ID: 930627783

View in Genome Browser
Species Human (GRCh38)
Location 2:53718196-53718218
Sequence TGTGAACGTGAATATCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930627781_930627783 21 Left 930627781 2:53718152-53718174 CCAGAGAGGAAGACATCCAGATA 0: 1
1: 2
2: 4
3: 21
4: 242
Right 930627783 2:53718196-53718218 TGTGAACGTGAATATCACCATGG 0: 1
1: 0
2: 0
3: 13
4: 96
930627782_930627783 5 Left 930627782 2:53718168-53718190 CCAGATAGAAGCAATACAGAGAA 0: 1
1: 0
2: 9
3: 80
4: 377
Right 930627783 2:53718196-53718218 TGTGAACGTGAATATCACCATGG 0: 1
1: 0
2: 0
3: 13
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930627783 Original CRISPR TGTGAACGTGAATATCACCA TGG Intronic
902962381 1:19974137-19974159 TGTGAAAGTGAACATGACCAGGG + Intergenic
905926631 1:41754695-41754717 TGTGAATCTTGATATCACCAAGG + Intronic
908670606 1:66543535-66543557 TTTGAACGTGAAAAACACCATGG - Intronic
913566766 1:120080329-120080351 TGAGAACTTGCTTATCACCAAGG - Intergenic
913631366 1:120713223-120713245 TGAGAACTTGCTTATCACCAAGG + Intergenic
914287521 1:146241036-146241058 TGAGAACTTGCTTATCACCAAGG - Intergenic
914548553 1:148691778-148691800 TGAGAACTTGCTTATCACCAAGG - Intergenic
914618125 1:149379933-149379955 TGAGAACTTGCTTATCACCAAGG + Intergenic
922542328 1:226428758-226428780 TGTGAACTTTAGAATCACCAGGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809002 10:447967-447989 TGTGATCCTGAATATCAACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1073909958 10:108330265-108330287 TGGGAACTTTAATATCATCAAGG - Intergenic
1075483949 10:122805442-122805464 GGTCAACGTGAATTTCAGCAGGG + Intergenic
1082304757 11:50558203-50558225 GGTGAATGTGCACATCACCAAGG + Intergenic
1087345892 11:96970607-96970629 AGTCAATGTGAATAGCACCATGG - Intergenic
1088030669 11:105245506-105245528 TTTGAACCTGAAAATCACCTGGG + Intergenic
1088052503 11:105534489-105534511 TCTCAAAGTGAATATCAGCAGGG - Intergenic
1088143519 11:106647956-106647978 TCTGAACGTATTTATCACCAGGG + Intergenic
1088594083 11:111426827-111426849 TGGGAAAGTTAATATCACCCCGG + Intronic
1091683487 12:2543784-2543806 TATGAACCTGAATTTGACCAGGG - Intronic
1095931026 12:47625003-47625025 TGTTTACCTGAGTATCACCAGGG - Intergenic
1097171200 12:57114238-57114260 TGTGAACGTGAAAATGGCCAAGG - Intronic
1097945238 12:65360438-65360460 AGAGAAGGTGAATATCAACAAGG + Intronic
1098621834 12:72610698-72610720 TGAGAATGAGAACATCACCATGG + Intronic
1099047665 12:77742936-77742958 TGTAAACCTGAATAATACCATGG + Intergenic
1101157556 12:101942154-101942176 GGTGAACATGAATATCACTCAGG + Intronic
1107783919 13:43935296-43935318 TGAGAAGTTGAATAGCACCATGG + Intergenic
1108119441 13:47167595-47167617 AGTGAAAGTGAAGATCACAAAGG + Intergenic
1109373884 13:61462900-61462922 TGTTAACGTGAGTCTCACCAAGG + Intergenic
