ID: 930624306

View in Genome Browser
Species Human (GRCh38)
Location 2:53679469-53679491
Sequence ATGGAGAAGAAAGATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1651
Summary {0: 1, 1: 0, 2: 17, 3: 193, 4: 1440}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930624306_930624308 -10 Left 930624306 2:53679469-53679491 CCATCCTCATCTTTCTTCTCCAT 0: 1
1: 0
2: 17
3: 193
4: 1440
Right 930624308 2:53679482-53679504 TCTTCTCCATCTCAAAGAAATGG 0: 1
1: 0
2: 5
3: 51
4: 425
930624306_930624309 -9 Left 930624306 2:53679469-53679491 CCATCCTCATCTTTCTTCTCCAT 0: 1
1: 0
2: 17
3: 193
4: 1440
Right 930624309 2:53679483-53679505 CTTCTCCATCTCAAAGAAATGGG 0: 1
1: 0
2: 3
3: 30
4: 307
930624306_930624313 22 Left 930624306 2:53679469-53679491 CCATCCTCATCTTTCTTCTCCAT 0: 1
1: 0
2: 17
3: 193
4: 1440
Right 930624313 2:53679514-53679536 AGGCTAATCCCGTCTCCAACTGG 0: 1
1: 0
2: 0
3: 3
4: 36
930624306_930624311 2 Left 930624306 2:53679469-53679491 CCATCCTCATCTTTCTTCTCCAT 0: 1
1: 0
2: 17
3: 193
4: 1440
Right 930624311 2:53679494-53679516 CAAAGAAATGGGTCTACCTGAGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930624306 Original CRISPR ATGGAGAAGAAAGATGAGGA TGG (reversed) Intronic
900031452 1:375790-375812 GGGGAGAAGAGAGATAAGGAGGG - Intergenic
900052003 1:603990-604012 GGGGAGAAGAGAGATAAGGAGGG - Intergenic
900738817 1:4317910-4317932 AAGGATAAGATAGATGAAGAGGG + Intergenic
900748635 1:4379007-4379029 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
900803495 1:4752178-4752200 AGGGAGGAGAGAGAGGAGGAGGG + Intronic
901037996 1:6347945-6347967 ATGGGGAGGAAAGATGAAGGAGG - Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901670759 1:10855242-10855264 ATGACTGAGAAAGATGAGGAGGG - Intergenic
901761006 1:11471617-11471639 AAGGAGAAGGAAGAGGAGAAGGG + Intergenic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902255479 1:15186321-15186343 ATGGACAGGAAAGACGGGGAAGG + Intronic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902533697 1:17106760-17106782 TAGGAGAAGAAAGATGAGAGAGG + Intronic
902653840 1:17854073-17854095 GGGGAAAAGAAAGAAGAGGAAGG - Intergenic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902990573 1:20184855-20184877 ATTGAGAAGAAAGGAGAGGCTGG + Intergenic
903189612 1:21649360-21649382 ATAGAGAAGAAAAAAAAGGAAGG + Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903426012 1:23254823-23254845 ATGAAGTTGAAAGATGGGGAAGG - Intergenic
903965302 1:27085067-27085089 AAGGAGAAGAAAGAGAAGAAGGG - Intergenic
903986132 1:27230387-27230409 AAGGAGAAGAAAGAAGAAGATGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904302786 1:29566193-29566215 GTGGAAAAGAGAGGTGAGGAAGG + Intergenic
904347463 1:29882540-29882562 ATGGAGAAGAAACCAGAGCAGGG + Intergenic
904797849 1:33070858-33070880 AAGGAGGAGGAAGATGAAGAAGG + Intronic
904848831 1:33441526-33441548 AAGGAGGAGAAAGAGGAAGAAGG - Intergenic
904983354 1:34524848-34524870 ATGGGGAAGAAAGGTGAGGATGG - Intergenic
905203703 1:36330671-36330693 ATGGAGGAGATGGTTGAGGAAGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905575798 1:39043701-39043723 AAGAAAAAGAAAGAAGAGGAAGG + Intergenic
905585228 1:39111960-39111982 ATGGAGAAGAGAGATGTGTTAGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906827421 1:48996464-48996486 GTGGAGAAGAAAGAGGACTAAGG + Intronic
906852953 1:49271708-49271730 ATGGAGAAGAAGGAGGGGTAGGG - Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907190741 1:52645928-52645950 TTGGAAAACAAAGAAGAGGAGGG + Intronic
907233606 1:53024368-53024390 ATGGAGATGAAAGGTGATGATGG + Intronic
907665857 1:56433334-56433356 CTGAAGTAGGAAGATGAGGAAGG - Intergenic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907816357 1:57921896-57921918 CTGGAGCAGAAAGATCAAGAAGG - Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908652724 1:66353591-66353613 ACAGAGGGGAAAGATGAGGAGGG + Intronic
908656018 1:66389778-66389800 ATGGAGAATAACGATGAAAATGG + Intergenic
908737726 1:67293277-67293299 ATGGGGCAGAAAGATGCAGAGGG - Intergenic
909421781 1:75475305-75475327 AAGGAAAGGAATGATGAGGAAGG + Intronic
909779060 1:79520066-79520088 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
909779082 1:79520191-79520213 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
910087064 1:83416038-83416060 ATGCAGATGAGAGATGAGGAAGG + Intergenic
910107447 1:83646752-83646774 ATGGAGAATAAACATGAGTAGGG - Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911136429 1:94445633-94445655 CTGGAAAAGAAAGATCTGGAGGG - Intronic
911185856 1:94904452-94904474 ATGGAGAACACAGCTGAGGCAGG + Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911854247 1:102856605-102856627 ATGGAAAATAAAGAAAAGGAGGG - Intergenic
912516405 1:110219269-110219291 ATGGAGATAAGAGTTGAGGAGGG - Intronic
912965632 1:114234843-114234865 AACCAGAAGAAAGATGAGAAAGG - Intergenic
913319450 1:117578120-117578142 ATGGAGAGGAAAGTTGTTGAGGG - Intergenic
913365559 1:118034193-118034215 ATGGATGAGACAGATAAGGAGGG + Intronic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
913978932 1:143490199-143490221 ATAGTGAAGAAAGATGACGTAGG + Intergenic
914073337 1:144315848-144315870 ATAGTGAAGAAAGATGACGTAGG + Intergenic
914105817 1:144650512-144650534 ATAGTGAAGAAAGATGACGTAGG - Intergenic
914761728 1:150604536-150604558 ATGGGGCAGAATGAAGAGGAAGG + Intronic
914918314 1:151831553-151831575 CTGGAGGAGAAACAGGAGGAGGG - Intronic
914923516 1:151863932-151863954 CTGGAGAAGGCAGAGGAGGAAGG - Intergenic
914960121 1:152197567-152197589 AGGGAGAAGAAAGGAGGGGAAGG - Intergenic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915179775 1:154048205-154048227 CTGGAAAAGAAAGATCTGGAGGG - Intronic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915871287 1:159562203-159562225 AAAGAGAAGAAAGAAAAGGAAGG + Intergenic
915895396 1:159807911-159807933 AGGGAGAGGAAAGAAGGGGAGGG + Intronic
915897041 1:159820180-159820202 GAGGAAGAGAAAGATGAGGATGG - Intergenic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916323341 1:163530419-163530441 ATGGAGAAGAAGGGGAAGGAAGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916651102 1:166835540-166835562 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916802943 1:168231611-168231633 AAGGAAAAGACAGAGGAGGAAGG - Intronic
916943990 1:169705821-169705843 ATCTAGAAGAAAGATAATGACGG + Intronic
916944851 1:169716220-169716242 CTGGTGAAGTAAGATGAGGATGG - Intronic
916967215 1:169961666-169961688 GAGGAGGAGAAAGAAGAGGAGGG - Intronic
917147943 1:171912597-171912619 AGGGAGACAAAAGAAGAGGAAGG + Intronic
917218574 1:172703506-172703528 ATGAAGAATAAAGTGGAGGATGG + Intergenic
917274309 1:173315035-173315057 ATAACAAAGAAAGATGAGGAAGG + Intergenic
917289638 1:173459924-173459946 ATGGAGAAGAGAGAAAAGCAAGG + Intergenic
917476214 1:175371552-175371574 ATGGAAAAGAATAATGACGAAGG + Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917683723 1:177394681-177394703 AAGGTGAAGAAAGTTGAGAAGGG + Intergenic
917725820 1:177826209-177826231 AAGGAGAAGAAACCTGAAGATGG - Intergenic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919906296 1:202080749-202080771 AAGCAGAAGAAAGAAAAGGATGG + Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920254643 1:204646139-204646161 ATGGTGAGAAAAGATGGGGAGGG + Intronic
920283742 1:204863869-204863891 AAGGAAAAGAAAGAAAAGGAAGG + Intronic
920427730 1:205891554-205891576 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
920757525 1:208748549-208748571 AGGGAGAAGGAAGGTGAAGAGGG - Intergenic
920790042 1:209081424-209081446 ATGTAGAATAAAGAGGAGGGAGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921151531 1:212406924-212406946 AGGCAGGAGAAAGAAGAGGAGGG - Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
921843993 1:219859940-219859962 TTGGAGAAGAAAGGTGGGGATGG - Intronic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
922187931 1:223292955-223292977 ATGCTGAAGAGAGTTGAGGAGGG + Intronic
922222643 1:223620201-223620223 CTGGACAAGAAAGTTGAGGATGG - Exonic
922416347 1:225426863-225426885 AGGGAGAAGAACGAGCAGGAGGG - Intronic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922936332 1:229425902-229425924 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
924003028 1:239574723-239574745 AGGGAAAAGAAAGAAGAAGAAGG - Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924190516 1:241546862-241546884 ATGGAGAAGACAGACTTGGATGG + Intronic
924481172 1:244435637-244435659 ATGGAGGAGGAAGAGAAGGATGG - Intronic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
1062806749 10:427237-427259 ATGGACTTTAAAGATGAGGAGGG - Intronic
1062859494 10:799393-799415 ATGGAAAACAAAGAAGAGCAGGG + Intergenic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1062985222 10:1762082-1762104 ATGGAGCTGAAAGTTGGGGAGGG - Intergenic
1063164814 10:3451679-3451701 ATTTAGAGGAAAGAGGAGGAGGG - Intergenic
1063312576 10:4968409-4968431 ACGGATAAGAAAGATGAGGTAGG + Intronic
1063315357 10:4999155-4999177 ACGGATAAGAAAGATGAGGTAGG - Intronic
1063350959 10:5354657-5354679 AGGGAGAAGAAATATGGAGAAGG - Intergenic
1063426248 10:5952314-5952336 AAGGAGGAGAAAGAGTAGGAAGG - Intronic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063889880 10:10618321-10618343 ATGGAGGATTAAGATGAAGAGGG - Intergenic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064462799 10:15551253-15551275 ATGGATGAGAGAGAAGAGGAGGG + Intronic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1064662910 10:17624151-17624173 AGGGAAAAGAAAGTTGAGGTAGG + Intergenic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065387142 10:25144792-25144814 ATGGAGAATGAAGAAGAAGAAGG + Intergenic
1065480642 10:26190384-26190406 ATGGAGAAGAATGATGACTGCGG + Intronic
1065659096 10:27987032-27987054 ATAGAGAAGACAGATGACAAGGG - Intronic
1065965452 10:30766899-30766921 ATGGAGGAGAACGAGGAGGCGGG - Intergenic
1066129736 10:32381298-32381320 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066347810 10:34606343-34606365 GAGGAGGAGAAAGATGAGGCTGG + Intronic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1066591737 10:37002231-37002253 AAGAAGAAGAAAGTTGTGGAAGG + Intergenic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067452145 10:46388343-46388365 ATGGACAGGAAAGGTGAGGCAGG + Intronic
1067585092 10:47471412-47471434 ATGGACAGGAAAGGTGAGGCAGG - Intronic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1068033189 10:51728717-51728739 ATGGAATAGAATGATGAGAAAGG + Intronic
1068150576 10:53125533-53125555 AAGGAGGAGGAAGACGAGGAGGG - Intergenic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1068864288 10:61878715-61878737 ATGAAGAAGAAAGTTGATGGTGG - Intergenic
1069026650 10:63549807-63549829 GGGAAGAGGAAAGATGAGGAGGG + Intronic
1069056323 10:63848290-63848312 CTGGAAAAGAAAGATCCGGAGGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069351551 10:67532701-67532723 AAGGAGAAGAAAGATGGGACAGG + Intronic
1069536982 10:69261112-69261134 TTGGAGAAGAAGGATAAGGTTGG - Intronic
1070164385 10:73886942-73886964 CTGGAGAAGGAAGAGCAGGAAGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070627625 10:78062456-78062478 AGGGAAGAGAAAGAAGAGGATGG - Intergenic
1070802381 10:79251206-79251228 GTGGAGAAGACAGGAGAGGAGGG - Intronic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071119700 10:82263196-82263218 GTGGGAAAGAAAGATGTGGATGG + Intronic
1071156050 10:82690966-82690988 AAGAAGGAGAAAGAGGAGGAAGG - Intronic
1071186924 10:83057307-83057329 TTGGAGAAGAAAGATGGGCTGGG + Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1072645673 10:97251633-97251655 AGGGAAAAGGAAGAAGAGGAGGG + Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073021561 10:100448968-100448990 AAGGAGAAGAAAGAAGAAGAAGG + Intergenic
1073056759 10:100708047-100708069 AAGGAGAAGGAAGGGGAGGACGG + Intergenic
1073070753 10:100791775-100791797 ATGGAGATGGCAGGTGAGGAGGG - Intronic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073855266 10:107666241-107666263 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075330937 10:121573614-121573636 AGGGAGAGGAAAGAAGAGGAAGG + Intronic
