ID: 930623980

View in Genome Browser
Species Human (GRCh38)
Location 2:53675894-53675916
Sequence CCTGCATTGCAGGGCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930623973_930623980 14 Left 930623973 2:53675857-53675879 CCACATAGCAAAAGTTTCTTTCA 0: 1
1: 0
2: 0
3: 21
4: 298
Right 930623980 2:53675894-53675916 CCTGCATTGCAGGGCATGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930623980 Original CRISPR CCTGCATTGCAGGGCATGGA GGG Intronic
900095626 1:938993-939015 CCTGCATCTCAAGGAATGGAAGG - Intronic
900105968 1:981163-981185 TCTTCCTTTCAGGGCATGGATGG - Intronic
900652302 1:3735680-3735702 CCAGCAGTGCAGGGGTTGGAGGG + Exonic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
900937502 1:5775800-5775822 CGTGCATTTCAGGGCCTGAATGG + Intergenic
901652075 1:10748801-10748823 CCATCATGGCAGGGCATGGTGGG - Intronic
901676950 1:10890904-10890926 CCTGCATTACAGGGCAGGGGTGG - Intergenic
903808526 1:26021963-26021985 CCTGCCTTGGAGGGCCAGGAGGG - Exonic
904350880 1:29905428-29905450 CCTGGGTTGCAGGGCAGGGCTGG + Intergenic
907225276 1:52940458-52940480 CCAGCATTGCAGGGCATAAAGGG + Intronic
907469779 1:54665812-54665834 CCTGCATGTCTGGGCCTGGATGG - Intronic
909762516 1:79309534-79309556 CTTGTCTTGCAGGGCATGAAAGG + Intergenic
911335278 1:96573951-96573973 TCTGTATTGCAGGGGATGAAGGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
911864682 1:103002781-103002803 TCTTCATTGCAGGGTATGGCAGG - Exonic
912451834 1:109772148-109772170 CCAGCAATGCGGGCCATGGAGGG + Intronic
913374184 1:118132724-118132746 CCTGCTTTGCAAGGCAAGGATGG - Intronic
915195467 1:154185748-154185770 CCTGCATGGCAGTGCCTGTAGGG - Intronic
916040090 1:160954319-160954341 TCTGCTGTGCAGGGCCTGGAGGG - Intronic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
916658593 1:166900177-166900199 CCTGCTGTGGAGGGCATGAAAGG - Intergenic
919011744 1:191974024-191974046 CCTGGATTTCAGGGTATGTATGG - Intergenic
919478573 1:198058016-198058038 TATGCAGTGCAAGGCATGGATGG + Intergenic
920501856 1:206490554-206490576 CCTGCAGTGCAGGGCCGGGGTGG - Intronic
920813751 1:209311447-209311469 CATACTTTGCAGGGCATGGATGG + Intergenic
921333764 1:214065847-214065869 CTTGGATTGCAGGGGATGGGCGG + Intergenic
922347626 1:224709468-224709490 GCTGCATGGAAGGGCATGGCAGG + Intronic
924927498 1:248697109-248697131 CATGCTTTGCAGTGCAAGGAAGG + Intergenic
1062996587 10:1872077-1872099 TCTGCATATAAGGGCATGGAGGG + Intergenic
1063947477 10:11191878-11191900 TCTGCATGGGAGGGCAGGGAGGG - Intronic
1064166024 10:12987071-12987093 GCTGCATACCAGGGAATGGAGGG - Intronic
1065628253 10:27653244-27653266 CCTGCATGGCAGGGAGTGGGTGG - Intergenic
1067751081 10:48971668-48971690 GGTGCCATGCAGGGCATGGAGGG + Intronic
1070266233 10:74905868-74905890 GTGGCATTGCAAGGCATGGATGG - Intronic
