ID: 930630819

View in Genome Browser
Species Human (GRCh38)
Location 2:53753059-53753081
Sequence CAACCAGGAGGTAAAAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930630813_930630819 29 Left 930630813 2:53753007-53753029 CCTTACAGCAGAAAGAGTGAACC 0: 1
1: 2
2: 9
3: 27
4: 162
Right 930630819 2:53753059-53753081 CAACCAGGAGGTAAAAGGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 354
930630814_930630819 8 Left 930630814 2:53753028-53753050 CCTTAATGTACGCAATTTAAAAA 0: 1
1: 0
2: 12
3: 62
4: 326
Right 930630819 2:53753059-53753081 CAACCAGGAGGTAAAAGGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930630819 Original CRISPR CAACCAGGAGGTAAAAGGAA GGG Intronic
901029746 1:6300206-6300228 CAAGCAGGAGTTTTAAGGAAGGG + Intronic
902959622 1:19953859-19953881 CAACCAGGAGCCAAAGGGCAAGG - Intergenic
903395275 1:22997190-22997212 AAAATAGGAGGGAAAAGGAAAGG - Intergenic
903915201 1:26758733-26758755 CAACCACAAGGTAACAGCAAAGG - Intronic
907547717 1:55276872-55276894 CAACCAGAAGCCAAAAGGCAAGG - Intergenic
908060993 1:60348711-60348733 CCACCAAGAGGAAAAATGAATGG + Intergenic
908382083 1:63606372-63606394 CACCCAGGATATGAAAGGAAGGG - Intronic
908645932 1:66277806-66277828 TAACCAGGAGGTACATGGAAGGG - Intronic
908858892 1:68460851-68460873 CAACCAGGAGGCAAAACCTAGGG - Intergenic
908986555 1:70030789-70030811 CAACTAAGGGGAAAAAGGAAAGG + Intronic
910785821 1:90997227-90997249 CAAGCAGGAAGTAAAAAGTAAGG + Intronic
910866338 1:91791635-91791657 CAAGTAAGAGCTAAAAGGAAAGG + Intronic
914461694 1:147891115-147891137 GTAAGAGGAGGTAAAAGGAAGGG + Intergenic
915814514 1:158952304-158952326 CAAGCAGTAGGTAGAAAGAAAGG - Intronic
917255228 1:173108735-173108757 CAAGCAGGAGGTAAAATCTAAGG - Intergenic
917556560 1:176096386-176096408 AAACCAGGAGGTAAGGGGAGTGG - Intronic
917861261 1:179146786-179146808 CTGCCATGAGGAAAAAGGAAAGG + Intronic
918045876 1:180940886-180940908 CAACCAGGCTGTAGAAAGAAAGG - Intronic
919571164 1:199249747-199249769 CTACCAGGGGGTAAAAGGTTGGG + Intergenic
920023268 1:202971744-202971766 TAACCAGGAGTTAAAGGTAAGGG - Intergenic
920259206 1:204677566-204677588 CACCCAGGCAGTGAAAGGAAGGG + Intronic
920368406 1:205460914-205460936 CAACTAAGAAGGAAAAGGAAGGG + Intergenic
920393489 1:205626480-205626502 CAAAAAGGTAGTAAAAGGAAGGG - Intronic
920881697 1:209886925-209886947 CAAGGAGGAGGGAAAAGGATGGG - Intergenic
921136761 1:212267792-212267814 CAAAAATGAGGTAAGAGGAAAGG + Intergenic
921383351 1:214546953-214546975 GAACCAACAGGAAAAAGGAAAGG + Intronic
921493508 1:215808006-215808028 CAACTAAGAGGTGAAAGAAATGG + Intronic
923291449 1:232549865-232549887 TAACCAGCAGGGAAAAAGAATGG + Intronic
924280339 1:242430689-242430711 GAACCAGCAGGTAGAAGGGAGGG - Intronic
1063209459 10:3865948-3865970 AGACCAAGAGGTTAAAGGAATGG - Intergenic
1064138826 10:12773041-12773063 GAACCAGGATGTCAAAGGAGAGG - Intronic
1064142435 10:12801937-12801959 CAGCCAGGAAGTCAGAGGAAAGG - Intronic
1065187357 10:23181331-23181353 CAGCCAGCAAGAAAAAGGAAAGG - Intergenic
1065904327 10:30235924-30235946 CAAACAAGATGTAAAAGCAATGG + Intergenic
1066148034 10:32583269-32583291 AGAACAGGAGGTAAAATGAATGG - Exonic
1066425467 10:35304019-35304041 CACCCAGCAGGTATCAGGAATGG - Intronic
1067044634 10:42977810-42977832 AAATCAGGAAGTAAAAGGAAAGG - Intergenic
1067479432 10:46585375-46585397 CAAAGAGGAAGGAAAAGGAAGGG + Intronic
1067615306 10:47756423-47756445 CAAAGAGGAAGGAAAAGGAAGGG - Intergenic
1068872784 10:61963369-61963391 AGACCAGGAGGTAACAGGTAGGG - Intronic
1069560912 10:69428792-69428814 TAACCAGGAGGTGAAAGCAGGGG + Intergenic