1075352402 10:121735384-121735406 ATGCAGAAGAATGATGCAGAAGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076039497 10:127232040-127232062 ATGGAGAAGGCAGAAAAGGAGGG + Intronic
1076471012 10:130718249-130718271 AGGGAGAAGGAAGAAGAGAAGGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078448935 11:11426036-11426058 TTTGACAAGGAAGATGAGGAGGG + Intronic
1078453042 11:11454449-11454471 AGGGAGAAGGAAGATAAGGAGGG + Intronic
1078456216 11:11477502-11477524 AGGGAGAGGAAAGGTGTGGAGGG - Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078593351 11:12665127-12665149 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1079259733 11:18866905-18866927 ATGGAGAAGGAAGAGGGGAAGGG - Intergenic
1079362581 11:19781509-19781531 ATTGAGAATAATGATGATGAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079796167 11:24805799-24805821 ATGGAGAAGTAAGACGAGAAAGG + Intronic
1079810946 11:24999353-24999375 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080087420 11:28301255-28301277 AGGGAGATGAGAGAAGAGGAAGG - Intronic
1080969223 11:37250063-37250085 AAGGAAAAGAAACATGTGGAAGG + Intergenic
1081134778 11:39426710-39426732 GTGGAGAGGAAAGGGGAGGATGG + Intergenic
1081404731 11:42683837-42683859 AATCAGAAGAAAGATGAAGATGG + Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1081867406 11:46367263-46367285 GAGGAGAAGACAGCTGAGGAGGG - Intronic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082778904 11:57270994-57271016 ATGGACAAGGAACATGGGGAGGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083186449 11:61020567-61020589 ATGAGGAAGAAAGAGGGGGAAGG + Intergenic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083296982 11:61720220-61720242 ATGCAGGAGAAAGAGGAAGATGG - Exonic
1083996574 11:66276015-66276037 AGGGAGAGGAGAGAAGAGGAGGG - Intronic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084534428 11:69748305-69748327 ATGGAGAAGAAAGAAAGGGAGGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1085167967 11:74420984-74421006 ATGGAAAAGAAAGACCAGTATGG - Intergenic
1085314850 11:75538584-75538606 AGGGAGAAGAAAGAGGACCAAGG + Intergenic
1086121840 11:83312594-83312616 TTGGAAAAGAAAGCTCAGGATGG - Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086302507 11:85442909-85442931 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
1086348603 11:85922731-85922753 ATGGAGAAGAGTGATGAGAAGGG - Intergenic
1086607614 11:88715008-88715030 ATGAAAATGAAAGATGGGGAAGG + Intronic
1086875241 11:92087922-92087944 AGGGAGAGGAAAGATGGAGAGGG - Intergenic
1086944951 11:92835909-92835931 ATGGGGAAGGATGGTGAGGAGGG - Intronic
1087149229 11:94843679-94843701 ATGGAGGAGAAACATTAGGGAGG + Intronic
1087260215 11:96002665-96002687 ATGAAGAATAATGATGGGGATGG + Intronic
1087261564 11:96017998-96018020 ACGGAGAAAGAAGATGAGTAAGG + Intronic
1087304157 11:96469488-96469510 GTGGAGTAGAAAGAAGAGGAGGG + Intronic
1087547350 11:99601710-99601732 TTGGAGAACAGAGATGAGGTGGG - Intronic
1087661898 11:100998157-100998179 CTCCAGAAGAAAGATGAAGATGG + Intergenic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088389967 11:109303344-109303366 AGGGAGAACATAGATGAAGAGGG - Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088491955 11:110397073-110397095 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1088602545 11:111494132-111494154 ATGGAGATGAGAGAGGAGAAGGG + Intronic
1088864874 11:113838145-113838167 ATGGAGAAGATAGCTGAGTAAGG - Intronic
1089474909 11:118751803-118751825 AAGGAAAAGAAAGAAGAGAAGGG - Exonic
1089538294 11:119173953-119173975 ATGGAGCACAAAGAGGAGGTGGG - Exonic
1089872121 11:121684866-121684888 AGGGTGAAGACACATGAGGAAGG + Intergenic
1089925009 11:122248197-122248219 ATAGAGAAGAAATAAGAGGCAGG + Intergenic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090167958 11:124571231-124571253 AGGAAGAGGAAAGAAGAGGAAGG - Intergenic
1090464632 11:126923319-126923341 AAGGAGAAGGAAGAAGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090510871 11:127373750-127373772 AGAGATAGGAAAGATGAGGAAGG - Intergenic
1090549560 11:127805384-127805406 ATGGAGGAGAAAGTTAAGGCAGG + Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090748635 11:129727218-129727240 ATGGAGAAGGAATCGGAGGAAGG + Intergenic
1091093910 11:132799438-132799460 ATGGAGAAGGAAGGAGATGAGGG + Intronic
1091238265 11:134035988-134036010 ATAGAAAAGGAAGACGAGGATGG + Intergenic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091933452 12:4415888-4415910 ATGGGGAAGGAAGAGCAGGAAGG + Intergenic
1092092182 12:5812290-5812312 AGGGGAAAGAAAGAAGAGGAAGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1093364823 12:18280928-18280950 TAGAAGAAGAAAGATGAGGAAGG + Intronic
1093427163 12:19041050-19041072 TTGGAGAACAAAGCTGAGGAAGG + Intergenic
1093572241 12:20679812-20679834 ATGGGGAAAAAAGAGGAAGATGG - Intronic
1094160603 12:27385959-27385981 ATGCACAGGAATGATGAGGACGG - Intronic
1094285676 12:28790367-28790389 AGGCAGAACAACGATGAGGAAGG - Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095196858 12:39329455-39329477 AAGGAGGAGAAAGATGAAGAAGG + Intronic
1095205007 12:39429849-39429871 GAGGAGAAAAAAGAAGAGGAGGG + Intronic
1095237251 12:39812429-39812451 AAAGAGAAGAAAGAAAAGGAAGG - Intronic
1095344709 12:41136457-41136479 GTAGAGAAGAAAGAAGAGAAGGG + Intergenic
1095489117 12:42714683-42714705 ATGAATAAGAAAGACAAGGACGG + Intergenic
1095824736 12:46519370-46519392 ATAGAGAAGAAAGAAGAGAAAGG - Intergenic
1095856158 12:46863044-46863066 TTGGGGAAGAAATATGTGGATGG - Intergenic
1095912997 12:47447876-47447898 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096173386 12:49492797-49492819 AAGAAAAAGAAAGATGAGGCCGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097098260 12:56567445-56567467 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1097170130 12:57108101-57108123 AAGGAGAAGGAAGATGAGTTAGG + Intronic
1097263285 12:57731700-57731722 ATAGGGAAGATAGATGAAGAAGG + Intronic
1097323502 12:58250452-58250474 AGGGAGGAGAAATATGGGGAGGG + Intergenic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1097701669 12:62826902-62826924 AGTGATAAGAAAGATAAGGATGG - Intronic
1097926447 12:65133867-65133889 ATGGAGAAGAAAGAAAGGAAGGG + Intergenic
1098009381 12:66034154-66034176 AGGGAGAGGGAAGAGGAGGAAGG + Intergenic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099174580 12:79406055-79406077 ATGGAAATGAAAGAGGAGAAAGG + Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099356606 12:81645208-81645230 AAGGAGAAGAAAGAGAAAGAAGG + Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1099649836 12:85411706-85411728 ATGGGGAAGAAAGACGGGAAGGG + Intergenic
1099836769 12:87916321-87916343 ATAGAAAAAAAAGATTAGGATGG + Intergenic
1099986732 12:89674374-89674396 AAGGAAAGGAAAGATAAGGATGG + Intronic
1100658259 12:96669890-96669912 ATGGAGCATAAACTTGAGGATGG + Intronic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1100950704 12:99846274-99846296 ACAGAGAAGAGAGAAGAGGAGGG - Intronic
1101084893 12:101225921-101225943 GAGGAGGAGAATGATGAGGAGGG - Intergenic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101646966 12:106640311-106640333 AAGGAAAAGAAACATCAGGAAGG + Intronic
1101704334 12:107207363-107207385 GTAGAGCAGAAAGATGAGGAAGG - Intergenic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1101807513 12:108077307-108077329 ATGGAGCAGAGAGTTGAGGCTGG - Intergenic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102167991 12:110821209-110821231 TTTGAGAAGAAAGAAGAGGCTGG - Intergenic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102464196 12:113119057-113119079 AGGGGGAAGAAAGATGAGACGGG - Intronic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1102764792 12:115423205-115423227 AGGGAGGAAAAAGAGGAGGAGGG + Intergenic
1102913663 12:116737526-116737548 AAGGAGGAGGAAGGTGAGGAAGG + Intronic
1103074111 12:117968611-117968633 AAGGAGGAGAGAGAGGAGGAGGG + Intronic
1103285340 12:119796365-119796387 ATGAGGAAGAAAGATGGGTATGG + Intronic
1103341094 12:120221562-120221584 AGGGAGGAGAAGGATGAGGGAGG + Intronic
1103508125 12:121454996-121455018 CTGGAGAAGAAAGTTGATGGTGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103829569 12:123768086-123768108 ACGGAGAAGAAAGATACAGAGGG - Intronic
1103896617 12:124277670-124277692 GGGGAGGAGAAAGAGGAGGAAGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104415335 12:128593067-128593089 AGAGAGAAGGAAGATGAGAAAGG - Intronic
1104433545 12:128737005-128737027 CTGAAGAAGAAAGAAAAGGAAGG + Intergenic
1104434203 12:128742892-128742914 TTGCAGAAGAAAGATGCGGGAGG + Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104498974 12:129266550-129266572 ATGAAGAGGAAAGGAGAGGAAGG - Intronic
1104637358 12:130446686-130446708 AGGGAGGAGAGAGATGAGGTTGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104710511 12:130982534-130982556 AAGAAGAAGGAAGAAGAGGAGGG - Intronic
1105220401 13:18321194-18321216 ATAGTGAAGAAAGATGACGTAGG - Intergenic
1105269088 13:18854175-18854197 AAGAGAAAGAAAGATGAGGAGGG - Intergenic
1105352352 13:19627185-19627207 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1105401310 13:20098583-20098605 GTGGAGCAGAAAGATAAAGAAGG + Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1105965500 13:25380204-25380226 AGGGAGATGAGAGATGAGGGAGG + Intronic
1106054277 13:26223341-26223363 AAGCAGAAGAAAGATCTGGAAGG - Intergenic
1106060605 13:26287564-26287586 TTGGAGGAGAAAGGTGGGGAGGG + Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1106897581 13:34321301-34321323 ATGGAGAAGAATCATGATAAAGG + Intergenic
1107045079 13:35985183-35985205 GTGGAGAAGGATGATGTGGAAGG - Intronic
1107053721 13:36080188-36080210 ATGAAGAAGGAAGGTGAGAAAGG + Intronic
1107119015 13:36778060-36778082 ATGGAGAAGGAAGAAAAGCAGGG + Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1107921215 13:45210239-45210261 AGGGAAGAAAAAGATGAGGATGG - Intronic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108470835 13:50765447-50765469 AGGAAGGAGAAAGAAGAGGAGGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1108749401 13:53432144-53432166 ATAGAGAAGAAAGCAGACGATGG + Intergenic
1108892969 13:55284796-55284818 AAGGAGAAGAAAGAAGAAGCAGG + Intergenic
1109078583 13:57868495-57868517 ATGGAGAACAAAGAAGAGCAGGG + Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1110124641 13:71927479-71927501 AGGATGGAGAAAGATGAGGAGGG + Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110268643 13:73568371-73568393 ATGGAGAGAAGAGATGAAGAAGG - Intergenic
1110369195 13:74720716-74720738 ATGGAAAAGAGAGGTCAGGAAGG - Intergenic
1110666482 13:78123588-78123610 GTGGAGAAGAATGGTGAAGAAGG + Intergenic
1110863971 13:80374494-80374516 ATGGAGAAGAAACATGAACCGGG + Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1110957907 13:81579380-81579402 GTGGGGCAGAAAGATGAGAAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111208651 13:85047311-85047333 ATGGAGAAGAATGATGATGGAGG + Intergenic
1111537413 13:89621162-89621184 ATGGAGAGGAAAGAAGAGAAAGG - Intergenic
1112016677 13:95336951-95336973 ATGCAGAACTTAGATGAGGAAGG + Intergenic
1112404350 13:99105102-99105124 AAGAAGAAGGAAGATGAAGAGGG - Intergenic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1112810255 13:103210027-103210049 GTGGCAAAGAAAGATGAAGATGG + Intergenic
1112839128 13:103553724-103553746 GAGGAGGAGAAAGAAGAGGAGGG - Intergenic
1113141842 13:107161261-107161283 TTGAAGGAGGAAGATGAGGAGGG + Intergenic
1113258633 13:108534996-108535018 AGGAAGAGGAAAGAAGAGGAAGG - Intergenic
1113288242 13:108877633-108877655 ATGGAAAATAAATATGAGAAAGG - Intronic
1113639917 13:111949856-111949878 ATGGGGAAGAAGGATGAGCCAGG + Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1114166354 14:20222671-20222693 ATGGAAAAGCAAGATAATGAAGG + Intergenic
1114197986 14:20495714-20495736 AGGGAGAGGAAGGAAGAGGAGGG - Intergenic
1114207020 14:20581611-20581633 TAGGAGAAGGAAGCTGAGGATGG - Intergenic
1114403937 14:22436373-22436395 ATGGCCCAGACAGATGAGGATGG - Intergenic