1070394544 10:76000768-76000790 CCTCAAATGCAGGGCACGGAGGG - Intronic
1073442656 10:103561704-103561726 CCTGCCTTGCAGGGATTGGAGGG + Intronic
1073861287 10:107744567-107744589 ACTGCAGGGCAGGGGATGGAAGG - Intergenic
1075030851 10:119023799-119023821 CCTGCCTTGCGGGGCAGGGTTGG + Intergenic
1075432056 10:122393918-122393940 ACTGCATTTCAGTTCATGGATGG - Intronic
1076689750 10:132216859-132216881 CCTGCATTTCAGAGGATGTATGG + Intronic
1080204447 11:29712878-29712900 CCTGCAGGGCAGGGCAGGGCTGG + Intergenic
1081012668 11:37834755-37834777 CATGCATGGCAAGGCATGTATGG - Intergenic
1083880491 11:65546052-65546074 CATGCAGTGCTGGGCCTGGATGG - Intronic
1084544840 11:69810094-69810116 CCTGCAATGCAGGGCATTTGTGG - Intergenic
1088548163 11:110982417-110982439 CCTGGAATGCAGGGCAGAGAGGG + Intergenic
1089353250 11:117833402-117833424 CCTGGATGGCAGGGACTGGAGGG - Intronic
1090235950 11:125147207-125147229 CCTGCCTGGCAGGGGAGGGAGGG - Intergenic
1090260529 11:125315593-125315615 ACTGCCTTGCAGGGCTGGGAGGG + Intronic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1090836181 11:130455749-130455771 GGTGCATGGCAGGGCAGGGACGG + Intronic
1091286097 11:134409394-134409416 CCTGCATTCCAGGACCAGGAGGG + Intronic
1092553499 12:9529268-9529290 ACTGCATTGTGGGACATGGAGGG - Intergenic
1093415775 12:18918975-18918997 CGTTCTTTGCAGGGCATGGCTGG + Intergenic
1094518599 12:31161355-31161377 ACTGCATTGTGGGACATGGAGGG + Intergenic
1097280503 12:57842793-57842815 CCTGCATAGCAAGCTATGGAAGG + Intronic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1101594303 12:106150386-106150408 TCTACATTGGAGGGTATGGAGGG - Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1103968123 12:124652974-124652996 CCTGCAGTGCAGGGGAGAGAAGG + Intergenic
1104347559 12:128015143-128015165 TCTGGACTGCAGGGCAGGGAGGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106219201 13:27731068-27731090 TCTGCATTGAAGTGGATGGATGG - Intergenic
1108345797 13:49545973-49545995 TCTGCATTGCATGGGGTGGAGGG - Intronic
1109184267 13:59250418-59250440 CCTGCATTGTTGGGGAAGGAGGG - Intergenic
1109494211 13:63146973-63146995 CCTGGATTTCAGGGGATGTATGG - Intergenic
1109517587 13:63464453-63464475 CCTGCCTTCAAGAGCATGGATGG - Intergenic
1113590333 13:111494385-111494407 AGTGGATGGCAGGGCATGGAGGG + Intergenic
1114209820 14:20605143-20605165 TCTGCAATGCGGGGCTTGGAGGG - Intronic
1115010809 14:28542410-28542432 ACTGCCTTGCATGGCATAGAAGG + Intergenic
1119439723 14:74620047-74620069 CCTTCATGGCAGGTCATGGGGGG - Intergenic
1119634580 14:76263648-76263670 TCAGCCTTGCATGGCATGGAAGG + Intergenic
1119743702 14:77029434-77029456 GCTGCAGTTCAGGGCAGGGAGGG + Intergenic
1119856060 14:77901834-77901856 CCAACAGTGCAGGGCTTGGAGGG + Intronic
1121338067 14:93089213-93089235 CCTGCAGTGAAGGGCCCGGAAGG + Intronic