1070737170 10:78871099-78871121 GAGCCAGGAGGCAAAAGGATGGG - Intergenic
1071630707 10:87216374-87216396 CAAAGAGGAAGGAAAAGGAAGGG - Intergenic
1072583350 10:96759539-96759561 CAACAGGAAGGGAAAAGGAAGGG + Intergenic
1072881737 10:99235132-99235154 CAACAAAGAGCTGAAAGGAATGG - Intronic
1073425853 10:103455180-103455202 AAACCAGGTGGAAAAAGGAAGGG - Exonic
1074391077 10:113058551-113058573 TGACCAGGAAGCAAAAGGAAGGG - Intronic
1075273443 10:121073167-121073189 TAACAAAGAGGCAAAAGGAAAGG + Intergenic
1075564173 10:123491734-123491756 GAAGTAGGATGTAAAAGGAATGG + Intergenic
1075642570 10:124075360-124075382 CAGCCAGGAGGTATAAAGGATGG + Intronic
1076007232 10:126957264-126957286 CAACCAGGAGGGAGAAGACAGGG - Intronic
1076575165 10:131461062-131461084 TAACCAGGAGATACAAGAAAGGG - Intergenic
1078043340 11:7889813-7889835 GAACCTGGAGTTAAAGGGAAAGG + Intergenic
1078528450 11:12118461-12118483 CAACCAGGATGTAAAGAGACAGG + Intronic
1078873838 11:15374391-15374413 CAGCCATGTGGTAAAAGGCAGGG + Intergenic
1079015157 11:16862494-16862516 CTAGCAGGAGGTAAAAGAAGAGG + Intronic
1079480653 11:20876377-20876399 AAACCAGGACATGAAAGGAATGG - Intronic
1080131227 11:28797384-28797406 CAACATAGAGGAAAAAGGAAAGG + Intergenic
1083395488 11:62388734-62388756 CCACCAAGAGGAGAAAGGAAAGG - Intronic
1083474266 11:62905891-62905913 CAACAAGGAGATAGAAGGTAGGG - Intergenic
1083479521 11:62934564-62934586 GAAACAGGAGGTAAGAAGAAAGG - Intergenic
1084383635 11:68828834-68828856 CCCCCAGGAGGAAGAAGGAACGG - Intronic
1084648684 11:70475395-70475417 CCTCCAGGAGCTAAAAGCAAAGG + Intronic
1084708810 11:70831306-70831328 AAACCAGGAGGAAAGAGGAGAGG + Intronic
1085650948 11:78268070-78268092 CAACCAGTGGGGAGAAGGAAGGG + Intronic
1086037509 11:82434687-82434709 AAAGGAGGATGTAAAAGGAAAGG - Intergenic
1086186140 11:84019277-84019299 TAACCAGGATATTAAAGGAAAGG + Intronic
1087044195 11:93830602-93830624 CAACCAGGAGAGAGCAGGAAAGG + Intronic
1088128238 11:106455338-106455360 CAAACAGGAAGTAAAAGCTAAGG - Intergenic
1089297412 11:117478364-117478386 CACCCAGGAGTAAACAGGAAGGG - Intronic
1089759875 11:120715518-120715540 CAAACAGGAAAGAAAAGGAAAGG - Intronic
1090320277 11:125837231-125837253 TGACCAGGAGGTAAGAGGAGAGG - Intronic
1091024108 11:132126712-132126734 CTACCAGGAGGCAAAGGGAGAGG + Intronic
1091629221 12:2146707-2146729 CCACCAGCAGGTAAACAGAATGG - Intronic
1091803573 12:3340722-3340744 CAACCAACAGGAAGAAGGAAAGG - Intergenic
1092363784 12:7860293-7860315 CAGGCAGAAGATAAAAGGAAAGG + Intronic
1092937339 12:13376333-13376355 CACACAGAAGGTAAAAGGCAGGG + Exonic
1093395209 12:18672754-18672776 CTACCAGGAGGTTGAAGGGAGGG - Intergenic
1093747493 12:22759835-22759857 CCAGCAGGAGATAAGAGGAAGGG - Intergenic
1094107191 12:26826539-26826561 CAAGCAGGAAGTAAAAATAAGGG + Intronic
1094627312 12:32136360-32136382 AAACCAGAAGCAAAAAGGAATGG + Intronic
1096346876 12:50856288-50856310 CAATCATGAGGTAAGGGGAAAGG - Intronic
1096796179 12:54079392-54079414 CCACCAGGAGACAGAAGGAAGGG - Intergenic
1097283515 12:57860488-57860510 CAGCCAGGAGGAGAAAGGAAAGG + Intergenic
1098447453 12:70580877-70580899 CATCCAGAAGGTATATGGAATGG - Intronic
1098562756 12:71895163-71895185 GAACTAAGAGGTAATAGGAAAGG - Intronic
1098601831 12:72340688-72340710 CAAGCAGCAGGAAAGAGGAAAGG + Intronic
1098620965 12:72597906-72597928 AACTCAGGAGGAAAAAGGAAAGG + Intronic
1098766226 12:74493073-74493095 AAAGCAGTAAGTAAAAGGAAAGG - Intergenic
1099364153 12:81746711-81746733 AAAAGAGGAGGTAAAAGGGAGGG + Intronic
1100827419 12:98488032-98488054 ATACCAGGAGGTATAAGGTATGG - Intronic