1114452317 14:22835529-22835551 AGGGAGAAGAAAGCAAAGGAAGG - Intergenic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1114970883 14:28026997-28027019 AAGGAGGAGAGAGAAGAGGAGGG + Intergenic
1115364145 14:32537468-32537490 ATGGAGATCAGAGATGAGGAAGG + Intronic
1115459514 14:33644784-33644806 ATCAAGAATAAAGATGAGGCCGG + Intronic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1115885866 14:37970961-37970983 TTGGAGCAGTGAGATGAGGAAGG - Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116238689 14:42313312-42313334 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1116255291 14:42547489-42547511 ATGGACAAGAGAGAGGCGGAAGG + Intergenic
1117197559 14:53355695-53355717 GTAGAGAAGAAAGGAGAGGAGGG + Intergenic
1117441087 14:55759997-55760019 CTGGCAAAGAAAGATGAGCAGGG - Intergenic
1117667837 14:58076070-58076092 AAGGAGGAGAAAGAGGAGGAAGG + Intronic
1117679170 14:58185593-58185615 GTGGGAAAGAAAGATGATGAAGG + Intronic
1118574159 14:67224770-67224792 ATGGAAAAGAAAGATGGGTAAGG - Intronic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1118815287 14:69308051-69308073 AAGGAGAGGAAAGTGGAGGAGGG - Intronic
1119039974 14:71264727-71264749 AAGGGAAAGAAAGCTGAGGAAGG - Intergenic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119071983 14:71595755-71595777 AAGGAGAGCAATGATGAGGAGGG - Intronic
1119193121 14:72697764-72697786 ATGGAGAGGAAAAATGGGGTGGG + Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120046675 14:79815565-79815587 AAGGCGAAGAAAGAGGAGGAGGG + Intronic
1120470256 14:84914392-84914414 ATGGATGAGAAAGCTGTGGAAGG - Intergenic
1120590793 14:86371221-86371243 AGGGAGAGGAAAGATGATGCAGG - Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120751467 14:88202569-88202591 AGTGAGACGAAAGAGGAGGACGG - Intronic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120938486 14:89921642-89921664 ATGGAGGAGAACGATGGGGTAGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121189528 14:92013584-92013606 ATGGAATAGAAAAAAGAGGAAGG + Intronic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1122322240 14:100862054-100862076 AAGGAGAAAGAAGAAGAGGAAGG - Intergenic
1122652794 14:103234859-103234881 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1202927122 14_KI270724v1_random:36735-36757 AGAAACAAGAAAGATGAGGAAGG - Intergenic
1123969107 15:25488424-25488446 AGGAAGAAGTAAGCTGAGGAAGG + Intergenic
1123986762 15:25653153-25653175 ATGGAGAAGAACGAGGAGAACGG - Intergenic
1124135332 15:27030285-27030307 AAGGAGGAGGAAGAAGAGGAAGG - Intronic
1124371609 15:29107505-29107527 ATGCCGAACAAAGAGGAGGAAGG - Intronic
1124517219 15:30376831-30376853 ATTGAGACAAAAGAGGAGGATGG + Intronic
1124688777 15:31804478-31804500 ATGGAGGAGAAAGGGGAGGAGGG - Intronic
1124725725 15:32154163-32154185 ATTGAGACAAAAGAGGAGGATGG - Intronic
1124996404 15:34727252-34727274 ATGGAACAAAAAGATGAGAAAGG - Intergenic
1125119810 15:36141853-36141875 AGGAGGAAGAAAGAGGAGGAAGG + Intergenic
1125281052 15:38043132-38043154 ATGGGGAAGAAAGATAAGGCTGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1126052326 15:44697275-44697297 AGGAAGAAGAAAGAAGAAGAAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126056185 15:44731889-44731911 GTGGTGAACAATGATGAGGAGGG + Intronic
1126357486 15:47811878-47811900 GGGAGGAAGAAAGATGAGGAAGG - Intergenic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1126464243 15:48946442-48946464 AGGAAGAGGAAGGATGAGGAAGG - Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127532210 15:59854513-59854535 ACTGAGATCAAAGATGAGGAAGG - Intergenic
1127574595 15:60278747-60278769 TATGAGAAGAAAGATGAGCAGGG - Intergenic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1127775699 15:62262686-62262708 ATGGAGAACAAAGAAAGGGAGGG + Intergenic
1127896784 15:63307382-63307404 ATAGAGATAAAAGAAGAGGAGGG + Exonic
1128095843 15:64954846-64954868 AAGGAGAAGAAAGAAGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1129228102 15:74181465-74181487 TGGGAGAAGAAAGCTGAGGCAGG + Intronic
1129321554 15:74777814-74777836 ATGGAGAAGAGAGGAGAGGTTGG - Intergenic
1129449735 15:75644431-75644453 ATGCAGACAAAAGATGATGAGGG - Intronic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1129928210 15:79385014-79385036 ATGGAGAATGAAGAAGAGCAAGG + Intronic
1129932603 15:79424876-79424898 GTGGAGAAGAAATAGAAGGAAGG + Intronic
1130730573 15:86487955-86487977 ATTGAGAAGAAAGCAAAGGAGGG - Intronic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131597865 15:93816792-93816814 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131771199 15:95739470-95739492 AGGGAGAAGAATGAGGAGCATGG + Intergenic
1131868820 15:96740514-96740536 ATGGAGTAGAAGGGTGTGGAAGG - Intergenic
1131996715 15:98140361-98140383 AGGAAGCAGAAAGAAGAGGAGGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133392717 16:5422645-5422667 ATTGGGAGGAAAGAGGAGGAGGG + Intergenic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1133717884 16:8466870-8466892 GTGGGAAAGAAAGAAGAGGAAGG + Intergenic
1133736861 16:8622275-8622297 ATCAGAAAGAAAGATGAGGAGGG + Intronic
1133901395 16:9978554-9978576 AAGGAGGAGTAAGAGGAGGATGG - Intronic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1134289670 16:12893699-12893721 ATGGAGACGAAAGGAAAGGAAGG + Intergenic
1134649573 16:15898111-15898133 AAGAAGATGAAAGAGGAGGAGGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1134892584 16:17854062-17854084 AAGGAGATGGAAGATGAGGGAGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135282020 16:21159965-21159987 TTGGAGGGGAAAGTTGAGGAGGG - Intronic
1135375593 16:21944224-21944246 ATGGAGAACAAAGAAGAGCAGGG - Intergenic
1135525211 16:23208901-23208923 AGGGATTAGAAAGATGAGCAGGG - Intronic
1135572697 16:23561406-23561428 ATGGAGAAGAAAGAAGACTCAGG + Intronic
1135637683 16:24093057-24093079 ATGGAGAAGACAGAAAAGGAGGG - Intronic
1135646738 16:24169481-24169503 TTGGAGAAGAAAGAAGAAGGGGG - Intronic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136094771 16:27947335-27947357 AAGGAGAAGAAAGAAGAAGAAGG + Intronic
1136412901 16:30087133-30087155 ATGGGGCAGAAAGATGAGCTAGG - Intronic
1136474406 16:30503630-30503652 AAAGAGAAGAAAGAAAAGGAAGG + Intronic
1136491885 16:30613939-30613961 AAGGAGAAGAAAGAAGAAGGAGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1137543679 16:49382810-49382832 GTGGAGAAGGAAGACGAGGGAGG - Intronic
1137625036 16:49902273-49902295 ATGGAGAAGAATGTTGTAGATGG + Intergenic
1137954062 16:52810978-52811000 GTGGAGAAGAAAGATTGGTAAGG + Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138153952 16:54685826-54685848 AGGAAGAAGGAAGAGGAGGAGGG - Intergenic
1138154530 16:54690970-54690992 ATGTAATAGAAAGATGAGCAGGG - Intergenic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138459233 16:57138210-57138232 ATGGAGGTGGAAGATGAGAAAGG - Intronic
1138467644 16:57203697-57203719 TAGGAGAATAAAGATGAGTAAGG - Intronic
1138499816 16:57433498-57433520 AGGGATAGGAAGGATGAGGATGG + Intronic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1138847429 16:60583579-60583601 ATGAAGAATCAAGATGATGAAGG + Intergenic
1139031174 16:62882704-62882726 CTGGAGCAGAAGGACGAGGAAGG + Intergenic
1139167552 16:64585954-64585976 ATGGAGACAAAAGATGAAGAAGG - Intergenic
1139642069 16:68298926-68298948 GTGGAGAAGAATGGTCAGGAAGG - Exonic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1140092981 16:71852422-71852444 ATGGTGAGGAGAGATGGGGAAGG - Exonic
1140302496 16:73772006-73772028 ATGTAGAAGAAAGAAAAGAAAGG - Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140694377 16:77517828-77517850 ATGCTTAAGAAAGATCAGGAAGG - Intergenic
1140756344 16:78070996-78071018 ATATAGTAGGAAGATGAGGATGG - Intergenic
1140806479 16:78536724-78536746 ATGGAGGAGAATGATGACGAAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141221105 16:82070042-82070064 GTGGAGAAGAAGGATTAGGTTGG - Intronic
1141231893 16:82175497-82175519 ATAGAGATGGAAGATGTGGAAGG + Intergenic
1141294137 16:82751047-82751069 AGAGAAAAGAAAGATCAGGAAGG - Intronic
1141496256 16:84411965-84411987 AAGGAAAAGAAAGAAGAGAAAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141713932 16:85716343-85716365 AGGGAGGAGGAAGAGGAGGAAGG + Intronic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141782444 16:86172499-86172521 AGGGAGAAGAAAGAAATGGAGGG - Intergenic
1142137771 16:88459588-88459610 GGGGAGGAGAAAGAGGAGGAGGG - Intronic
1142441160 16:90098367-90098389 ATGGAGGAGATAGATGATGCAGG - Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1142475019 17:183533-183555 AAGGAGGAGGAAGAGGAGGACGG + Intergenic
1142923299 17:3210141-3210163 ATGGAAAAGAAAAAAGAAGACGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143035134 17:3990789-3990811 AATGAGAAGAAAGAAGAAGAAGG - Intergenic
1143263101 17:5614815-5614837 ATGAAGAACAAAGAAGAGAATGG - Intronic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391459 17:6561410-6561432 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143410858 17:6707551-6707573 ATGGAGAAGGAAGAAAAGAAAGG + Intronic
1143779661 17:9222577-9222599 CTGGTGAGGAAAGAGGAGGAGGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1144016401 17:11200457-11200479 AGGGGGAGGAAAGATGAGAAAGG + Intergenic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144204858 17:12973029-12973051 ATGGGGAAGAAAGAGGCAGAAGG - Intronic
1144285754 17:13772344-13772366 GTGGGGAAGTAAGAGGAGGAAGG + Intergenic
1144746792 17:17621409-17621431 AAGAAGAAGGAAGAAGAGGAAGG + Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145747600 17:27331992-27332014 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1146136353 17:30324229-30324251 ATGAGCAAGAAATATGAGGAGGG + Intronic
1146441075 17:32895546-32895568 GTGGAGAAAGAAGAGGAGGAAGG + Intergenic
1146490618 17:33278893-33278915 AAGGAGATGACAGCTGAGGAAGG + Intronic
1146801216 17:35824635-35824657 ATGGAGTAGAAAGGTGGGGATGG + Intronic
1146953155 17:36920561-36920583 ATGGAAAAGCAAGAGGAGAAAGG - Intergenic
1147310398 17:39592635-39592657 ATGGAGGAGAAAGAAGAGAGGGG + Intergenic
1147361860 17:39935900-39935922 ATAGAGAAGATAGATAAGGAAGG - Intergenic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147641248 17:42001824-42001846 ATGGAGAAGAATGGAGAGGGAGG - Intronic
1147983293 17:44288521-44288543 AGGGAGAAGATAGCTCAGGAGGG - Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148507639 17:48140749-48140771 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148967238 17:51446459-51446481 ATGCAGAGGAAAGAAGAGGTGGG + Intergenic
1149095982 17:52841565-52841587 ATGGAGAACTAAGATTAGGATGG + Intergenic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149665784 17:58363998-58364020 AAGGAGAAGAGAGAGGAAGAAGG + Intronic
1149792447 17:59491140-59491162 ATGGAGATTACAGAGGAGGAAGG + Intergenic
1150072124 17:62160050-62160072 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150289558 17:63973526-63973548 AGGGAAAAGAAAGATGGGGGTGG + Intergenic
1150481801 17:65516755-65516777 ATGAGGAAGAGAGATGCGGAAGG + Intergenic
1150631742 17:66884956-66884978 AGGGAGAAGACAGCAGAGGATGG - Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150879675 17:69009705-69009727 ATCCAGAAGAGAGATGATGATGG + Intronic
1150931949 17:69594610-69594632 AGGGAGAAAAAAGATAATGACGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151158736 17:72146754-72146776 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1151249236 17:72820816-72820838 AGGGAGGAGAAACATGTGGATGG + Intronic
1151327640 17:73388873-73388895 AGGGAGAAGGAAGAGAAGGAGGG - Intronic
1151635349 17:75343824-75343846 AGGGAGAAGAAAGGAGAGGAAGG + Intronic
1151918394 17:77135862-77135884 ATAGAAAAGAAAGAGAAGGAAGG - Intronic
1152053895 17:78006609-78006631 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1152084064 17:78206659-78206681 GAGGAGAAGAAAGAAGATGAAGG - Intronic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152206642 17:78977817-78977839 ATGGGGAAGATAGATGAAAAGGG + Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152731675 17:81975113-81975135 AAGGAGAAGAAAGAAGAAGAGGG - Intergenic
1152969515 18:148189-148211 ATTGAGAAGAAAGAGGAAGAAGG + Intergenic