1121629733 14:95413500-95413522 CCTGCCTTGCAGGGGATGGGAGG - Intronic
1121732301 14:96195110-96195132 CCTGCCTGGCAGGGCCTGGCTGG + Intergenic
1122395343 14:101424540-101424562 CCTGGATTGCAAAGGATGGAGGG - Intergenic
1123121731 14:105919850-105919872 CCAGCAATGCAGGACATGGCAGG + Intronic
1123404436 15:20011501-20011523 CCAGCAATGCAGGACATGGCAGG + Intergenic
1123513769 15:21018148-21018170 CCAGCAATGCAGGACATGGCAGG + Intergenic
1124693822 15:31847001-31847023 CCTGCTAGGCAGGGCAGGGAAGG + Intronic
1125864663 15:43034315-43034337 CCTGCATAGCTGGGCCTGCAGGG - Intronic
1125889204 15:43253171-43253193 CCAGCTTTGCAGGGGATGGGAGG - Intronic
1127104129 15:55595197-55595219 CCAGCACTGCAGGACCTGGAAGG + Intergenic
1129706184 15:77795904-77795926 TCTGGGTGGCAGGGCATGGAGGG - Intronic
1131116933 15:89801645-89801667 CCTGGATGGCAGGGACTGGAGGG - Intronic
1132944284 16:2524013-2524035 CCTGCACTGCAGTGCATGCTGGG - Intronic
1133043075 16:3070942-3070964 CCTAGATTTCAGGGGATGGATGG - Intronic
1133102181 16:3486289-3486311 CCTGCATCGGAGGGCAGGGCAGG - Exonic
1133218854 16:4309722-4309744 CCTGCATTCCAGGGCGGGGACGG - Intergenic
1133630289 16:7614015-7614037 GCTGCTTTGAAGGGCTTGGATGG - Intronic
1133678512 16:8098491-8098513 CCTGAATTGCAGCGAATGTAGGG + Intergenic
1134421486 16:14095110-14095132 CCTGAAAGGCAGTGCATGGAAGG + Intronic
1135547160 16:23374045-23374067 CCTCCATCACAGGGCCTGGAAGG + Intronic
1139137125 16:64218063-64218085 GCTGCATTGCCGGGCTTGCATGG + Intergenic
1141693390 16:85608709-85608731 CCTGCCTTGCAGGGCCGGGAGGG + Intergenic
1141842316 16:86580999-86581021 CCTGCCTGGCAGGGCTGGGAGGG - Exonic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142381241 16:89733460-89733482 CCTGCAATGAAGAGCATGCATGG - Exonic
1142967749 17:3591744-3591766 GCTGCAAGGCAGGGCAGGGAGGG - Intronic
1143205443 17:5137220-5137242 ACGGCACTGCAGGGCAAGGAGGG - Intronic
1143434592 17:6914258-6914280 CCGGCTTTGCAGGACAGGGAAGG + Intronic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1152543522 17:80989287-80989309 CCTCCACAGCAGGCCATGGAGGG - Intergenic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1153335100 18:3915420-3915442 ACTGCAGTGCAGCTCATGGAAGG + Intronic
1153551846 18:6270753-6270775 GCTGCACTGCAGGGGCTGGAGGG + Intronic
1157182407 18:45509564-45509586 ACAGCATTTCAGGTCATGGAGGG + Intronic
1161561105 19:4972876-4972898 CCCTCATTGCAGGGCGTGCAGGG - Intronic
1162460491 19:10811415-10811437 CCCCCAGTGCAGGGCATGGCAGG - Intronic
1163177319 19:15573475-15573497 CCTGCTATGCTGGGCCTGGAGGG + Intergenic
1163236010 19:16031209-16031231 GCTGCAGTCCAGGGAATGGAGGG - Intergenic
1163344417 19:16731170-16731192 TCTGCAAGGAAGGGCATGGAGGG - Exonic
1164634383 19:29781822-29781844 CCAGCACTGGAGGGCAGGGACGG + Intergenic
1165024503 19:32949797-32949819 GCTGCACTGCAGGCAATGGAAGG + Intronic