1116552692 14:46262469-46262491 TGTGAAAGTGTATTTGACCATGG - Intergenic
1117060093 14:51953541-51953563 TTTGAATGTGAAGATCACCTAGG - Intronic
1126713319 15:51484850-51484872 TGTGAATTTGAAATTCACCAAGG + Intronic
1130628641 15:85542463-85542485 TCTATACGTGAATATCACAAAGG - Intronic
1132052778 15:98623269-98623291 TGTGAAAATTAAAATCACCATGG + Intergenic
1132295710 15:100732723-100732745 TGTGCACGGGAATAGCAACAAGG + Intergenic
1136288680 16:29258908-29258930 TCTGCATGTAAATATCACCAGGG + Intergenic
1136331720 16:29583605-29583627 TATGAATATGAATATCAACAGGG + Intergenic
1136446358 16:30323349-30323371 TATGAATATGAATATCAACAGGG + Intergenic
1138808813 16:60124428-60124450 TGTGAAGGTGAATATAACATTGG - Intergenic
1141345080 16:83237263-83237285 TGTGACCGTGAGCATCACCATGG - Intronic
1142094401 16:88231813-88231835 TCTGCATGTAAATATCACCAGGG + Intergenic
1143615635 17:8047612-8047634 GGAGCAGGTGAATATCACCATGG - Exonic
1146327144 17:31896462-31896484 TGTGAACGTGAAAGTCACAAAGG - Intronic
1147424393 17:40339118-40339140 TGGGTACGTGAAACTCACCAAGG - Intronic
1149737324 17:59008256-59008278 TGTGAATGTGCAAATCAACAGGG - Intronic
1149911801 17:60573677-60573699 TGTGACCTTGATTATCTCCAAGG - Intronic
1153941216 18:9979430-9979452 TGATAAAGGGAATATCACCATGG - Intergenic
1155081966 18:22419191-22419213 TGTGAACGTGATTCTGATCACGG - Intergenic
1158727622 18:59988035-59988057 TGAGAAAGTGAAGAGCACCAAGG - Intergenic
1159999663 18:75004620-75004642 TGAGAACTGGAATTTCACCAGGG + Intronic
925859206 2:8158933-8158955 TGTGCATGTGAATACCACCTGGG + Intergenic
927374379 2:22396712-22396734 TGAGACAATGAATATCACCAGGG + Intergenic
927507474 2:23623772-23623794 TGTGAATGTGAATGTCATCCCGG + Intronic
930627783 2:53718196-53718218 TGTGAACGTGAATATCACCATGG + Intronic
932212852 2:69946312-69946334 TGTGCACGTGACCATCACCCAGG - Intergenic
932372819 2:71207092-71207114 AGAGAATGTAAATATCACCAGGG - Intronic
933343180 2:81048639-81048661 TGTGGATGTGAATGCCACCAAGG + Intergenic
933816170 2:86070304-86070326 TGCAAACGTCAGTATCACCACGG + Intronic
937072562 2:119075100-119075122 TGGGAACCTGAATAGCACCAGGG - Intergenic
938628127 2:133134255-133134277 TGTGGAAGTGGATATCAACAGGG - Intronic
945186528 2:207145641-207145663 TGTGACTGTGAATGTCACTAAGG + Intronic
1169526767 20:6436818-6436840 TGTGGACATGAAAATCACCTGGG - Intergenic
1170770797 20:19330832-19330854 TGTTAAAGTTAACATCACCAAGG + Intronic
1172174353 20:32963180-32963202 TGTGAAAGTGAAAATCAACAAGG - Intergenic
1172393020 20:34579078-34579100 TAAGAAAGGGAATATCACCATGG - Intronic
1172829298 20:37819389-37819411 TGTACAGGTGAATATCACTAGGG - Intronic
1173904587 20:46616831-46616853 TGGGAACCTGAATATCAGCTGGG + Intronic
1179724122 21:43332298-43332320 TGGGAAGGCGAAGATCACCAGGG + Intergenic
1182817098 22:33174647-33174669 TGAGAAAGGGAATATCACCACGG + Intronic