1153151384 18:2097865-2097887 AAAGAAAAGAAAGATGAGGTAGG + Intergenic
1153356978 18:4148051-4148073 ATGGAAAAGAGAGACAAGGATGG - Intronic
1153488363 18:5624942-5624964 AAGGTGAAGAAAGGGGAGGAAGG + Intronic
1153647390 18:7207406-7207428 AGGGAGATGGTAGATGAGGAAGG + Intergenic
1153850954 18:9093815-9093837 AAGGAGGAGAAAGAAGAAGAAGG - Intergenic
1153955253 18:10090645-10090667 AAGGAGAAGGAAGAAGAAGAGGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154103460 18:11498963-11498985 ATGGTCCAGTAAGATGAGGAGGG - Intergenic
1154434435 18:14333118-14333140 GTGGAGGTGAAAGATGAGGGTGG + Intergenic
1154941618 18:21118651-21118673 AGGGAGAAAAAAGATGAAAAGGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155067342 18:22279337-22279359 AGGGAGGTGGAAGATGAGGAGGG - Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155332183 18:24729653-24729675 TTTGAGATGAAAGATGAAGAAGG - Intergenic
1155472491 18:26205469-26205491 AGGAAGAAGAAAGAAGAAGAAGG + Intergenic
1155724285 18:29060228-29060250 ATGGAGAAGAAACTTGGAGAAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156451844 18:37270959-37270981 AAGCAGAACAAAGGTGAGGAAGG + Intronic
1156673088 18:39493900-39493922 GGGGAGAAGAAAGCAGAGGATGG + Intergenic
1156822705 18:41391961-41391983 ATGAAGAAGAAAGGGGAGCATGG + Intergenic
1156837314 18:41569435-41569457 GTGGAGGATAAAGAGGAGGAAGG + Intergenic
1156852519 18:41745087-41745109 AGGGAGAGGAAAGAGGAGAAAGG + Intergenic
1157023148 18:43810780-43810802 AAAGACAAGAAAGAAGAGGAAGG + Intergenic
1157150417 18:45211616-45211638 AAGGAGAAAAAAGCAGAGGAGGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157369634 18:47098995-47099017 AAGGAGAAGAAAGAGAAGGAAGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157508536 18:48250297-48250319 ATCTAGCAGAAAGATCAGGAAGG - Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1157771664 18:50353110-50353132 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1158031694 18:52973474-52973496 AGGGAGCAGAAATATGAGAAAGG - Intronic
1158174553 18:54639765-54639787 CTGCAAAAGAAAGATTAGGAAGG + Intergenic
1158281944 18:55838124-55838146 AGGGGGAAGAAACAAGAGGAAGG + Intergenic
1158423100 18:57313423-57313445 AGGGAGGAGAAAGAAGGGGAGGG + Intergenic
1158439230 18:57459318-57459340 ACTGTGAACAAAGATGAGGAGGG + Intronic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1158495404 18:57950821-57950843 TAGGAGTAGAAAGATGAGTAAGG + Intergenic
1159234226 18:65650330-65650352 ATGGAGAAGAAAGATAGTGGAGG + Intergenic
1159271236 18:66153804-66153826 AAGAAGAAGAAAGACGAAGAAGG + Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1160035477 18:75297746-75297768 ACAGAGAAGATAGAAGAGGAAGG + Intergenic
1160067181 18:75586574-75586596 ATGGAGAGGAGAGAGGAGGGAGG - Intergenic
1160102410 18:75935350-75935372 ATGGAGAAGTGAGATCAGGAGGG + Intergenic
1160535527 18:79589557-79589579 AGGGAGAAGGGAGATGGGGAAGG + Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160676474 19:393954-393976 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676504 19:394078-394100 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676508 19:394091-394113 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676531 19:394177-394199 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676569 19:394325-394347 ATGGAGAAGGATGATGGGAAAGG + Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676774 19:395256-395278 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676799 19:395356-395378 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676824 19:395456-395478 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695200 19:480512-480534 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695204 19:480525-480547 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695373 19:481434-481456 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695394 19:481509-481531 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1161143493 19:2663348-2663370 CTGGGGAAGAAAGAGGAGGGGGG - Intronic
1161195151 19:2982569-2982591 ATGGTGAAGACAGAGGACGAGGG + Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161631068 19:5355820-5355842 ATGGAGAAGAGAGGAAAGGAGGG - Intergenic
1161834797 19:6638560-6638582 ATGGAGAAGAAAGCGTGGGAGGG + Intergenic
1161836284 19:6649305-6649327 GTGGAGGAGACAGAAGAGGAAGG - Intergenic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1162024225 19:7884593-7884615 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162024245 19:7884638-7884660 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162024264 19:7884683-7884705 AGGGAGGAGGAAGATGGGGAGGG + Intergenic
1162197487 19:8996729-8996751 AATGAGGAGAAAGAGGAGGAAGG + Intergenic
1162203745 19:9040206-9040228 AGGGAGAAGATAGAAGAGGAAGG + Intergenic
1162376023 19:10305745-10305767 ATGGGGAAGCAAGATGGAGAAGG + Intronic
1162829218 19:13274142-13274164 AGAGAGGAGAAAGAGGAGGAAGG + Intronic
1162835455 19:13314188-13314210 ATAGAAAGGAGAGATGAGGAGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164025071 19:21344419-21344441 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1164032239 19:21418153-21418175 CTGGAAAAGAAAGATCTGGAGGG + Intronic
1164081136 19:21862346-21862368 ATGGAGGTGAAGGATGTGGAAGG - Intergenic
1164480112 19:28605037-28605059 ATGGAGGAGAAAGATCAGGCAGG + Intergenic
1164521024 19:28979934-28979956 ATAGATAAGAAAGGAGAGGAAGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1165348302 19:35262579-35262601 CAGGAGGAGGAAGATGAGGAAGG - Exonic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1165866213 19:38940953-38940975 CTGGAAAAGAAAGATCTGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166195623 19:41203808-41203830 AAGGAGAAGAAAGATGCAGGGGG - Intronic
1166380267 19:42351910-42351932 ATGGAGAAAAAAGAGCGGGAGGG - Intronic
1166626547 19:44362219-44362241 ATGGAGGAGAAGGGGGAGGAAGG + Intronic
1166642894 19:44509772-44509794 ATGGAAAAGAAAGAAGGGAATGG + Intronic
1166763021 19:45236143-45236165 ATGTAGGTGAAAGCTGAGGATGG + Intronic
1166916077 19:46196833-46196855 TGGGAGAAGGAAGAAGAGGAGGG - Intergenic
1167130493 19:47582177-47582199 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1167138770 19:47634722-47634744 AGAGAGAAGAGAGTTGAGGATGG - Intronic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167191288 19:47991750-47991772 GTGAAGAAGGAAGAGGAGGAGGG - Intronic
1167433060 19:49464307-49464329 AGGGAGAAGGGAGATGAAGATGG - Intronic
1167608143 19:50492726-50492748 AGGAAGAGGAAAGAGGAGGAAGG + Intergenic
1167874115 19:52397456-52397478 ATGGACAAGAAAGAAAAGTAAGG - Intergenic
1168184268 19:54688145-54688167 ATGGAAAAGAAACATGGGGCAGG + Intronic
1168199649 19:54805405-54805427 GTGGAGAAGGAAGAGGAGAATGG + Intronic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168519863 19:57040939-57040961 AGGGAGAAGTAAGAGGATGAGGG + Intergenic
1168573192 19:57487567-57487589 TTGGAGATGATAGATGATGATGG - Intergenic
925149870 2:1607560-1607582 AAGGACAGGAAAGATGAGGATGG + Intergenic
925445567 2:3923981-3924003 AAGGAGAAGAGAGGAGAGGAGGG - Intergenic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926137436 2:10346778-10346800 ATGGAGAAGGAAGGGGAGGAAGG - Intronic
926843557 2:17108439-17108461 AGGGAGGAGAAAGAGAAGGATGG + Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
926887212 2:17609254-17609276 AAGGAGAAGACAGAGGAGTAGGG + Intronic
926952298 2:18255274-18255296 AGAGAGAAGTGAGATGAGGAAGG - Intronic
927117942 2:19923605-19923627 CTGGAAAAGAAAGATCTGGAGGG - Intronic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927369747 2:22340746-22340768 AAGGAGAAGAAAGTTGGGTAAGG - Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928385481 2:30863942-30863964 ATGGAGCAGAAATATGAGGCAGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929039826 2:37733624-37733646 ATGAAGATGGAAGTTGAGGAAGG + Intronic
929085620 2:38164724-38164746 CTGGAGAGGAGAGATGAAGAGGG - Intergenic
929138714 2:38648783-38648805 ATGGAGAAGAGAGACTAGTATGG - Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929461888 2:42108364-42108386 ATGAAGAAAAAAGACGAAGAAGG - Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930183205 2:48385382-48385404 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930350064 2:50240382-50240404 ATGTAGAAGAGAGCTGAGGAAGG - Intronic
930550327 2:52826569-52826591 ATAGAGAAGGTTGATGAGGAGGG + Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931158164 2:59658854-59658876 ATGGAGGAGAATGATTATGAGGG - Intergenic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
932074714 2:68651989-68652011 ATGGAGAGGAAAGAGGAGAAGGG + Intronic
932128360 2:69165517-69165539 GGAGACAAGAAAGATGAGGAGGG + Intronic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932634962 2:73380155-73380177 AAGAAGAAGAAAGACAAGGAGGG + Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933211222 2:79571556-79571578 ATGGAGAAGAAAGATCAGTTAGG - Intronic
933335377 2:80951226-80951248 ATGGAGATGAAAAATGAAGCTGG - Intergenic
933421383 2:82050214-82050236 ATGGAGAAGTAAGATCAGGTAGG + Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933573741 2:84043381-84043403 GTGAAGAAGAAAGAAGAAGAAGG + Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934183654 2:89651280-89651302 ATAGTGAAGAAAGATGACGTAGG + Intergenic
934293941 2:91725451-91725473 ATAGTGAAGAAAGATGACGTAGG + Intergenic
934653187 2:96104025-96104047 ATGGAGGGGGAAGAGGAGGAGGG - Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934881611 2:97986352-97986374 AGAGGGAAGAGAGATGAGGAAGG + Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935026011 2:99277716-99277738 CTGGAAAAGAAAGATCTGGAGGG + Intronic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936731298 2:115384525-115384547 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
937009958 2:118553596-118553618 AAGGAAAGGAAAGAAGAGGAAGG + Intergenic
937070773 2:119061360-119061382 AAGGAAAAGAAAGATGAAAAGGG - Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937412309 2:121687214-121687236 AAAGAAAAGAAAGGTGAGGAGGG - Intergenic
937430357 2:121832783-121832805 CTGGAGAAAACAGATGTGGAAGG + Intergenic
937492172 2:122381474-122381496 TTTGAGAAGAAAGATTAGAATGG + Intergenic
937535059 2:122876100-122876122 ATGGAGAAGATAGAGGAGGGTGG - Intergenic
937606470 2:123807355-123807377 ATGGAGAACAAAGAAAAGCAAGG + Intergenic
938307019 2:130263489-130263511 ATGGAGAAGGGAGATGAGTGAGG - Intergenic
939031563 2:137081949-137081971 AGGGAGAAGAAATTAGAGGAGGG - Intronic
939098289 2:137862875-137862897 ATGCAAAAGAAAGAGGAGGGAGG + Intergenic
939113658 2:138036635-138036657 TTCAAGAAGAAAGATGAGTACGG - Intergenic
939262131 2:139823767-139823789 ATGGATAAGAAAGTTAATGATGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939315821 2:140548442-140548464 ATGGAGATGAAATAAGAAGATGG - Intronic
939462302 2:142512882-142512904 ATGGAGAAGGAAGAAGGGTAGGG + Intergenic
939490779 2:142874023-142874045 AGGGAGAAGAAAGGAGAGTATGG + Intergenic
939707125 2:145469091-145469113 CTGGAGGAGGAAGATGAGGGTGG + Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940057251 2:149525984-149526006 ATGGAGAACAAAGAAAAGCAGGG - Intergenic
940310981 2:152278883-152278905 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
940575962 2:155504366-155504388 ATGGAAAACAAAGAAGAGCAAGG + Intergenic
940719349 2:157264739-157264761 CTGGAGGAGGAAGAGGAGGAGGG + Intronic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
940979789 2:159988846-159988868 AAGGAGAAGAAAGAAGACAAAGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941242214 2:163053555-163053577 AAGGAGGAGAAAGATGAAGAAGG + Intergenic
941338331 2:164272703-164272725 ATGGAAAAAAAAGAAGAGGAGGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941870008 2:170374107-170374129 ATTGAGATGACAGATGAGAAAGG - Intronic
942042600 2:172080945-172080967 ATGGAGGGGAAAGATACGGAAGG - Exonic
942214629 2:173706494-173706516 ATGGAGTAGAAAGAGGAAGAAGG - Intergenic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
942582195 2:177430645-177430667 ATGGAGAACAAAGAAAAGGAGGG - Intronic