1166399276 19:42466064-42466086 CCTCCATGGCAGAGCATGGCAGG - Intergenic
925808042 2:7671855-7671877 CTTGCATTGCAGAGCTGGGAAGG + Intergenic
928778590 2:34793867-34793889 CCAGCTTTGCAGGGAAGGGAGGG - Intergenic
928836986 2:35559146-35559168 CCTAGATTTCAGAGCATGGATGG + Intergenic
929923920 2:46193743-46193765 TCAGCTTTGCATGGCATGGAAGG + Intergenic
930019834 2:46994869-46994891 CCAGCACTGCAGGGAATGGCTGG - Intronic
930623980 2:53675894-53675916 CCTGCATTGCAGGGCATGGAGGG + Intronic
930713087 2:54567494-54567516 CCAGTATTGCTGGGCATGGTGGG - Intronic
932808766 2:74806284-74806306 CTTGCAATCCAGGGCAGGGATGG + Intergenic
933243380 2:79947991-79948013 CCTTTCTTGCAGGGCAGGGACGG - Intronic
933893645 2:86791648-86791670 CCAGCAATGCAGGCCATGGGAGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
936095586 2:109528433-109528455 CCAGGAGGGCAGGGCATGGAAGG - Intergenic
937060435 2:118976801-118976823 CCTGCATGGCAGTGCAGGAAAGG - Intronic
937061047 2:118980733-118980755 CCTGCATTGCATGGCTGGCAAGG + Intronic
937885955 2:126900050-126900072 CCAGAAATGCAGGGCAGGGAGGG - Intronic
938228101 2:129635159-129635181 CCATCACTGCAGGGCAGGGAAGG + Intergenic
938234601 2:129695693-129695715 CCTAGATTTCAGGGCATGTATGG + Intergenic
942784896 2:179689464-179689486 CGTGCAGAGCAGCGCATGGAGGG + Intronic
944231554 2:197399003-197399025 CCTGCAATGCAGGGCATACTTGG + Intronic
948839237 2:240641070-240641092 CCTGGATGGCCGGGGATGGAAGG - Intergenic
1169093486 20:2875383-2875405 CGTGCATTGTAAGGCATGGTGGG + Intronic
1170017333 20:11796725-11796747 ATTGCATTGCTGGGCATGTAGGG + Intergenic
1170522748 20:17205225-17205247 AATGCATGGCAGGGCAGGGAAGG - Intergenic
1173185834 20:40839572-40839594 CCTGCATTGAGGGTAATGGATGG + Intergenic
1174036819 20:47673636-47673658 CATGCATTGAAGGGGATGGGAGG - Intronic
1174089398 20:48035022-48035044 CCTTCAGTGCAGGGCAGAGAAGG + Intergenic
1175976731 20:62714240-62714262 CCTGCAGCGCAGGGCATAGAGGG + Intronic
1176167567 20:63682048-63682070 CCTGCAGCCCAGGGCCTGGAGGG + Intronic
1176520763 21:7822367-7822389 GCTGGATGGCAGGGCAGGGATGG - Intronic
1178221835 21:30669226-30669248 CCTGGATTGCTGAGCATGTATGG + Intergenic
1178654787 21:34452379-34452401 GCTGGATGGCAGGGCAGGGATGG - Intergenic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183252205 22:36738079-36738101 CCAGCAGGGCAGGGCATGGCAGG - Intergenic
1183406086 22:37631353-37631375 CCTGCCTTCCTGGGGATGGAAGG - Intronic
1184451505 22:44585541-44585563 CCTGCCCTGCAGGCCATGGAGGG + Intergenic
1184799224 22:46750007-46750029 ACTGCCTTGCAGGGGATGAAGGG + Intergenic
1184799254 22:46750119-46750141 ACTGCCTTGCAGGGGATGAAGGG + Intergenic
1185129776 22:49032352-49032374 CCTGGAGAGCCGGGCATGGAGGG + Intergenic
1185181696 22:49367242-49367264 CCTGCAGTGCAGGGGCAGGAAGG - Intergenic