1101494574 12:105241510-105241532 CACCTGGGAGGTAAAAGGACAGG - Intronic
1101791801 12:107934341-107934363 CCAACAGGAGGAAAAAGTAACGG - Intergenic
1103162570 12:118742019-118742041 CAACAAAGAGTTAAAAGCAATGG - Intergenic
1103200931 12:119087372-119087394 GAACAAGGAGGAAAAAGGAGTGG + Intronic
1103211327 12:119168879-119168901 CAGCCAGCAAGAAAAAGGAAGGG - Intergenic
1104411136 12:128558752-128558774 CAACCTGTAGGTAAAAGAGAGGG + Intronic
1104427948 12:128693463-128693485 CAACCAGTAGGAATAAGAAATGG + Intronic
1104502328 12:129297981-129298003 CAACCACAAGGGAAAAGAAAAGG + Intronic
1107700010 13:43037612-43037634 AAATCAGGAGGTAAAAATAAAGG - Intronic
1108067406 13:46592368-46592390 AATCCAGGAGCTAAAAGGATGGG - Intronic
1108253819 13:48591827-48591849 CAACAAGGAAGTAAAACCAAAGG - Intergenic
1108257077 13:48621257-48621279 CAAGAAGGAGGGAAAAAGAAAGG - Intergenic
1108487875 13:50945396-50945418 CAACCAAGAGGGGAAAGGCAGGG - Intronic
1109115573 13:58378525-58378547 CACCAATGAGGTATAAGGAAAGG - Intergenic
1110411658 13:75210437-75210459 AAATAAGGAGGTCAAAGGAAAGG + Intergenic
1111018599 13:82415350-82415372 CAATAAGAAAGTAAAAGGAAAGG + Intergenic
1111496932 13:89062976-89062998 TAACCAGAAGCTTAAAGGAAAGG - Intergenic
1111586313 13:90288496-90288518 CAACAAGGAGGTGCAAGGAAAGG + Intergenic
1114400360 14:22404675-22404697 TAAGCAGGAAGGAAAAGGAAGGG + Intergenic
1114549122 14:23523122-23523144 GAATCAGGAAGGAAAAGGAAGGG + Intronic
1116500071 14:45610097-45610119 CAACAAGGAGGAAAAAAGAGAGG - Intergenic
1118002120 14:61533050-61533072 CAGCCAGAAGGTAACAGGACTGG - Intronic
1119218876 14:72890952-72890974 CAACAAGGAAGAAAAAGAAAGGG + Intronic
1120033455 14:79668752-79668774 CATCCAGGGGGTAAAAGTCATGG - Intronic
1121833270 14:97069904-97069926 CAGCCAGGAGGAGAGAGGAAGGG - Intergenic
1122694894 14:103547700-103547722 AAACCAGGATGCAAGAGGAAGGG + Intergenic
1124841681 15:33247950-33247972 CATCCAGGAGCTATAAGGTAGGG + Intergenic
1124865958 15:33491593-33491615 TATCCAGGAGGGAAAAAGAAAGG + Intronic
1124936257 15:34174616-34174638 CATGCAGAAAGTAAAAGGAAGGG + Intronic
1125702248 15:41697378-41697400 AAACCAGGAGGTAAAAGAAATGG - Intronic
1125736107 15:41926945-41926967 CCATCAGGAGGAAACAGGAAAGG - Intronic
1126464061 15:48944445-48944467 CAAGCAGCAGGAAGAAGGAATGG - Intronic
1127336674 15:57992932-57992954 CATCAAGGAGGTAAGAGAAACGG - Exonic
1128217797 15:65946293-65946315 CACCCAGGAGGTGAATGGCAAGG + Intronic
1128963831 15:72037461-72037483 TAAGCAGGAAGTAAAAGGTAAGG + Intronic
1130698862 15:86158796-86158818 CAACCAGGGTGGAAAAGAAAGGG + Intronic
1130920784 15:88342802-88342824 CACCCATGAGGTAAAACGAAAGG - Intergenic
1131223000 15:90600845-90600867 GATCCAGGAGACAAAAGGAATGG + Intronic
1132008957 15:98257383-98257405 CAAAAGGTAGGTAAAAGGAAAGG + Intergenic
1133375499 16:5283456-5283478 AAACCAGGAGGTGAAAGGAGGGG - Intergenic
1134307173 16:13043359-13043381 CACCCAGGAGGAAAGAGAAACGG + Intronic
1134507563 16:14820713-14820735 GAAACAGGAGGAGAAAGGAAGGG + Intronic
1134695261 16:16219475-16219497 GAAACAGGAGGAGAAAGGAAGGG + Intronic
1134976571 16:18575211-18575233 GAAACAGGAGGAGAAAGGAAGGG - Intergenic
1136056409 16:27693097-27693119 CAAGCAACAGGTAAAAGGATGGG - Intronic
1137273459 16:46918216-46918238 CAAATAGGAGGTCAGAGGAAAGG + Intronic
1137950727 16:52781122-52781144 CAAACCGGAGGTAAAAGTGAGGG + Intergenic
1137997273 16:53232178-53232200 CATTTAGAAGGTAAAAGGAATGG - Intronic
1138897330 16:61222616-61222638 AAACCAGAAGGTAGAAGGAAAGG - Intergenic
1139330505 16:66185740-66185762 GAAACAGGAGGTATAAGGATTGG - Intergenic