942999351 2:182305130-182305152 TTGGAGAAGAGAGACAAGGAAGG - Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943682836 2:190786142-190786164 ATGGAGCAGAATTATGAGGGAGG + Intergenic
944019315 2:195082411-195082433 AAGAAGAAAAAAGAGGAGGAAGG - Intergenic
944366757 2:198929885-198929907 ATGGAGCATAAAGATTATGAAGG + Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
944667494 2:201969622-201969644 ATGGCAGAGAAGGATGAGGAAGG - Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945120533 2:206452748-206452770 ATGGCTGAGAAAGATGAGGAAGG - Intronic
945201369 2:207285088-207285110 ATGGAGATGAGAGATAAGGCTGG + Intergenic
945435020 2:209809110-209809132 GTGGAGGAGAAAGACGAAGAAGG - Intronic
945476806 2:210292991-210293013 AAGGAGAAGAAAGGAAAGGAGGG - Intronic
945575071 2:211520498-211520520 ATGAAGAAGAAAGAAGAGAAGGG + Intronic
945771828 2:214053118-214053140 CTGGAGGAGAAAGACAAGGAAGG + Intronic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946051630 2:216867603-216867625 AAGGAGAAGGAAGAGGAAGAGGG - Intergenic
946063948 2:216969939-216969961 ATGAAGAAGAAAGAAGAAAAGGG + Intergenic
946206563 2:218113123-218113145 CTGGAAAAGAAAGATCTGGAAGG - Intergenic
946410352 2:219512506-219512528 AAGGAGAAGAGAGAGAAGGATGG + Intergenic
946688139 2:222291694-222291716 GGGGAGAAGAAAGCTGAGGGAGG - Intronic
946873141 2:224102802-224102824 ATGGAAAGGAAATAAGAGGAAGG - Intergenic
946899509 2:224358611-224358633 ATGGAGAACAAACATCAGAATGG + Intergenic
947147604 2:227082629-227082651 ATGGAGAGGAAAGAAGAGAGTGG + Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947292106 2:228587140-228587162 ATGGAGATGAAATATGGAGAAGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948281820 2:236752889-236752911 AAGGAGAAGACAGCAGAGGAGGG - Intergenic
948554563 2:238799005-238799027 AAGGAAAAGAAAGATAAGAAAGG + Intergenic
1168765548 20:379923-379945 ATGGAGCAGGAAGTTGAGGCAGG + Intronic
1169089085 20:2846954-2846976 GTGGAGCAGAAAGATGGGGCTGG + Intronic
1169269009 20:4185183-4185205 ATTGAGGAGAAAGAGGAGAATGG + Intronic
1169785182 20:9352305-9352327 ATGGACACAAAAGATCAGGAGGG - Intronic
1169840163 20:9926818-9926840 GTGGAGAAGTAAGACAAGGAAGG - Intergenic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170045019 20:12075757-12075779 TTGAAGAAGACAGATGAGAAGGG - Intergenic
1170067485 20:12329286-12329308 AAGAAGAAGAAAGATAAGGATGG - Intergenic
1170073298 20:12392031-12392053 ATGGAGACAAAAGATTTGGAGGG + Intergenic
1170120970 20:12911337-12911359 ATGGGCCAGAAAGATGGGGAGGG - Intergenic
1170160459 20:13304861-13304883 GTGGGGAAGAGAGATGGGGAAGG - Intergenic
1170712911 20:18808215-18808237 ATGGAGAAGTGAGATGGAGAAGG - Intergenic
1170715783 20:18829687-18829709 AGGGACAAGAAAGAGGAGAAGGG - Intronic
1170821338 20:19758158-19758180 GAGGAGAGGAAAGAGGAGGAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171130907 20:22652275-22652297 CTGCAGAAAAAAGAGGAGGATGG - Intergenic
1171158578 20:22899813-22899835 GTGGAGAAGAGAGATCAGGTAGG + Intergenic
1171373037 20:24673965-24673987 TTGGGAAACAAAGATGAGGAAGG + Intergenic
1171781455 20:29422456-29422478 AGAAACAAGAAAGATGAGGAAGG + Intergenic
1172068674 20:32239990-32240012 ATAAAGAAGAAAGAGGAGAAAGG + Intergenic
1172073022 20:32272471-32272493 ATGGAGAGGGAAGGTGAGAATGG + Intergenic
1172306671 20:33885532-33885554 ATGGGGAGGAAAGCCGAGGAGGG + Intergenic
1172558840 20:35867852-35867874 AAGGAGGAGAGAGAAGAGGAAGG - Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172969436 20:38862692-38862714 ATGAAGAAGAATGTTCAGGAGGG + Intronic
1173066909 20:39721878-39721900 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1173284718 20:41659814-41659836 ATGGAGGTGAGAGATGAGGATGG - Intergenic
1173647476 20:44642464-44642486 AGGGAGAAGAAAGAAGGAGAGGG + Intronic
1173811873 20:45960758-45960780 ATGGAGAAAGAAGTGGAGGAGGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1173965248 20:47107757-47107779 AAGGAGAAGAAAGAAGAAGTAGG + Intronic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175379206 20:58551115-58551137 ATAGAGAAAAAAGAAAAGGAAGG - Intergenic
1175624556 20:60479519-60479541 AGGAAGAAGTAAGATGATGAAGG - Intergenic
1175921336 20:62451808-62451830 ATGGAGAAGAGAGAGGGAGAGGG + Intergenic
1176986502 21:15443535-15443557 TTGGAGAAGAAAGAAAAGGGTGG + Intergenic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179081846 21:38178669-38178691 AAGAAGAAGGAAGAAGAGGAAGG + Intronic
1179162936 21:38912826-38912848 GTGGAGAAGAAAGGAAAGGAAGG + Intergenic
1179880193 21:44290399-44290421 CTGGGGACGAAAGATGAGCATGG - Intronic
1179941468 21:44641294-44641316 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180865123 22:19114114-19114136 ATGGAGAGGAAAGGTGGGAATGG - Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181741234 22:24923481-24923503 ATGGAGAAGGAAGAGGAGAAAGG - Intronic
1181911739 22:26243857-26243879 CAAGAGAAGAAAGATGAGCAGGG + Intronic
1181927344 22:26370571-26370593 CTGGAGAAGAAAGAAAGGGATGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182864207 22:33588392-33588414 CTCTAGAAGAAAGATGAGGAAGG + Intronic
1182883838 22:33756563-33756585 AGGGAGAAGAAAGAACAGGTGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182959396 22:34457939-34457961 ATGGAGATGAAAGGTGTGGTTGG + Intergenic
1183021713 22:35032804-35032826 ATGAAGAGGACAGAGGAGGAGGG + Intergenic
1183577262 22:38700163-38700185 ATTGAGAAGAGAGAAGAGGTGGG - Exonic
1183593977 22:38798563-38798585 ATGGAGCAGCAAGAAGAAGATGG - Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184449471 22:44574513-44574535 AAGGAGGAGAAAGAGAAGGAGGG + Intergenic
1184671970 22:46017850-46017872 ATGGAGAAAAAAGAAGAGAATGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1185037057 22:48484878-48484900 AAGGAGAAGGAAGAGAAGGAGGG - Intergenic
1185205926 22:49538726-49538748 ATGGAAGACAAAGGTGAGGAGGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949148724 3:737880-737902 ATGGTGAAGAAAGGTGGGGCAGG + Intergenic
949250077 3:1973130-1973152 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
949366256 3:3284828-3284850 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949577126 3:5349284-5349306 GTGGAGAAATAAGATGGGGATGG - Intergenic
949625977 3:5867163-5867185 GGGGAGCAGAAAGTTGAGGATGG + Intergenic
950114979 3:10444873-10444895 AGGAAGAAGAAAGAAGAGGCAGG - Intronic
950285259 3:11739712-11739734 ATGGAGCAAAAAGATGAGTGAGG + Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
950404612 3:12796890-12796912 AGGGAGAAGAGAGAAGAGGCAGG - Intronic
950727240 3:14924347-14924369 AGAGAAAAGAAAGAGGAGGAGGG - Intronic
950982799 3:17327017-17327039 ATCAAGATGAAAGATCAGGATGG - Intronic
951055036 3:18137662-18137684 ATGCAGAAAAAATATGGGGAGGG - Intronic
951666217 3:25127051-25127073 ATGCAGGCGAAAGATGATGATGG - Intergenic
951813379 3:26726509-26726531 AAGGAGTAGAGAGCTGAGGAGGG - Intergenic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
952073072 3:29662717-29662739 ATGGAGAAGAAATCTGTAGAAGG - Intronic
952402533 3:32976349-32976371 ATGGAGGGGAAAGAGTAGGATGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952938576 3:38421842-38421864 CTGGAAAAGAAAGATTCGGAGGG - Intergenic
953174988 3:40542760-40542782 ATAGAGAAGAAAGAAAAAGAAGG + Intronic
953197189 3:40745691-40745713 ATGGAGAAGCAAGACTGGGAAGG - Intergenic
953284283 3:41591320-41591342 ATGGAAAAAAAAGAAGTGGAGGG + Intronic
953382157 3:42480154-42480176 ATGGAGTGGGCAGATGAGGAGGG + Intergenic
953387710 3:42516122-42516144 ATGGTGAGGCAAGATGAGGTGGG - Intronic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953435267 3:42872790-42872812 ATGAAGGTGAAAGAGGAGGAGGG + Exonic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
954106872 3:48414254-48414276 CTGGAGAAGAAAGATAGGAAAGG - Intronic
954547307 3:51448209-51448231 AGGGAGTAGAGAGATGAGAAAGG - Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955613743 3:60784098-60784120 AGGATGAAGAAAGATGGGGAGGG - Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956251994 3:67244228-67244250 TTGGAGAAGAAAGATGTGCAAGG + Intergenic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
956741563 3:72279914-72279936 GTGGGGAAGGAAGAGGAGGAGGG + Intergenic
956798895 3:72739304-72739326 TGGGGGAAGGAAGATGAGGAGGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
957107273 3:75906770-75906792 AGGGAGAGGAAAGAAAAGGAAGG + Exonic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957683413 3:83469638-83469660 AAGGAGAGGAGAGAAGAGGAGGG + Intergenic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
958112354 3:89164658-89164680 ATGGAGAAAAAAGATTAAGTAGG + Intronic
958856994 3:99397673-99397695 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
958862544 3:99462475-99462497 ATAGAGAATAAATAGGAGGATGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
958907299 3:99956222-99956244 ACAAAGAAGAAAGGTGAGGAAGG - Intronic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959034672 3:101346992-101347014 AGGAGGAAGAAAGAGGAGGAAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959397605 3:105860637-105860659 AGGGAGAAGAAATATTAAGAAGG - Intronic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959460551 3:106620748-106620770 ATAGAGAAGAAAGAGAAGGAAGG + Intergenic
959659108 3:108845442-108845464 ATGGAGAAAAATCATGAGCAGGG + Intronic
959795881 3:110427863-110427885 ATGGAGAAGAAGGAGGCTGAGGG - Intergenic
960061546 3:113328035-113328057 ATGGTGAAGAAATAGGTGGAAGG - Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960862951 3:122169878-122169900 AAGAAGAAGAGAGATGAAGAGGG + Intergenic
961345446 3:126260655-126260677 GTGGAGAGGAAAGAGGGGGAGGG - Intergenic
961859330 3:129902102-129902124 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962189444 3:133295304-133295326 ATGGAGAAGTAAGGAGAGCAAGG + Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
962803443 3:138909826-138909848 ATGGAGAAGAGAGGGGAGGAAGG + Intergenic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
962981871 3:140497977-140497999 ATGGAGAAGGAAGAAAAGCAGGG - Intronic
963326178 3:143865875-143865897 ACAGGGAAGAAAGATGAGAATGG - Intergenic
964082399 3:152775270-152775292 GTGGAGAAGAATGATGAAGCAGG - Intergenic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
965315293 3:167183047-167183069 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
965365603 3:167795532-167795554 TTGGGAAAGAAATATGAGGAGGG - Intronic
965380679 3:167983603-167983625 AAGGAGAAGAAAGAGTGGGAAGG + Intergenic
965594873 3:170400692-170400714 AGGAAGAAGAAAGAGAAGGAAGG - Intergenic
965714859 3:171591985-171592007 AAGAAGAAGAAAGATGAATATGG + Intergenic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966157528 3:176933339-176933361 GTGGATAATAAAGTTGAGGAAGG - Intergenic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966625464 3:182011311-182011333 ATGGAAGAGAAAGAACAGGAAGG + Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966775329 3:183538410-183538432 ATGGTGAAGAAATAAGAGGAAGG - Intronic
966978313 3:185106055-185106077 CTGGAAAAGAAAGATATGGAGGG - Intronic
967165742 3:186778140-186778162 ATAAAGATGAAAGATGAGGCCGG + Intergenic
967274301 3:187758816-187758838 AGGGGGAAGAAAGAGGAAGAAGG - Intergenic
967414956 3:189206141-189206163 AAAGAGAAGAAAGATAAAGAAGG - Intronic
967517905 3:190392267-190392289 AGGGGGAATAAAGAAGAGGAAGG - Intronic
967753892 3:193146940-193146962 AGGGAGTAGAATGATGATGATGG - Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968022272 3:195403492-195403514 ATCCAGATGAAAGATGAAGATGG + Intronic
968454557 4:690383-690405 ATGGGGAACAAAGATGAGGGGGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968625190 4:1623840-1623862 GAGGAGAAAAAAGTTGAGGAGGG + Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969561805 4:7953137-7953159 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
969895678 4:10302377-10302399 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
970017331 4:11526579-11526601 ATGCAGAAGAAAGATGATGCAGG - Intergenic