1185243368 22:49759029-49759051 CCAGCAGCGCAGGGCAGGGAAGG + Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
954320482 3:49829285-49829307 ACTGCAATGCAGGGCAAGAAAGG + Intronic
958650067 3:96927046-96927068 CCTGCATTTCAGAGAATGTATGG - Intronic
960871186 3:122251523-122251545 CCTTAATTGCAGGGCATGTCTGG - Intronic
971884333 4:32423851-32423873 ACTGCAATGCAGGCCCTGGAGGG + Intergenic
972295401 4:37732996-37733018 CCTGCATGGGAGGACATAGAAGG - Intergenic
973543714 4:51959566-51959588 CCTGCAATGCAGTGCAGTGAAGG - Intergenic
975367220 4:73544064-73544086 CCCGCATTCCAGGGCAATGATGG - Intergenic
977545054 4:98367312-98367334 CCTACATTGCAGGAAATGTATGG + Intronic
981688437 4:147480896-147480918 CCTGCCCTTCAGGGCCTGGAAGG + Intronic
982781537 4:159496308-159496330 CCTGCTTTACAAGGCATGGGAGG - Intergenic
985105739 4:186498306-186498328 CTTGCATGGAAGGGCATTGAAGG + Intronic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986282454 5:6334802-6334824 CATGAATTCCAGGGCCTGGATGG - Intergenic
986693200 5:10330887-10330909 CATGTGTTGCTGGGCATGGATGG + Intergenic
986939958 5:12937580-12937602 CCTGCAGTGAGGGGCTTGGAGGG - Intergenic
989105250 5:37857158-37857180 CCTACATTGCTGGGCATATAGGG - Intergenic
989163970 5:38417011-38417033 TCTGCATTACAGGGTAAGGAAGG - Intronic
990561367 5:56986681-56986703 CCTGCAATATAGGGCATGGTTGG - Intergenic
990621771 5:57567702-57567724 ACTGCATTCCAGGGCATCGATGG - Intergenic
991961663 5:72050880-72050902 CCTACAGCCCAGGGCATGGAGGG - Intergenic
993696141 5:91064003-91064025 GCTACAGTGCTGGGCATGGAAGG - Intronic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
997411759 5:133696237-133696259 CCTGGTTTTCAGGGCATGCAGGG + Intergenic
999314511 5:150575269-150575291 CCTCCATGGCAGGGCCAGGATGG - Intergenic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1000442381 5:161279296-161279318 CCAGGATTGCAGGCCATGGATGG + Intergenic
1002889908 6:1323663-1323685 CCCACATTGCATGCCATGGATGG - Intergenic
1003255823 6:4474159-4474181 GCTGCAGTCCAGGGAATGGATGG - Intergenic
1003329881 6:5121108-5121130 ACTCCATTGCAGGGCAGGGGTGG - Intronic
1005125226 6:22439214-22439236 CCAGCATTGGAGGCCAAGGAGGG - Intergenic
1006937023 6:37725715-37725737 TCTGCTTGGCAGGGCATGGGTGG - Intergenic
1007072538 6:39048140-39048162 TCAGCATTGCAGGGCAGGGAGGG - Intergenic
1010605955 6:77889966-77889988 CCTACATTTCAGAGCATGTATGG + Intronic
1011741555 6:90365705-90365727 ACTGGATTGCAGGGCTTGGTTGG - Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1017996468 6:159535559-159535581 CCTCAATTGCAGGGCTTGGATGG - Intergenic
1018710329 6:166494149-166494171 CTGGCTTTGCAGGGTATGGAGGG + Intronic
1018932958 6:168253995-168254017 TCTACACTGCAGGCCATGGATGG + Intergenic
1019173939 6:170150293-170150315 TCTGCATTGCAGGTAGTGGAGGG - Intergenic