1139486767 16:67261808-67261830 CAACCAGGAAATATAGGGAACGG - Intronic
1139792313 16:69448884-69448906 CAAGGAGGAGGAAAATGGAAGGG - Intronic
1140330868 16:74055611-74055633 CCACCAGGAGGAGCAAGGAATGG - Intergenic
1141683168 16:85555681-85555703 GAACCAGAAGGAAAAAGGAAGGG - Intergenic
1142263968 16:89055128-89055150 CACCCGGGAGGTTAAAGGAAAGG - Intergenic
1142614812 17:1128020-1128042 TAACCAGGAGGGATATGGAAGGG - Intronic
1142759967 17:2036410-2036432 CAGCCTGGGGGTAAAAGGACAGG - Intronic
1142808675 17:2385188-2385210 GGACCAGGAGGGAACAGGAAGGG + Exonic
1143141589 17:4744503-4744525 CAACCAGGAGGTCACTGGAGGGG - Intronic
1144401946 17:14913179-14913201 CAAGCAGGAGGTGAAGGGTAAGG + Intergenic
1146745377 17:35324105-35324127 CAACCAGGAGGGAGAAGAAGTGG - Intergenic
1146933716 17:36796679-36796701 CAACCAGGAGGTAAAACTAAGGG - Intergenic
1148017159 17:44530028-44530050 CAACCAGCAGGGAACAGGACAGG + Intergenic
1149228855 17:54508310-54508332 CAGTCAGGAGGTCAAAGCAATGG + Intergenic
1150748229 17:67834116-67834138 CCACCTGGCGGTAAAGGGAATGG - Intronic
1150969604 17:70011905-70011927 CAACCAGGAAAAAAAAGTAATGG + Intergenic
1151036202 17:70803389-70803411 GAAACAGGAAGTAAAAAGAATGG - Intergenic
1151604003 17:75124900-75124922 CCACCAGGAGCTATAAGGCAGGG - Intronic
1153760088 18:8322533-8322555 AAACCAGGAGCTCAAAGGAGAGG + Intronic
1153877128 18:9383945-9383967 CCAAAAGGAGGGAAAAGGAATGG + Intronic
1157951665 18:52045030-52045052 CAGCAAGAAGGTAAGAGGAAAGG - Intergenic
1158395113 18:57073206-57073228 CATCCAGGAGGTAAGAGGACAGG - Intergenic
1158971562 18:62672933-62672955 CAAGCAGGAGGTAAAGGCTAAGG - Intergenic
1160111632 18:76037674-76037696 CACCCAGGAAGGAAAAGGGATGG - Intergenic
1161918823 19:7250958-7250980 CAGAGAGAAGGTAAAAGGAAAGG + Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1162594750 19:11619618-11619640 TATCCAGAAGGGAAAAGGAATGG + Intergenic
1162695350 19:12469437-12469459 CAGGCAGGAGGAAAAAGGCATGG + Intronic
1163569045 19:18069483-18069505 CCACCAGGACCTAAAAGGGAGGG + Intronic
1164565651 19:29324106-29324128 CACCCAGCCGGTAAAAGGATTGG + Intergenic
1164966185 19:32486885-32486907 CAACCAACATTTAAAAGGAAAGG + Intergenic
1165009439 19:32833185-32833207 CAAACAGGAAGTAAAATAAAAGG + Exonic
1165009979 19:32838157-32838179 CAAACAGGAAGTAAAATAAAAGG + Intronic
1166006200 19:39908865-39908887 CTTCCAGGTGGTACAAGGAAAGG + Intronic
1167309127 19:48726756-48726778 CAAACAGGAAGTAAGAGGCAAGG + Intronic
1168635008 19:57989370-57989392 AAACGAGAAGGAAAAAGGAAAGG + Intronic
926182319 2:10655968-10655990 AAACCAGGAAGCAAAGGGAAAGG + Intronic
926376646 2:12235543-12235565 CAACCAGCAGAAAGAAGGAAAGG - Intergenic
927224386 2:20749005-20749027 CAACCAGTAGATCTAAGGAATGG - Intronic
930045510 2:47168230-47168252 AAACCTGGAGGTCCAAGGAATGG + Intronic
930576054 2:53150207-53150229 ACACCAGGAGGAAAAAGGAGAGG + Intergenic
930630819 2:53753059-53753081 CAACCAGGAGGTAAAAGGAAGGG + Intronic
931092464 2:58900715-58900737 AAAGCAGGAGGCAAAATGAATGG - Intergenic
931880866 2:66569247-66569269 AAACCAGGAGTTTAATGGAAAGG - Intronic
932434578 2:71695495-71695517 CAGATAGGAGGGAAAAGGAAAGG - Intergenic
933315014 2:80705054-80705076 CAACCAGCAGGAGAAAGGAGTGG + Intergenic
934635327 2:95982483-95982505 CACCGAGGAGGGAAAAGAAAGGG - Intronic
934798305 2:97122740-97122762 CACCGAGGAGGGAAAAGAAAGGG + Intronic
934835121 2:97580689-97580711 CACCGAGGAGGGAAAAGAAAGGG - Intronic
935551375 2:104461069-104461091 AAACCAGGAGTTAAAGAGAAAGG - Intergenic
935712281 2:105909757-105909779 CTACCTGGAAGAAAAAGGAATGG + Intergenic