970027318 4:11637163-11637185 ATGGTGAAAAATGAAGAGGAAGG + Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970310990 4:14782343-14782365 ATAGATAAGATAGATAAGGATGG + Intergenic
970344752 4:15142841-15142863 ATTCAGAAGAAAGATAACGATGG + Intergenic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
970814171 4:20134316-20134338 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
971072461 4:23110534-23110556 GTGGAGAAGAAATATGGGTAGGG - Intergenic
971234549 4:24829422-24829444 ATGGAGAAAAAAGATGGAGTGGG + Intronic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971435117 4:26613128-26613150 ATAAAAAAGAAAGATAAGGAAGG - Intronic
971512446 4:27443765-27443787 AGGAAGAAGGAAGATAAGGAGGG - Intergenic
971591681 4:28476798-28476820 ATGGGGAGAAAAGAAGAGGAAGG - Intergenic
971633841 4:29031426-29031448 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
972199038 4:36691024-36691046 ATGGAGAACAAAAAAGAGCAAGG - Intergenic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
973008448 4:45042920-45042942 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974183341 4:58412140-58412162 AGGGAGAAGAAAGAGAAGAAGGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
974850217 4:67395299-67395321 ATGCAGAAGAAAGACAAAGAGGG - Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
974932559 4:68375609-68375631 CTGGAGAAAAAAGATGTGGGAGG - Intergenic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975293408 4:72704101-72704123 ATGTAAAAGAAAGATGAGAAAGG + Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975533553 4:75425443-75425465 ATGGGGAAGTAAGAAAAGGAAGG - Intergenic
975938713 4:79614148-79614170 ATGTAGAATTAAGATAAGGATGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
976336634 4:83895454-83895476 ATGAAAAAGAAAGATGGGGGAGG - Intergenic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976604604 4:86970886-86970908 CTGGAGCAGAATGTTGAGGAGGG + Intronic
976777192 4:88719621-88719643 AAGGAGAAGAAAGAAGGAGAAGG - Intergenic
976951667 4:90840243-90840265 GTGGAGAAGAATGAGGAGAAAGG + Intronic
976965074 4:91027984-91028006 ATGGAAAAGAAAAAAGAAGAGGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977739918 4:100466997-100467019 ATAGCTAAGAAAGATGTGGAGGG + Intronic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978431630 4:108639308-108639330 AGAGAGAAGAAAGCTGAAGATGG - Intergenic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978839198 4:113189714-113189736 ATTGAGAAGAAAGAGGTGGCAGG - Intronic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979171983 4:117611336-117611358 GGGAAGAAGAAAGATCAGGAGGG + Intergenic
979178874 4:117700620-117700642 ATGGTGAAAAAAGATAAGGTGGG + Intergenic
979375455 4:119941502-119941524 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
979623894 4:122826122-122826144 ACGACGCAGAAAGATGAGGATGG - Intergenic
979893598 4:126131606-126131628 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
980333759 4:131441648-131441670 ATGGAGAACAAAGAAAAGTAGGG - Intergenic
980420066 4:132547401-132547423 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980487168 4:133473733-133473755 ATGGAGAATGAACTTGAGGAGGG - Intergenic
980489319 4:133505391-133505413 ATGGAGAGGAAGGAAGAGCAGGG + Intergenic
980657736 4:135811741-135811763 AAGGAGAGGAAAGATTAGGAAGG + Intergenic
980688705 4:136263044-136263066 ATGGAAAACAAAAATGAGTAGGG + Intergenic
981003102 4:139847135-139847157 AGGGGGAAGAAAGCTGAGAAAGG - Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981174957 4:141670918-141670940 ATGGAGAAGAAAGACGTTGGAGG + Intronic
981254379 4:142644235-142644257 AAGGAGGAGAAAGAGAAGGAAGG + Intronic
982049652 4:151488046-151488068 GTTGAGAAGAGAGATGATGAAGG - Intronic
982124485 4:152172980-152173002 ATGGAAACAAAACATGAGGATGG + Intergenic
982222161 4:153134249-153134271 GTGCAGAAGAAAGGTGAGGGAGG - Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982793501 4:159619036-159619058 ATGGAGAAGATTTATTAGGAAGG + Intergenic
983264495 4:165493662-165493684 AGGGAGCGGAAAGAGGAGGAAGG + Intronic
983311699 4:166072383-166072405 AAAGAAAAGAAAGAAGAGGAAGG - Intronic
983335997 4:166393238-166393260 ATGGAGAGGAAAAATGGGGTTGG - Intergenic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
983501433 4:168504104-168504126 AAGGAGGACAAAGATGAGGCAGG - Intronic
984061052 4:174989500-174989522 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
984070301 4:175103245-175103267 AGGGAGAAGAAAGAGAAAGAAGG + Intergenic
984233144 4:177124245-177124267 ATGGAGAGGAAAGAGAGGGAGGG - Intergenic
984380182 4:178982892-178982914 ATGAAGAAAGAAGATAAGGATGG - Intergenic
984418756 4:179492684-179492706 AGGGAAAAGAGAGAAGAGGAAGG - Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
984956488 4:185050829-185050851 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985189072 4:187351929-187351951 ATGGTGTAGAAACACGAGGATGG + Intergenic
985323073 4:188735530-188735552 CTGAAGAAGAAAGAAAAGGAAGG - Intergenic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985500726 5:243003-243025 CTGGAAAAGAAAGATCTGGAGGG - Intronic
985608948 5:875857-875879 ACAGAGATGAAAGATGAAGATGG + Intronic
985900042 5:2780965-2780987 GTGGAGCAGAAAGGTGAGGCAGG - Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
986374119 5:7112831-7112853 ATGGAAAAGAAAGGAAAGGAGGG + Intergenic
986558070 5:9031676-9031698 ATGGAGAAGGAAGTTGGGGCAGG - Intergenic
986724815 5:10586367-10586389 ATGAAGAAGAAAGAAAAGGCTGG + Intronic
986955522 5:13145713-13145735 ATGGAAAATAAAGATTAGTAAGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987042078 5:14072388-14072410 ATGGAGATAGAAGATGGGGAAGG - Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987211415 5:15687419-15687441 ATGGAGAACAAAGGTGTGAAAGG - Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987675950 5:21072929-21072951 AGGAAGAAGAAAGAAGACGAAGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988219964 5:28331999-28332021 ATGAAGAAGAAAAAAGAGTATGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988388968 5:30602636-30602658 TTGGGGAAAAAAGATCAGGATGG + Intergenic
988497723 5:31758975-31758997 ATGGAGGTGGAAGAGGAGGAGGG - Intronic
988737832 5:34040404-34040426 AGGGAAAAGAAAGAAGAGGAAGG + Intronic
988811141 5:34786370-34786392 CTGGAAAAGAAAGATCTGGAGGG + Intronic
988942435 5:36159741-36159763 GTGGAGAAGACAGAGGTGGAAGG - Intronic
988947809 5:36224097-36224119 ATGGGGAAGAGAGATGAGTAGGG + Intronic
988948310 5:36230206-36230228 ATGGGGAGGAAAAATGAGGTAGG - Intronic
989185526 5:38621635-38621657 ATGGAGCTGAGATATGAGGAAGG - Intergenic
989211036 5:38859784-38859806 ATGGAGGTGAAAGATGTTGAAGG - Intronic
989556826 5:42806638-42806660 GAGGAGGAGAAAGAAGAGGAAGG + Intronic
989758715 5:44987099-44987121 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
990000116 5:50882877-50882899 ATGGAGTGGCAAGAAGAGGAAGG - Intergenic
990153236 5:52844524-52844546 AAGGAGAAGAAAGCTTGGGAAGG - Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990573888 5:57106356-57106378 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
991718559 5:69474759-69474781 AAGGAGAAGAAAGCTCTGGAGGG - Intergenic
991953434 5:71969459-71969481 ATGTAAAAGCAAGATTAGGAAGG + Intergenic
992090672 5:73313080-73313102 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
992090687 5:73313148-73313170 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992507861 5:77405890-77405912 ATAGAAAAGAGAGATGAGGCTGG + Intronic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
993290579 5:86063044-86063066 AGGTAGAAGAAATGTGAGGAAGG - Intergenic
993314843 5:86389167-86389189 ATTGATAAGATAGAAGAGGAAGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993355690 5:86904423-86904445 ATGGAGAAGAGAGGTGATGAAGG - Intergenic
993405850 5:87511188-87511210 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
993456575 5:88133987-88134009 GAGGAGGAGAAAGAAGAGGAAGG + Intergenic
993681665 5:90885856-90885878 ATGAAGAAGAAAGGGAAGGAGGG + Intronic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994133578 5:96260018-96260040 ATGGAAAAAAAAGAAAAGGATGG - Intergenic
994502410 5:100596431-100596453 ATGGAAAAGAAAGAAGTGTAGGG - Intergenic
994686853 5:102966373-102966395 AAGGAGAAGATAGAAGATGATGG - Intronic
994913680 5:105945620-105945642 AAGAAGAAGAAAGAAGAGGGAGG + Intergenic
994927160 5:106131191-106131213 ATGGAGGAGAAAGGTAAAGAAGG - Intergenic
995025446 5:107415719-107415741 TTGCACAAGAAAGATGAGTAGGG - Intronic
995142637 5:108749627-108749649 CCGGAGGAGAAAGATGAGGTGGG - Intronic
995209571 5:109521897-109521919 AGGGGGAAGAAAGAAGGGGAAGG - Intergenic
995821574 5:116240305-116240327 ATGGAGAAGAGAGAAAAGAATGG + Intronic
995830564 5:116350420-116350442 AAGGAGGAGGAAGAGGAGGAGGG + Intronic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
997023890 5:130035161-130035183 AAGAAGCAGAAAGATGAGGTAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997261537 5:132469148-132469170 ATGGAGAAGAGAGAGGCAGAAGG + Intronic
997478543 5:134164435-134164457 ATGGAGAATAAAGAAGGGAATGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997674415 5:135702014-135702036 ATGGATGAGAAAGATGAGCCTGG + Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998221896 5:140289514-140289536 CTGGAGAAGAAAGAGGAAGGAGG - Intronic
998769854 5:145530570-145530592 ATGGAGAAGAAAGAATAAGGAGG + Intronic
999149502 5:149417363-149417385 AGGAGGAAGAAAGATGGGGAGGG - Intergenic
999171417 5:149598439-149598461 AGGAAGAAGAAAGAAGAGGAAGG - Intronic
999211030 5:149888711-149888733 ATGGATAAGAAAGTTGTAGAAGG + Intronic
999286046 5:150394992-150395014 ATGGAGAGGGAAGCTGGGGAGGG - Intronic
999296537 5:150462959-150462981 AGGGAGAAGGGAGATGAGGTGGG + Intergenic
999409709 5:151340150-151340172 AAGGAGGAGGAAGAAGAGGAAGG + Intronic
999470677 5:151852156-151852178 AGGGTGAAGAAAGATGGGGAAGG - Intronic
999666487 5:153917777-153917799 ATGGAGAACAAAGAAAAGCAGGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000126958 5:158254845-158254867 AGAGAGAAGAAAGATGGAGAAGG + Intergenic
1000134599 5:158335185-158335207 ATGGAAAACAAAGAAGAGCAGGG - Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000478588 5:161743895-161743917 ATGGGGAGGAAAGAGCAGGAAGG - Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001108406 5:168875303-168875325 AGAAAGAAGAAAGAGGAGGAAGG + Intronic
1001152840 5:169247240-169247262 ATGGAAAAGGAAGACGAGAAGGG - Intronic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001625009 5:173124896-173124918 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1001836183 5:174834689-174834711 ATGCAGAAAAGAGATGAGGTTGG - Intergenic
1002076671 5:176712539-176712561 GTGGAGAAGGAAGAGGACGATGG + Intergenic
1002430724 5:179202418-179202440 ATGGAGAAGGAAGAAGGGTAGGG - Intronic
1002742368 5:181443078-181443100 GGGGAGAAGAGAGATAAGGAGGG + Intergenic
1002817104 6:691416-691438 GTGGAGGAGGAAGAAGAGGAGGG - Intronic
1002873973 6:1194310-1194332 ATGTAGAAGAAAGGTGTAGAAGG - Intergenic
1002899507 6:1399256-1399278 ACGGAGAAGAAAGAGAGGGAGGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003277705 6:4666548-4666570 ATGGAGAGGACAGGTCAGGAAGG - Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1003990708 6:11483587-11483609 AGGGAGCAGAAACAGGAGGAGGG - Intergenic
1004155192 6:13161329-13161351 AGGGAGGAGGAAGAAGAGGAAGG - Intronic
1004199391 6:13533804-13533826 AAGGAGAAGACAGAGGAAGAAGG + Intergenic
1004554268 6:16680356-16680378 AAGGAAAAGAAAGAAAAGGAAGG - Intronic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1005131067 6:22508339-22508361 ATGGAGTCAAAAGGTGAGGATGG + Intergenic
1005358421 6:25007678-25007700 ACCGAGAAGGAAGATGGGGAGGG - Intronic
1005401458 6:25438667-25438689 ATGAAGAACAAAGATGGGAAGGG + Intronic
1005413107 6:25571859-25571881 ATGAAAAAGAAAGGTGGGGATGG + Intronic
1005580086 6:27225570-27225592 AGAGAGAAGAAAGAGAAGGAAGG - Intergenic
1005673333 6:28129054-28129076 CTGGAGAACAGAGATGGGGAGGG - Intronic
1005850768 6:29819058-29819080 ATAGAGAAGAAAGAGAGGGAGGG - Intergenic
1005865807 6:29935139-29935161 ATAGAGAAGAAAGAGATGGAGGG - Intergenic