1019607292 7:1916611-1916633 ACTCCCTTGCAGGGCCTGGAGGG - Intronic
1021605451 7:22405186-22405208 CCTGCCTAGCTGGGCATGGTTGG - Intergenic
1022975121 7:35549656-35549678 CTTGCTTTGCAGGGCATGAAGGG - Intergenic
1023378726 7:39584979-39585001 CCTGTAATGCAGGACATGCAAGG - Intronic
1024164837 7:46720618-46720640 ACTGCAGAGAAGGGCATGGAAGG - Intronic
1026122787 7:67552084-67552106 GCTGCATTGCAAGGCATGTTGGG + Intergenic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1029670855 7:102029734-102029756 CCTGCATCCCAGGGCTTGGATGG + Intronic
1031479370 7:122259350-122259372 CCTGCATTTAAAGGCAAGGAGGG + Intergenic
1032485838 7:132286852-132286874 ACTGCCTTCCAGGGGATGGAGGG - Intronic
1032993065 7:137415156-137415178 CCTGCGTTGAAGGACAAGGAAGG + Intronic
1035274628 7:157740418-157740440 CCTGCCTTGCCGTGGATGGAGGG - Intronic
1037015514 8:13901415-13901437 TCTTCATGGCAGGCCATGGAAGG - Intergenic
1038166333 8:25088211-25088233 TCTGCAGGGCAGGGCAAGGAAGG + Intergenic
1038329329 8:26595721-26595743 GCTGCACTGCTGGGCATGGTAGG - Intronic
1039659142 8:39444572-39444594 CCTTCCTTGCTGAGCATGGAAGG - Intergenic
1040313936 8:46251054-46251076 GCAGCATTGCAGGGAATGGTGGG + Intergenic
1042676359 8:71326531-71326553 CCCGCCCTGCATGGCATGGATGG - Intronic
1044737024 8:95289296-95289318 ACTGCATTGCAGGTAGTGGATGG - Intergenic
1045318038 8:101060000-101060022 CCTGAATCACAGTGCATGGAGGG - Intergenic
1046198275 8:110890884-110890906 TCTGCAATGAAGGGCTTGGAGGG + Intergenic
1047404385 8:124573133-124573155 CCTGCCCTGCAAGGCATGAAAGG + Intronic
1048344493 8:133566520-133566542 CCTGCAATGCGGGGGATGCAGGG - Intronic
1048465814 8:134664070-134664092 CCTGCACAGGAGGTCATGGAAGG + Intronic
1049428715 8:142549442-142549464 TCTGGAGTGCAGGGCCTGGAGGG + Intergenic
1052216511 9:25972609-25972631 CCTGCATTGCATCCCATGAAGGG + Intergenic
1052845090 9:33328473-33328495 CTGGAGTTGCAGGGCATGGAGGG + Intronic
1055107108 9:72524619-72524641 CTTTCATTGCAGGGAAAGGAAGG - Intronic
1055228380 9:74029530-74029552 CCTGCATAGCAGGGCACGAACGG - Intergenic
1057438838 9:95067028-95067050 CCTGTATTTCAGGGCATTTAAGG - Intronic
1057646831 9:96884341-96884363 CCTTCATGACAGGGCCTGGAGGG - Intergenic
1060435550 9:123589811-123589833 CCTGCCTTTCAGGCCAGGGAAGG + Intronic
1061595814 9:131628508-131628530 CCTGCATGGGAAGGCAGGGAGGG - Intronic
1186583545 X:10847069-10847091 GCTGAATTGCAGGGCCTGGGTGG + Intergenic
1189364084 X:40374801-40374823 CCTGCTTTTGAAGGCATGGAAGG + Intergenic
1189558140 X:42166206-42166228 CCTGCATGGCTGGGCATGGAGGG - Intergenic
1194895292 X:99432584-99432606 CCTGCATTTCAGAGGATGTATGG + Intergenic
1198218812 X:134581157-134581179 CCTGGATGTCAGGGCTTGGATGG + Intronic
1198741138 X:139844413-139844435 CCTGCATTGCAGGTATTGCAGGG - Intronic
1200878046 Y:8180355-8180377 CCTGCATTCCAGGTCCTGGGAGG - Intergenic