936702825 2:115034226-115034248 AAATCAGGAGTAAAAAGGAAAGG - Intronic
937295274 2:120806483-120806505 CCACCAGGTGGAAAGAGGAAAGG + Intronic
937684656 2:124682052-124682074 CAAGCAGGAAGTAAAAGCTAAGG - Intronic
938234253 2:129690241-129690263 CAAGCAGGAAGTAAAGGGTAAGG + Intergenic
939419382 2:141946216-141946238 CACCCAGAAGATAAAGGGAATGG - Intronic
940297255 2:152140418-152140440 AAATCAGTAGTTAAAAGGAAAGG - Intronic
940473496 2:154130276-154130298 CAACCAGGAGTCAAAGGGAAAGG + Intronic
941672952 2:168314695-168314717 CATCCAGGATGGAAAAGGAAAGG - Intergenic
943627440 2:190216186-190216208 CAACAAGGAGGTGCAAGCAAAGG + Intronic
944134180 2:196380286-196380308 CAAGCAGGAAGTAAAAGTTAAGG - Intronic
944538063 2:200730811-200730833 CACCCAGGAGGTAAAAGTGGAGG - Intergenic
945757857 2:213871613-213871635 CAAGCAGGAGGTAAAGGCTAAGG + Intronic
946494343 2:220180764-220180786 CAAGCAGGAAATAAAATGAATGG - Intergenic
947213500 2:227728892-227728914 CAGAAAGGAGGGAAAAGGAATGG - Intergenic
947382741 2:229560856-229560878 AAACCAGGAGGTAAAGGGGCCGG + Intronic
1170722278 20:18893278-18893300 CTTCCAGAAGATAAAAGGAAAGG + Intergenic
1171141890 20:22750573-22750595 GAATGAGGAGGTGAAAGGAAAGG + Intergenic
1173290685 20:41712270-41712292 CAATCAGAGGGTAAAAAGAAAGG + Intergenic
1173692006 20:44967683-44967705 CAACCAAGAGGTGAAGAGAAGGG + Intronic
1174976763 20:55344607-55344629 TAACTAGAAGTTAAAAGGAAGGG + Intergenic
1175199743 20:57268709-57268731 CATGCAGGAGGGAGAAGGAAAGG + Intergenic
1175481194 20:59312439-59312461 GCACCAGGGGGTCAAAGGAAAGG - Intronic
1177343739 21:19840501-19840523 CAACCAGGGGCTGAAAGGAGGGG + Intergenic
1178470595 21:32889153-32889175 GAACGGGGATGTAAAAGGAAAGG - Intergenic
1181618542 22:24071734-24071756 CAACCTGGAGGGAACATGAAGGG - Intronic
1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG + Intronic
1182410886 22:30185068-30185090 CAACCAGGAGATAGAAGCAGTGG + Intergenic
1184075729 22:42176300-42176322 CAAGAAGGATGTGAAAGGAATGG + Intronic
1185116079 22:48939069-48939091 GGCCCAGGAGGAAAAAGGAAGGG + Intergenic
949451714 3:4192705-4192727 CAACCAGGAGATTAAAGGGTTGG + Intronic
950020823 3:9786483-9786505 CAACCAGCAGGTATAAAGACAGG + Intronic
950244579 3:11404492-11404514 CAAGCAGGAGATAAAAGGCAAGG - Intronic
951035148 3:17924931-17924953 CAAACAGTAGGGAAAAGGTAGGG + Intronic
952038052 3:29227564-29227586 AGATGAGGAGGTAAAAGGAAAGG - Intergenic
952589976 3:34940223-34940245 CAATCAGGAGGCAAAAGGGAGGG + Intergenic
953078107 3:39590003-39590025 CTGCAGGGAGGTAAAAGGAAGGG + Intergenic
954942159 3:54383472-54383494 CAACCAGCAGCTACAAGTAATGG - Intronic
956879512 3:73496468-73496490 CACCCAGGAAATAAAAAGAATGG - Intronic
957494805 3:80978513-80978535 CCACAAAGAGGTAATAGGAAGGG - Intergenic
958048893 3:88319431-88319453 AAACCAGAAGCAAAAAGGAATGG - Intergenic
958869096 3:99536042-99536064 CAAACTGGAAGGAAAAGGAATGG - Intergenic
960009904 3:112822386-112822408 CTCCCAGGAGGTCAATGGAAGGG - Intronic
961288634 3:125827131-125827153 CAGCCAGAAGTTAAAAGAAACGG + Intergenic
961923778 3:130453820-130453842 CACCCAGGAGCAAAATGGAAAGG + Intronic
963920769 3:150902615-150902637 CAGCCAGGAGGCAAAACTAAAGG - Intronic
964335026 3:155645826-155645848 CAGTCAGGAGGTAAAGGGAATGG + Intronic
964445320 3:156752046-156752068 AAAACAGGAGGTTAAAGGATAGG - Intergenic
964506344 3:157404253-157404275 CCACGAGGAGGTATAAGGTATGG + Intronic
964559755 3:157981055-157981077 CAGCTAGAAGGTAAAAGGGAAGG - Intergenic
965792830 3:172408156-172408178 TACCAAGTAGGTAAAAGGAAAGG + Intergenic
965978609 3:174657791-174657813 TAGCCAGGGGTTAAAAGGAAAGG - Intronic