1006049277 6:31328725-31328747 ATGGAGAACAAAGGAAAGGAGGG + Intronic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1006244502 6:32718703-32718725 AAGGAAGAGAAAGAGGAGGAAGG + Intergenic
1006277587 6:33018046-33018068 GTAAAGAAGAAAGATGAGGGTGG - Intergenic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007154498 6:39729270-39729292 ATGGGGAAGAGAGAAGAGAATGG + Intergenic
1007168193 6:39843323-39843345 ATGGGGAAGAAAGATCAGGGTGG + Intronic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1007274147 6:40661212-40661234 GTGGAGGAGACAGATGGGGACGG - Intergenic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007995812 6:46306497-46306519 ATGGTAAGGAGAGATGAGGAGGG + Intronic
1008093535 6:47315895-47315917 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1008218042 6:48819763-48819785 ATGAAAAAGAAAGATGAATAGGG + Intergenic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1008686536 6:53931545-53931567 ATGAAGAATACAGATGAGGTTGG - Intronic
1008697632 6:54059164-54059186 ATGGGGAAGAAAGGGAAGGAAGG - Intronic
1008863216 6:56176864-56176886 AAGGGGAGGAAAGAGGAGGAAGG + Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1009671935 6:66765169-66765191 ATTGGGAAGAGAGAAGAGGAAGG - Intergenic
1009780661 6:68265080-68265102 ATGGAGATGAATGAAGAGCATGG + Intergenic
1009860665 6:69326840-69326862 AGGGAGGATAAGGATGAGGAGGG + Intronic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010311383 6:74389880-74389902 AAGAAGAAGGAAGAAGAGGAAGG - Intergenic
1010343273 6:74781858-74781880 AAGGAGAAGAAAGAATGGGAAGG + Intergenic
1010526749 6:76909396-76909418 ATGCAGAAGAAAGCTGGGTAGGG + Intergenic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1010917084 6:81633333-81633355 ATAGAAAAGAAAGAAAAGGAAGG + Intronic
1011002660 6:82608284-82608306 AAGGACAACAAAGTTGAGGAGGG + Intergenic
1011206593 6:84905849-84905871 ATTGAGAAGAGAGATGAGATTGG + Intergenic
1011690491 6:89862929-89862951 ATCTAGAAGAGAGAAGAGGATGG + Exonic
1011875463 6:91955854-91955876 ATGATGAAGTAAGATAAGGAAGG - Intergenic
1012000501 6:93648324-93648346 GTTGAGAAGAAAGAGGTGGAAGG - Intergenic
1012075906 6:94685607-94685629 ATGGAACAGAAAACTGAGGAAGG - Intergenic
1012091410 6:94902558-94902580 GAGGAGAAGAAAGAGTAGGAAGG + Intergenic
1012093783 6:94932450-94932472 ATGGAGAATAAAGAAGAAAAGGG - Intergenic
1012232523 6:96777209-96777231 AAGGAGAAGAAAGAGGGAGAGGG - Intergenic
1012754314 6:103205657-103205679 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1013036301 6:106387330-106387352 AGGGAAAAGGAAGCTGAGGAAGG + Intergenic
1013475144 6:110500036-110500058 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014207597 6:118672993-118673015 ATGATGAAGAAAGATGAGGGAGG + Intronic
1014356053 6:120411634-120411656 ATGAAAAAGAAAGAACAGGAAGG + Intergenic
1014422217 6:121260499-121260521 ATGGAGAGGAAGGAAGAGCAGGG + Intronic
1014690529 6:124558388-124558410 ATGGAGTAGAAAGAAGAGTCCGG - Intronic
1014729705 6:125018758-125018780 ATGGTCAAGAGAGGTGAGGAGGG - Intronic
1014856071 6:126402329-126402351 CAGGAGAAGAAAGATGGAGAGGG - Intergenic
1014961442 6:127691118-127691140 ATGGAGATGAAGGATAATGATGG - Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015081678 6:129233608-129233630 AAGGAGGAGGAAGAAGAGGAGGG + Intronic
1015123172 6:129723104-129723126 GTGGAGAAGATAGATCAGAAAGG + Intergenic
1015150588 6:130032609-130032631 ATGGTGAAGACAGATGAGATAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015446604 6:133312829-133312851 ATGGAAAAAAAAAATGAGAAGGG - Intronic
1015817457 6:137225214-137225236 ATGTTGATGAAAGATAAGGATGG - Intergenic
1015973550 6:138767045-138767067 AAGGAGAAGAAAGAGAGGGAAGG - Intronic
1016465861 6:144324811-144324833 ATGGGGAAGAAAGACGATGGTGG + Intronic
1016689651 6:146922294-146922316 AATGAGATGAGAGATGAGGAGGG + Intergenic
1016785350 6:148005496-148005518 AGGGAAAGGAAAGAGGAGGAGGG + Intergenic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1016989393 6:149918856-149918878 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1016998633 6:149979236-149979258 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1016999757 6:149988574-149988596 AGGGAGAAGGGAGAGGAGGATGG + Intergenic
1017004591 6:150020718-150020740 AGGGAGAAGGAAGAGGAGGGTGG + Intronic
1017006859 6:150033700-150033722 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1017521944 6:155210133-155210155 TTGGAGAAGAGTGCTGAGGATGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018496319 6:164348967-164348989 ATGGAGAGGAAACACTAGGAGGG - Intergenic
1018719677 6:166563225-166563247 CTGGAGAAGGAAGATGGAGAAGG + Intronic
1018727897 6:166627512-166627534 AAGGAGTAGAAAGAGGAGGAGGG - Intronic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019449693 7:1090999-1091021 ATGGAGAAGTAAGATAGGAAGGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1020288653 7:6706184-6706206 CTGGAGCAGAGAGAGGAGGAAGG + Intronic
1020369578 7:7417465-7417487 ATGGAGGATACAGGTGAGGAAGG + Intronic
1020673163 7:11145012-11145034 ATGGAGATGAATGATGGTGATGG + Intronic
1021130052 7:16900474-16900496 ATGGAGAACAAAGAGAAGCAGGG - Intergenic
1021795716 7:24251923-24251945 AAGGAGAAGAAAGAGGAAAAGGG + Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1022278727 7:28883279-28883301 AGGGAGAAGAAAGAAAGGGAGGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023057564 7:36302278-36302300 ATGGAGAAGCAAGAAAAGAATGG - Intergenic
1023241390 7:38151402-38151424 ATGGGGAGGAAATGTGAGGACGG - Intergenic
1023409358 7:39874004-39874026 TGGGATAAGGAAGATGAGGAAGG - Intergenic
1023502462 7:40865149-40865171 AAGGAGAAAAGAGAGGAGGAGGG - Intergenic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1023587406 7:41744892-41744914 ATTCAGAAGAAAGAAAAGGATGG - Intergenic
1023676551 7:42636075-42636097 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1023784208 7:43689998-43690020 ATAGAAAACAAAGATGAAGATGG + Intronic
1023804673 7:43864116-43864138 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1024014211 7:45296407-45296429 AAGGAGAAGAAAGAGGTTGATGG - Intergenic
1024055333 7:45656856-45656878 ATGGAATAGAAAGAGGAGGTTGG + Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024207793 7:47178647-47178669 ACAGAGAAGAAACATGAGAAAGG + Intergenic
1024234672 7:47388887-47388909 AAGAAGAAGAAAGAAGAAGAAGG + Intronic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025043574 7:55670024-55670046 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025136494 7:56418533-56418555 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1026062932 7:67042544-67042566 ATAGAGAAGGAAGATGGGGTAGG + Intronic
1026063650 7:67049221-67049243 ATAGAGAAGAAATATGTTGAAGG - Intronic
1026100454 7:67379709-67379731 AAGAAGGGGAAAGATGAGGAGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026508455 7:71006950-71006972 AATAAGAAGAAAGAGGAGGAAGG - Intergenic
1026715417 7:72784946-72784968 ATAGAGAAGGAAGATGGGGTAGG - Intronic
1026905084 7:74058207-74058229 AAGAAGAAGAAAGAAGAAGAAGG - Intronic
1026905094 7:74058337-74058359 AAGGAGAAGAAAGAAGAAGGAGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027234202 7:76288111-76288133 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1027303946 7:76872525-76872547 ATGCAGATGAGAGATGAGGAAGG + Intergenic
1027384798 7:77648949-77648971 AAGGAGAAGAAAGAGAAGGAGGG + Intergenic
1027411134 7:77918945-77918967 TTGGAGAAGAAGGACAAGGAAGG + Intronic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027534589 7:79381250-79381272 ATAGAGAAGAAAGATTATAAAGG - Intronic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028102728 7:86841293-86841315 ATGAACAATAAAGATGAAGAAGG + Intronic
1028629043 7:92913534-92913556 ACGTGGAAGAAAGATGAGGGGGG + Intergenic
1028654637 7:93190481-93190503 ATTGAGAAGACAGAAGAAGAAGG + Intronic
1028714212 7:93945947-93945969 CTGGAAAAGAAAGATAAGGGAGG - Intergenic
1028720691 7:94027524-94027546 TTTGAGAAAAAAGATAAGGATGG - Intergenic
1028780328 7:94728426-94728448 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1028898175 7:96065324-96065346 ATGGAGAAGAAGGAGGACTATGG - Intronic
1029204914 7:98863834-98863856 AGGAAGAAGAAAGAAAAGGAAGG - Intronic
1029276710 7:99409390-99409412 ATCGAGAAGAAAGATGTGCCGGG - Intronic
1029799630 7:102933074-102933096 ATGGAGAAGAAAGAAGAAAAGGG + Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1031209041 7:118798565-118798587 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
1031236914 7:119188654-119188676 TTGGGGAAGAAATATGTGGATGG + Intergenic
1031595460 7:123644751-123644773 ATTAAGAAGAATGATGTGGAAGG - Intergenic
1032119457 7:129145450-129145472 CTGGCAAAGAAAGAAGAGGAAGG + Intronic
1032217497 7:129968970-129968992 ATGGAAAAGAGAGAGGAGGCCGG + Intergenic
1032450435 7:132025834-132025856 AGGGTAGAGAAAGATGAGGATGG + Intergenic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032771783 7:135066730-135066752 ATGGATAAAAAAGATGAGGGGGG + Intronic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1032963422 7:137067298-137067320 ATGGAGGACAAAGATCAAGAGGG - Intergenic
1033018986 7:137702610-137702632 ATGGAGCTGAGAGATAAGGATGG - Intronic
1033669658 7:143478823-143478845 CCGGAAAAGAAAGGTGAGGATGG + Intergenic
1033719527 7:144043240-144043262 ATGGAGAAGAAAGAAGTCAAAGG + Intergenic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034021677 7:147651014-147651036 ATTTGGAGGAAAGATGAGGAAGG + Intronic
1034031591 7:147772658-147772680 ATGGAGAAGAAAGAAGGCAATGG - Intronic
1034246809 7:149651117-149651139 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1034271313 7:149804588-149804610 ATGGGGAAGAAAGAGGAGTGGGG + Intergenic
1034346495 7:150388505-150388527 AGAGAGAAGAAAGAGGAGGCAGG + Intronic
1034446492 7:151116511-151116533 CTGGAGCAGGAAGAGGAGGAAGG + Intronic
1034581153 7:152043688-152043710 CTGGAAAAGAAAGATCCGGAGGG + Intronic
1035226765 7:157438121-157438143 GGGGAGGGGAAAGATGAGGAGGG - Intergenic
1035226772 7:157438141-157438163 GGGGAGGGGAAAGATGAGGAGGG - Intergenic
1035226779 7:157438161-157438183 GGGGAGGGGAAAGATGAGGAGGG - Intergenic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035333042 7:158108529-158108551 ATGGACAGGAAAGATGTGGAGGG - Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036441918 8:8789251-8789273 ATAGGGAAGAAAGCAGAGGAAGG + Intronic
1036592981 8:10185621-10185643 ATGGAGAAGAAAGTAGCAGATGG + Intronic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037024333 8:14014401-14014423 ATGAGGAAGAAAGAGGATGAGGG + Intergenic
1037501871 8:19494386-19494408 ATGGAGTGGAATGATCAGGAAGG - Intronic
1037598423 8:20373689-20373711 GTGGAGGGGAAAGAGGAGGAGGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1037691297 8:21183495-21183517 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
1037703362 8:21295417-21295439 AAGGAGAAAAATGATGAGTAGGG - Intergenic
1037755981 8:21710309-21710331 GCAGAGAAGGAAGATGAGGATGG - Intronic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038497412 8:28013361-28013383 ATGGGGAAGAGAGAGGGGGAGGG + Intergenic
1039435031 8:37554078-37554100 ACAGAGAAGAAAGAGGATGATGG - Intergenic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039712194 8:40067248-40067270 ATGAAGAAGAGAGAAGGGGAAGG - Intergenic
1039758478 8:40548306-40548328 AAGGAGGAGGAAGAAGAGGAAGG + Intronic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1040315637 8:46259462-46259484 ATGCAGAGGAATGTTGAGGAAGG + Intergenic
1040324649 8:46335577-46335599 ATGCAGGGGAAAGTTGAGGAAGG + Intergenic
1040365731 8:46713126-46713148 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1040608920 8:48963146-48963168 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041101044 8:54396689-54396711 TTGGAGGAGAAAGATTAGGGTGG + Intergenic
1041401400 8:57448890-57448912 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1041456253 8:58064042-58064064 AGGAAGAAGAGAGATGGGGAAGG + Intronic
1041499486 8:58524626-58524648 ATGGAAAAGAAAGAATAGAATGG - Intergenic
1041585832 8:59517820-59517842 AAGAAGAAGAAAGAAGAAGAAGG + Intergenic