1182863084 22:33578087-33578109 GGTGAATGTCAATATTACCACGG - Intronic
951282244 3:20766054-20766076 TGTGAACTGTAATAGCACCATGG - Intergenic
952691587 3:36212727-36212749 TATGCATGTGTATATCACCAAGG + Intergenic
957982797 3:87532256-87532278 TGTGACTGTAAATAGCACCATGG + Intergenic
960243161 3:115369832-115369854 TGTCAACTTGAATTTCTCCAAGG + Intergenic
960298398 3:115971689-115971711 TGATAAGGTGATTATCACCATGG + Intronic
962934226 3:140064892-140064914 TGACAAAGGGAATATCACCATGG + Intronic
966242362 3:177768783-177768805 TGTAGACGTGGATACCACCAAGG + Intergenic
967678389 3:192328593-192328615 TGTAACCGTGAGTATAACCATGG + Intronic
970568774 4:17358851-17358873 TGTCATCGTTATTATCACCATGG + Intergenic
971008155 4:22398853-22398875 TGTGCACGTGAATATGAGCATGG - Intronic
974155347 4:58064297-58064319 TGTGAAGATGAATATCATTATGG + Intergenic
976469904 4:85416569-85416591 TGTCAAAGTAAATTTCACCATGG + Intergenic
979606267 4:122642188-122642210 TGTGAACATTTAAATCACCAAGG + Intergenic
984133414 4:175906533-175906555 TGTGTGTCTGAATATCACCATGG - Intronic
990031629 5:51267346-51267368 TCTGAACATGAATATCTCCAGGG - Intergenic
1003017468 6:2479532-2479554 TGTGAAGGACAATGTCACCAAGG + Intergenic
1005440500 6:25862346-25862368 TGTCATCATGAACATCACCATGG - Exonic
1008526882 6:52416614-52416636 TGAGCACGTGAATATGGCCAGGG - Intergenic
1011866532 6:91835800-91835822 TGTGAATGAGAATAAAACCAAGG + Intergenic
1023923704 7:44649626-44649648 TGTGCACGTTAGTATAACCAGGG + Intronic
1031386370 7:121156865-121156887 TGTAAACTTGAATAACACCAGGG + Intronic
1034027760 7:147725642-147725664 TGTGAACGTGATTTCCCCCAAGG + Intronic
1035910400 8:3559282-3559304 TGTGAACATGAAGATCGCCATGG + Intronic
1038581379 8:28751985-28752007 GGGGAAGGTGAATTTCACCAAGG - Exonic
1040401498 8:47054280-47054302 TTTACAGGTGAATATCACCAAGG + Intergenic
1041872567 8:62651769-62651791 TGAGAACTTGCTTATCACCAAGG - Intronic
1043637053 8:82398534-82398556 TTTGAACATGAATATTACAAGGG + Intergenic
1050102195 9:2130556-2130578 TGTGAAAGAGAATATTAACATGG + Intronic
1051770177 9:20569223-20569245 TGTGTATGTGAATAAGACCATGG - Intronic
1055357691 9:75454257-75454279 GGTGAACGTCCTTATCACCAGGG + Intergenic
1056086488 9:83154680-83154702 TGTGAGCAAGGATATCACCATGG - Intergenic
1187270249 X:17774097-17774119 TGTGAGCATGAATATCAGGAAGG - Intergenic
1188729913 X:33633034-33633056 TGTGAATGAGAAATTCACCAAGG + Intergenic
1188885943 X:35548935-35548957 TGTAAAAGTAAATAACACCAGGG + Intergenic
1190959270 X:55229029-55229051 TGAGAACTTGCTTATCACCAAGG - Intronic
1198282130 X:135152828-135152850 TGTGTACATGAATTGCACCATGG + Intergenic
1198288829 X:135219694-135219716 TGTGTACATGAATTGCACCATGG - Intergenic
1199303636 X:146241554-146241576 TGTGTACCTGAATGTCCCCACGG + Intergenic
1200171149 X:154075968-154075990 TGTGAATATGAATTTCAACATGG + Intronic