966254771 3:177905291-177905313 GAGGCAGGAGGTAAATGGAAAGG - Intergenic
967437620 3:189467708-189467730 CAATCAGGGGTAAAAAGGAAAGG - Intergenic
968877757 4:3282988-3283010 CAACCAGAAGCCAGAAGGAAAGG - Intergenic
969928530 4:10608556-10608578 CAACAAGGATGCAAAAGGAGAGG - Intronic
970149158 4:13070494-13070516 CCACCAGCAGGGAAAAAGAAGGG + Intergenic
970257052 4:14179374-14179396 GAACCAAGAGGTAAAAAGAGAGG - Intergenic
970561129 4:17283360-17283382 AAACCGGGAGGCAAAAGGAGAGG - Intergenic
970726564 4:19052312-19052334 TGACCAGGAGGTAAAAGAATGGG + Intergenic
971525856 4:27617848-27617870 TAACTGGGAGGTAAAATGAATGG + Intergenic
972419521 4:38873616-38873638 CAACCTGGAGGAACAAAGAATGG + Intronic
976408290 4:84684161-84684183 AAACCAGAAGGTAATTGGAAGGG - Intronic
976494133 4:85707123-85707145 GCACCAGGAGGTAACAGCAAGGG - Intronic
976695077 4:87910400-87910422 GAAGCAGGAGGTCAGAGGAAGGG - Intergenic
976966679 4:91050946-91050968 CAAACAGGAGGAAAAAGCATGGG + Intronic
977992461 4:103461055-103461077 CAACCAGGTGGTGAATGCAAAGG - Intergenic
978070694 4:104464467-104464489 TATCCAGGAGAGAAAAGGAAAGG + Intergenic
978210215 4:106126194-106126216 CAGTCAGGAGTTAAAAAGAAAGG - Intronic
979095088 4:116537933-116537955 CAACCAAGCATTAAAAGGAATGG + Intergenic
982388564 4:154838997-154839019 CAAGCGGTAGGTAGAAGGAAAGG - Intergenic
982464779 4:155716547-155716569 GAACCAGCAGGTAAAAACAACGG - Intronic
984468086 4:180126975-180126997 CATGGAGGAGGTAAGAGGAAAGG + Intergenic
987976620 5:25022909-25022931 CATCCAGAAGGTAAAAGAGAGGG + Intergenic
989155631 5:38342343-38342365 AAAAGAGGAGGTAAAAGGAGGGG - Intronic
989579228 5:43016617-43016639 AAACCAGGAGGAAATTGGAAGGG + Intergenic
989989329 5:50742635-50742657 CAACTAGGAAGAAAAAGTAAGGG + Intronic
990613900 5:57487598-57487620 CAACGATGAGCTAAAAGAAAGGG + Intergenic
990874503 5:60468950-60468972 CATCCAGGAGGTAAAGGCAAAGG - Intronic
991063336 5:62401107-62401129 CAACCAGAAGTTGAAAGGTAAGG - Intronic
993683732 5:90912264-90912286 CAAGCAGGAGGGAAAGGGAAAGG + Intronic
993827229 5:92706171-92706193 CATCCATGAGCTTAAAGGAAGGG + Intergenic
994790230 5:104215972-104215994 CAATCAGGAGGTATAAGGAAAGG + Intergenic
994985028 5:106921691-106921713 CAATCAGCAGGTTGAAGGAAGGG - Intergenic
995457399 5:112366750-112366772 CAACCAGGGGGACAAATGAAAGG + Intronic
995615636 5:113960215-113960237 CAACCAGGACTTAAAAAGAAAGG + Intergenic
996334487 5:122368148-122368170 GAACCAGGAAGTAAAGTGAAGGG - Intronic
996897058 5:128497530-128497552 GAACCAGCACGTAAAAGGAAAGG + Intronic
997805922 5:136917769-136917791 CAGAGAGGAAGTAAAAGGAAAGG + Intergenic
998471935 5:142390316-142390338 CCCCCAGGGGGTAAAAGGAGTGG - Intergenic
998544647 5:143016381-143016403 CACACAGGAGGTAAAAAGATGGG + Intronic
999717756 5:154375720-154375742 CAACCAGCTAGCAAAAGGAAAGG + Intronic
999910055 5:156187918-156187940 GATCCAGGAGGTACAAGGTATGG + Intronic
999994797 5:157082136-157082158 CAACTAGGAGTTGAATGGAATGG + Intergenic
1000797361 5:165681612-165681634 AATCCAAGGGGTAAAAGGAAAGG - Intergenic
1002157809 5:177296534-177296556 CACTCAGGAGGGAAAAGGAATGG - Exonic
1002619381 5:180476310-180476332 TACTCAGCAGGTAAAAGGAAAGG - Intergenic
1005014106 6:21361133-21361155 CAACCTGGTTATAAAAGGAAAGG - Intergenic
1005587620 6:27292219-27292241 GAATCAGGTGGGAAAAGGAAGGG - Intronic
1006035642 6:31209666-31209688 CATCGAGGTGGTAAAAGTAATGG - Intergenic
1007072373 6:39047259-39047281 CAACCAGCAGGAAGGAGGAATGG - Intergenic
1007534690 6:42576017-42576039 AAAACAGAAGGGAAAAGGAAAGG - Intronic
1008541912 6:52552886-52552908 CAACAAGGGGCTATAAGGAAAGG - Intronic
1010956030 6:82091811-82091833 CAACCAAGCAGTATAAGGAATGG + Intergenic
1011238531 6:85245046-85245068 CAACCAGGAGTGAAGAGGCAAGG + Intergenic
1011556563 6:88575746-88575768 CAGGCAGGAGGTAGAGGGAAGGG + Intergenic
1011592335 6:88982227-88982249 CAAGAAGCAGGTAAAGGGAAAGG + Intergenic
1012838529 6:104299889-104299911 CTGCCAGGAGGTAACAGGGAAGG + Intergenic
1013252768 6:108350775-108350797 AAACCAGGAGGCAGCAGGAAAGG - Intronic
1015061282 6:128969201-128969223 CAAAAAAGAGGTAAAAGAAATGG - Intronic
1016278621 6:142385993-142386015 TAGCCAAGAGTTAAAAGGAATGG - Intronic
1016354660 6:143204945-143204967 CAACCCCGAGGTAAAAGACATGG - Intronic
1016546439 6:145229311-145229333 GAGAGAGGAGGTAAAAGGAAGGG - Intergenic
1016760484 6:147730770-147730792 CAACCAGGAGTTTTAAGGAAGGG + Intronic
1017403548 6:154092246-154092268 CAACAAGGAGGAAAGAGAAAAGG + Intronic
1017820787 6:158047878-158047900 CACCCAGGAGATAAAACCAATGG + Intronic
1017824085 6:158068920-158068942 CACTTAGGAAGTAAAAGGAAGGG + Intronic
1017983927 6:159426070-159426092 AAACCAGGAGGTGAAGGAAATGG + Intergenic
1019007121 6:168808389-168808411 CAAGCAGAAGGTAAAAGCAAAGG - Intergenic
1022073376 7:26940186-26940208 CAGCCAGCAGGTAGAAGGAAGGG - Intronic
1022496172 7:30854574-30854596 CATCCAGAAGGTCAAAGGGAAGG - Intronic
1022616445 7:31935825-31935847 CAAGCAGCAGCTGAAAGGAAAGG + Intronic
1023649841 7:42357835-42357857 GAACTAGGAGGCAAAAAGAAGGG + Intergenic
1023650034 7:42359817-42359839 GAACCAGGAGGCAAAAGGAAGGG - Intergenic
1023803091 7:43851840-43851862 CAACCAAGAGGAATAAGGTATGG - Intergenic
1028646576 7:93104387-93104409 CTACCAGGATCTCAAAGGAATGG - Exonic
1031396639 7:121282434-121282456 CACCCATGAGATCAAAGGAAAGG + Intronic
1032312973 7:130805629-130805651 CAACCAGGAGCTAATGGCAAGGG - Intergenic
1032440130 7:131936323-131936345 TAACCAAGAGGTAAGAGGAAAGG - Intergenic
1032868216 7:135951042-135951064 CAAAGAGGAGGTAAAAGGGCCGG + Intronic
1035705067 8:1669115-1669137 GAATGAAGAGGTAAAAGGAAGGG + Intronic
1035836660 8:2761608-2761630 CATCCAGGAGGTTAGAAGAAAGG + Intergenic
1036397615 8:8382367-8382389 CAACCAGGTGGAGAAAGGAATGG + Intronic
1040516089 8:48136363-48136385 CAACCAGAAGCCAGAAGGAAAGG - Intergenic
1040666740 8:49642858-49642880 CACCCAGGAGCCAAAAGAAAGGG - Intergenic
1040903720 8:52443183-52443205 CCAGGAGGAGGTAAAAGGAGAGG - Intronic
1042229745 8:66543832-66543854 CAACGAGGAGGAGACAGGAAAGG + Intergenic
1042712502 8:71734012-71734034 CAACAAGAAAGTCAAAGGAAAGG - Intergenic
1045058319 8:98389176-98389198 CAGGCTGGAGGTAAAAGGAAAGG - Intergenic
1045913487 8:107438246-107438268 CAAAGAAGAGGTAGAAGGAAAGG - Intronic
1046753660 8:117951208-117951230 CAACCAGGAGTCAATAGGAATGG + Intronic
1046785415 8:118260614-118260636 CCACTGGGAGGTAGAAGGAAAGG - Intronic
1047900437 8:129415629-129415651 CATGCAGGAGGCAAGAGGAACGG + Intergenic
1047939300 8:129813462-129813484 CAACCAAGAAGTACAAAGAAGGG - Intergenic
1048033209 8:130652468-130652490 CTACCAGGAAGTAAGAAGAAGGG - Intergenic
1048390635 8:133960552-133960574 GAATCAGGAGGTAAAGGGGAGGG - Intergenic
1048818256 8:138354480-138354502 CACCCAGGAGGTATCAGGATGGG - Intronic
1048901162 8:139039262-139039284 CACCCAGGAGATAAACGGAAGGG - Intergenic
1049523969 8:143111333-143111355 AAACCAAGAGGAAAAAGGAAAGG - Intergenic
1050929258 9:11303207-11303229 CAACCAGGAAGGATTAGGAATGG - Intergenic
1051976501 9:22956633-22956655 CAAACAGGAAGTAAAGGCAAAGG - Intergenic
1052375485 9:27713743-27713765 CACCCAGGAGATTAAGGGAAGGG - Intergenic
1052389830 9:27866748-27866770 CAGTCACGAGGTAAAAGGAGTGG + Intergenic
1053157167 9:35789550-35789572 CAACTGGGAGGAAAAGGGAAAGG + Intergenic
1053325392 9:37142292-37142314 CAACCATGAGGTACAATCAAAGG - Intronic
1053362716 9:37500762-37500784 CAACCATGAGCTAAGAGAAAAGG - Intronic
1053393999 9:37755756-37755778 GAAACATGAGGTAAAAGGAGGGG + Intronic
1054864648 9:69987703-69987725 CTCCCATGAGGTAAAAGGGAAGG - Intergenic
1055790993 9:79923117-79923139 AAACCAGAACGGAAAAGGAAAGG - Intergenic
1056084913 9:83137835-83137857 CAGGAGGGAGGTAAAAGGAAGGG + Intergenic
1057566653 9:96170999-96171021 CACCCAGGAGGGAAAGGGGATGG + Intergenic
1057698974 9:97349276-97349298 CCACCAGGAGCCAAAAGTAAGGG + Exonic
1057964641 9:99491298-99491320 TAGCTAGGAGGTAAAAGGAGAGG - Intergenic
1059722154 9:116970430-116970452 CCACCTGGAGGTTAAAAGAAAGG - Intronic
1060402388 9:123356332-123356354 CAGCCAGGAGGGAAAGGGCAGGG - Exonic
1060641894 9:125245791-125245813 CCAGCAGGAAGAAAAAGGAAAGG + Intergenic
1060729328 9:126027331-126027353 CAACCTGGAGGAAAGAGGAGAGG - Intergenic
1060881677 9:127122309-127122331 CAAGCAGGAGGGAAGAGGTAAGG - Exonic
1061100045 9:128485418-128485440 CAACCAAGTTGTAAAAGAAAAGG + Exonic
1061887643 9:133600608-133600630 AAACCAGAGGGTAAAAGGATGGG + Intergenic
1185685488 X:1925012-1925034 CATCCAGGAGGCCAAGGGAATGG - Intergenic
1186633660 X:11378590-11378612 CAACCATGAGTTAGAAGGAATGG - Intronic
1187252171 X:17608461-17608483 CAAGTAGGAGGTAAGAGAAAGGG + Intronic
1187788697 X:22923294-22923316 TAACCAGAAGGCAGAAGGAAAGG - Intergenic
1187981775 X:24765037-24765059 CAAAAATGAGGTAAAAGGAGAGG - Intronic
1188030204 X:25255317-25255339 CAACCAAGAAGAAAAAGGAATGG - Intergenic
1188379258 X:29471207-29471229 CAAATAGGAGGGAAAAGAAAGGG + Intronic
1189260533 X:39675481-39675503 CAAACAGAAAGAAAAAGGAAAGG + Intergenic
1189693642 X:43641620-43641642 CAACCAGAAGCTAAAAGGCAGGG + Intergenic
1192667738 X:73105576-73105598 CAAACAGGAAGCAAAATGAAGGG + Intergenic
1193047798 X:77070730-77070752 CAACAAGGAGGTGCAGGGAAAGG + Intergenic
1193806032 X:85995869-85995891 CAACATGGGGGAAAAAGGAAAGG + Intronic
1194373739 X:93107721-93107743 CAACCACAAGCTAAAAGTAAGGG - Intergenic
1195356124 X:104041267-104041289 CAACCTGGTGTTTAAAGGAACGG + Exonic
1195769161 X:108330590-108330612 AAACCAGGAGGTAGAAGACAGGG + Intronic
1196228723 X:113196158-113196180 CAATCAGGAAGTAAAGGAAAAGG - Intergenic
1196686151 X:118512236-118512258 CGACAAGGAGGTAGGAGGAATGG + Intronic
1197085135 X:122463984-122464006 CAACTAGGATATAAAAAGAAAGG - Intergenic
1197262154 X:124331377-124331399 CAAGCAGGAAGTAAAGGCAAAGG + Intronic
1197578938 X:128257345-128257367 CAATCAGGATGAAAAAAGAAGGG + Intergenic
1198028734 X:132734608-132734630 CAACCAGGAATCTAAAGGAAGGG - Intronic
1198152388 X:133923622-133923644 CAGCCAGCAGGTCAAAGGATTGG + Intronic
1198691128 X:139286068-139286090 CAAGCAGGAAGTAAAAGCTAAGG - Intergenic
1198932408 X:141875665-141875687 ATACCAGGAGGTAAAAGAATAGG + Intronic
1198937753 X:141916679-141916701 ATACCAGGAGGTAAAATGATAGG + Intergenic
1198961298 X:142186185-142186207 ATACCAGGAGGTAAAAGGATAGG - Intergenic
1199407014 X:147474243-147474265 CAAGAAAGAGGTTAAAGGAAAGG + Intergenic
1199784387 X:151091281-151091303 CAACCAGGAGGGAAATAGAGTGG + Intergenic
1200254586 X:154573287-154573309 GAAGCAGGAGATGAAAGGAAAGG + Intergenic
1200263183 X:154631121-154631143 GAAGCAGGAGATGAAAGGAAAGG - Intergenic
1201606831 Y:15795414-15795436 CTACCATGAGATAAAAGGACGGG + Intergenic
1201966040 Y:19737002-19737024 CAGTCAGGAGGTAAAAGGTAAGG - Intronic
1201982076 Y:19918788-19918810 CAGCCAGGAGGTTCCAGGAAAGG - Intergenic