1041646019 8:60253511-60253533 ATGGGAAAAAAAGATGTGGATGG - Intronic
1041890155 8:62859223-62859245 ATGGAGAAGAAAGAAAAGCAGGG - Intronic
1042256161 8:66806015-66806037 ATGTAGAAGAAATATGAAAAAGG - Intronic
1042311056 8:67379812-67379834 AAGGAGAAGAAAGAGAAAGAGGG - Intergenic
1042328761 8:67556068-67556090 ATGCAGAACAGAGATGTGGATGG + Intronic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1042487629 8:69363910-69363932 AAGGAGAAGGAAGAGGAGCAGGG + Intergenic
1042553478 8:70014780-70014802 AAGGAGAAGAAAGAAGAAGAAGG - Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043140765 8:76587094-76587116 GTGGAGAAGAAACATGTGAAAGG + Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1043778982 8:84307688-84307710 ATGGGGAAGAAAGAGGAGCAAGG + Intronic
1044228893 8:89751441-89751463 AGGATGAAGAAAGAAGAGGAAGG + Intergenic
1044255662 8:90057262-90057284 ATGTATAAGAAAGTTGAGGCCGG - Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044451175 8:92336767-92336789 ATGGAGAACAAAGAAAAGCATGG - Intergenic
1044458690 8:92419055-92419077 ATGGAGAAGAAAGAAAGGGAAGG + Intergenic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1044873065 8:96639129-96639151 AAGGAGAAGAAAGTTTAGTAGGG - Intergenic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045684519 8:104698623-104698645 ATTTAAAAGAAAGATGAGGCGGG + Intronic
1045840040 8:106569246-106569268 ATTGAGAAGAAAGAAGAAGGGGG - Intronic
1046063243 8:109164273-109164295 AAGGGGAAGAAAGGGGAGGAGGG + Intergenic
1046245752 8:111560293-111560315 ATGGGGAAGAAAGCCTAGGATGG - Intergenic
1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG + Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046389879 8:113556775-113556797 ATGGAGTAGAAAGAAAAGAAAGG - Intergenic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046560870 8:115835932-115835954 TTGAAGAGGAAAGATGAGAAAGG + Intergenic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046875293 8:119248448-119248470 AAGGAGAAGTAAGATTAGGTAGG + Intergenic
1046888245 8:119392869-119392891 AGAAAGAAGAAAGAGGAGGAAGG - Intergenic
1047083720 8:121493479-121493501 ATGTTGGAGAAAAATGAGGATGG + Intergenic
1047297122 8:123580989-123581011 ATGGAGAAGGAAGAGCAGGTGGG + Intergenic
1047562894 8:126008579-126008601 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1047631012 8:126708577-126708599 ATTGAGAGGGAAGATGGGGAAGG - Intergenic
1047994192 8:130317896-130317918 GTGGAGAGGAGAGCTGAGGAAGG + Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048079187 8:131106447-131106469 ATGGAGAAGCAATAAGAGAAGGG - Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048586698 8:135780658-135780680 AAAGACAAGAAAGGTGAGGAAGG - Intergenic
1048664343 8:136644022-136644044 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1048686663 8:136911976-136911998 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1048859618 8:138714408-138714430 ATGGAGAGGACAGAGAAGGACGG + Intronic
1049183710 8:141237571-141237593 CTGGAGGAGAAAGATTAGGAAGG - Intronic
1049217925 8:141416200-141416222 ATGGATAAGAAAACTGAGGCTGG + Intronic
1049695249 8:143980946-143980968 ATTGAGATGGAAGATGAGGGAGG + Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1049857480 8:144871913-144871935 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050132652 9:2428723-2428745 ATGGAGAGGAGAGAAGGGGAAGG + Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050283287 9:4074894-4074916 TTGGAGAAGAAAGAAGATCATGG - Intronic
1050308731 9:4331671-4331693 ATGACGAAGAAATATGATGAAGG + Intronic
1050567535 9:6901696-6901718 GTGGAGAAGAAAGAAAAAGATGG + Intronic
1050899178 9:10923566-10923588 AAGCAGAAGAAATATGAGAAAGG - Intergenic
1051502551 9:17793689-17793711 ATAGAGAAGAATGAGAAGGAAGG - Intronic
1051517746 9:17949680-17949702 CTGGAGAAGAAAGATAAGAAAGG - Intergenic
1051581784 9:18684039-18684061 GTGGAGGAGAAAAATGAAGAGGG - Intronic
1051859661 9:21609956-21609978 ACAGATAAGGAAGATGAGGAAGG + Intergenic
1051907609 9:22114496-22114518 ATGAAGGAGAAAGGAGAGGAAGG + Intergenic
1051939006 9:22481866-22481888 ATGGAGAATATAGAAGAGCAAGG + Intergenic
1052025139 9:23565865-23565887 ATGGGGAAGAATGATTAGAAGGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052492343 9:29185749-29185771 ATGAAGCAGCAAGATGTGGAAGG - Intergenic
1052500643 9:29285195-29285217 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1052879662 9:33593592-33593614 GTGGGGTCGAAAGATGAGGATGG + Intergenic
1053050844 9:34959045-34959067 ATGGAGAAGAAAAATCCGAATGG - Intronic
1053095343 9:35322435-35322457 TTGTTGAAGAAAGCTGAGGAAGG + Intronic
1053244053 9:36519944-36519966 AAGAAGAAGAAAGAAGAAGAGGG - Intergenic
1053382659 9:37661478-37661500 ATGGAGAAGAGAGATAAGACTGG + Intronic
1053446512 9:38157246-38157268 ATGCAGGAAAGAGATGAGGATGG - Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054720597 9:68599905-68599927 ATGAAGAGGAGAGAGGAGGATGG - Intergenic
1054879914 9:70134323-70134345 ATGGAGAAGGAAGTGGGGGATGG - Intronic
1054989005 9:71299522-71299544 AGGGAGAAAAAAGAAAAGGAAGG + Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055713086 9:79086877-79086899 AGAGAGAAGAAAGAGAAGGAAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055785346 9:79864500-79864522 CGGGAGAGGAAAGAGGAGGAAGG - Intergenic
1055829016 9:80358707-80358729 TGGGAGAGGAAAGAGGAGGAGGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056831204 9:89918809-89918831 ATGGAAAAGAAAGACGGGGGAGG - Intergenic
1056838971 9:89982356-89982378 AGGGAGAAGAAAGGTTTGGAAGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057489347 9:95509231-95509253 TTGGAGAAAGAAGAGGAGGAGGG + Intronic
1057493347 9:95540091-95540113 GTGGAGAAGAGAGAAGCGGAAGG - Intergenic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1058059900 9:100484224-100484246 ATTTAGAAAAAAGATGATGATGG - Intronic
1058125339 9:101187211-101187233 AGGGAGGATAAAGATGATGATGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058842652 9:108925083-108925105 ATCCAGATGAAAGATAAGGAAGG - Intronic
1058955273 9:109941086-109941108 AGGAAGAAAAAAGAAGAGGAAGG - Intronic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059015128 9:110506937-110506959 AGGGAAAAGAAAGAGGAAGATGG + Intronic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059771395 9:117429798-117429820 ATGGAGCAGAAAGTTGAGGAAGG + Intergenic
1060018060 9:120104421-120104443 ATGGAGGAGAAGGATTGGGATGG + Intergenic
1060378049 9:123136339-123136361 TTTGAGAAGAAAGATAAGGCTGG + Intronic
1060451216 9:123742484-123742506 ATTGAGCAGAAACATGTGGAAGG - Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060765351 9:126291650-126291672 GTGGGGAAGAAGGATCAGGAGGG - Intergenic
1061255672 9:129453395-129453417 ATGGAGTAGAGGGATGGGGATGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062676205 9:137745983-137746005 ATCCAGAAGAAAAATGAGCAGGG - Intronic
1203608277 Un_KI270748v1:74297-74319 GGGGAGAAGAGAGATAAGGAGGG + Intergenic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1185662009 X:1735515-1735537 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185913542 X:4009017-4009039 GTGGAAAAGAGAGATAAGGAAGG + Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186311707 X:8326794-8326816 ATGGAGAAAAGAGTAGAGGATGG - Intergenic
1186361441 X:8846105-8846127 AAGGAGAAGGAAGAGGAAGAAGG - Intergenic
1186795141 X:13039833-13039855 GATGAGCAGAAAGATGAGGAAGG - Exonic
1187092409 X:16110643-16110665 ATGGAAAAAAAAGATCACGATGG + Intergenic
1187167543 X:16818537-16818559 AAGGAGAAAAAAGATGGAGAAGG - Intronic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187344138 X:18447624-18447646 ATGGAGAACAAGGATGACAATGG - Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187571485 X:20508247-20508269 ATGGGGAAGTAAGATTGGGAAGG - Intergenic
1187766559 X:22648995-22649017 AGGCAGAAGAAAGATGGGCAAGG + Intergenic
1187967131 X:24623077-24623099 ATGGAGGAGAGAGATAAGAAAGG + Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188211624 X:27432424-27432446 AGGGAGAAAACAGAAGAGGATGG + Intergenic
1188519673 X:31024235-31024257 CTGAAGAAGAAAGATAAGGTAGG - Intergenic
1188661194 X:32760897-32760919 ATGAAGAAGAAATAAGAGGAAGG - Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189156489 X:38762463-38762485 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
1189854360 X:45209135-45209157 AAGGGGAAGAAAGAGTAGGAAGG - Intergenic
1190126198 X:47707796-47707818 GTTGAGAAGATAGAGGAGGAGGG + Intergenic
1190483594 X:50901822-50901844 ATGGAGCACAAAGAAGAGAATGG - Intergenic
1190553607 X:51611576-51611598 ATGGAGAGGAAAGAGAAAGAAGG - Intergenic
1190766488 X:53479888-53479910 ATTGAGTAGAAAGCTCAGGATGG + Intergenic
1190869594 X:54413989-54414011 ATGCAGATGAGAGATGATGATGG + Intergenic
1191025739 X:55911229-55911251 ATTGAGAAGGAAGAAGAGCAGGG + Intergenic
1191109872 X:56796089-56796111 AGGGACAAGAAAGATGAAGAGGG - Intergenic
1191110039 X:56797109-56797131 AAGAAGAAGAAAGAAGAAGAGGG - Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1192135116 X:68589587-68589609 AAGGGGAAGAAAGAGCAGGAAGG + Intergenic
1192166636 X:68830826-68830848 AAGGAGAAGAAAGAAAAGAAAGG - Intronic
1192884665 X:75324057-75324079 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1193048671 X:77078771-77078793 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1193601701 X:83514390-83514412 GAGGAGAAGAAAGAGGAGAATGG + Intergenic
1193647808 X:84089745-84089767 ATGGAGGAGAAAGAATAGCAGGG - Intronic
1193738801 X:85193228-85193250 ATGGGGAGGAAAAATGATGATGG + Intergenic
1194403207 X:93462594-93462616 ATGGAGAAAGAAGGTGAAGAGGG + Intergenic
1194426677 X:93747449-93747471 AGGGAGAAAAAAGATGATGAAGG + Intergenic
1194443624 X:93961731-93961753 TTGGGGAAGAAATATGGGGATGG + Intergenic
1194536240 X:95108390-95108412 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1195235815 X:102897227-102897249 AAGGAGAAGAAGGATAAGGGAGG + Intergenic
1196295649 X:113993898-113993920 ATGGAAAAGAACGAAAAGGAGGG - Intergenic
1196345627 X:114653658-114653680 ATAAAGAAGAAAGATGAACAAGG - Intronic
1196583468 X:117402396-117402418 ATGGAGAAGGAAGATGGCAAAGG - Intergenic
1196731106 X:118942317-118942339 AAGGAGAAGAAAGAAGGAGAAGG + Intergenic
1197182086 X:123547627-123547649 AGGAAGAAGAAAGAAGAAGAAGG + Intergenic
1197273058 X:124447160-124447182 AGAGAGAAGAAAGCTGAGCAGGG - Intronic
1197508923 X:127346617-127346639 AAGGAGAGGAAAGAGTAGGAAGG - Intergenic
1197636021 X:128915633-128915655 AAGGAAAAGACAGAAGAGGAGGG + Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1197775838 X:130118199-130118221 TTGGAGAGGAGAGATCAGGAGGG + Intergenic
1197795216 X:130291075-130291097 TTGGGGAAGAAAGAGGAAGATGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198045735 X:132900603-132900625 ATGTAGAAAAATGATGAGAAAGG + Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198603442 X:138310461-138310483 ATGGAGATGGAAGTTGGGGATGG - Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199541851 X:148966448-148966470 ATAGAGAGGAGAGAGGAGGAGGG - Intronic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1199982788 X:152929917-152929939 GTGGAACAGAAAGATGAAGAGGG - Intronic
1200103674 X:153700935-153700957 ATGGACAAGAAGGAAGAGTAAGG - Exonic
1200269855 X:154672231-154672253 AAGAAGAAGAAAGAAGAAGAAGG - Intergenic
1201058015 Y:10015291-10015313 ATAGAGAAGAAAGAAAAGGAAGG + Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201266117 Y:12208385-12208407 TTGGAGAAGACAGTTGAAGAGGG - Intergenic
1201370038 Y:13253376-13253398 CTGGAAAAGAAAGATCTGGAGGG - Intronic
1201479076 Y:14418056-14418078 TTGGAGAACAAATATGAGAAGGG + Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1201926545 Y:19293924-19293946 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1202164089 Y:21968590-21968612 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1202227267 Y:22617774-22617796 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1202315855 Y:23577880-23577902 CTGGAAAAGAAAGATCTGGAGGG + Intergenic
1202554910 Y:26092194-26092216 CTGGAAAAGAAAGATCTGGAGGG - Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic