ID: 930633232

View in Genome Browser
Species Human (GRCh38)
Location 2:53777277-53777299
Sequence TTGATACTATAATGATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930633232 Original CRISPR TTGATACTATAATGATTGGG TGG (reversed) Intronic
905182008 1:36173101-36173123 TTGATTCTCTGAGGATTGGGTGG - Intronic
909348689 1:74623401-74623423 TTGACACTATACTGTTTGTGTGG - Intronic
918458611 1:184753948-184753970 TTCATAATAGAATGTTTGGGGGG - Intronic
921168853 1:212527691-212527713 GTGTTAATATAATGATTGAGAGG - Intergenic
922382309 1:225043124-225043146 TTGAGACTATAAAGAATGAGGGG + Intronic
923347326 1:233066911-233066933 TTGATACTTTCCTGAATGGGAGG - Intronic
1063689930 10:8277242-8277264 TTTATACTATCTTGAGTGGGTGG + Intergenic
1064514805 10:16135250-16135272 TTAGCGCTATAATGATTGGGAGG + Intergenic
1067656167 10:48193272-48193294 TTGCTACAAGAATGTTTGGGAGG - Intronic
1081396597 11:42593222-42593244 ATGATAATATAATTATTGGGAGG - Intergenic
1088412840 11:109554448-109554470 ATAATACTATAATAATTTGGTGG + Intergenic
1089427352 11:118389961-118389983 TTGATAGTAGAATGACTGGTTGG + Intronic
1092902069 12:13069259-13069281 GTGAGAATATAATGATTGGATGG + Intronic
1093670087 12:21863462-21863484 TTGATACTGTAATTATTGTATGG + Intronic
1094043481 12:26142262-26142284 TTGATAGTATATTGAAGGGGAGG + Intronic
1097605950 12:61754725-61754747 TTGAAACTAGAATATTTGGGTGG - Intronic
1100310902 12:93393778-93393800 TTGTTACTGTTATGATTAGGTGG - Intronic
1102154674 12:110715125-110715147 TTGATACTGTGCTAATTGGGTGG + Intergenic
1104054938 12:125222359-125222381 TAGTTACTATAATGCTGGGGTGG + Intronic
1107034447 13:35885802-35885824 ATGATAAAATAATGATTGTGTGG + Intronic
1111319689 13:86611074-86611096 TTTATAATAAAATGATTTGGTGG - Intergenic
1111598482 13:90441574-90441596 ATTATTCTATAATTATTGGGTGG + Intergenic
1114145309 14:19969008-19969030 TTCATACTTAAATGATTGTGTGG - Intergenic
1115180825 14:30623932-30623954 TAGATACTAGAATATTTGGGTGG + Intronic
1115617336 14:35108646-35108668 TTAATACAATAATACTTGGGAGG + Intronic
1120266273 14:82254546-82254568 TTGAGACTATCATGATGGAGAGG + Intergenic
1125796309 15:42406515-42406537 TAGATACTGTTATAATTGGGGGG - Intronic
1131033010 15:89202243-89202265 TTGATTCTACTATGATTGTGTGG + Exonic
1131996557 15:98138410-98138432 TTGAGGACATAATGATTGGGAGG + Intergenic
1133625482 16:7566986-7567008 TTGATACCATTATTTTTGGGTGG - Intronic
1134387655 16:13788854-13788876 TTGTTAGTATAATGCTTAGGTGG + Intergenic
1148706014 17:49633160-49633182 TAGATTCTAAAATGATTGTGAGG + Intronic
1148747785 17:49928038-49928060 CTGACTCTATAATAATTGGGGGG - Intergenic
1150907490 17:69353579-69353601 TTGGTGCTATAATCATTGGGGGG + Intergenic
1156714344 18:39988783-39988805 AAGATACTAATATGATTGGGAGG - Intergenic
1157078169 18:44491350-44491372 TGGATGCTAAAATGATTAGGTGG - Intergenic
1161948198 19:7452040-7452062 TTGATACAAGAAAGATGGGGTGG + Intronic
926760232 2:16272016-16272038 ATGATACTACAATGTTGGGGGGG - Intergenic
928735381 2:34282673-34282695 TTCATACTTTAATGATTTGGGGG + Intergenic
930633232 2:53777277-53777299 TTGATACTATAATGATTGGGTGG - Intronic
941635765 2:167933441-167933463 GAGATACTAAGATGATTGGGAGG + Intergenic
941686027 2:168449766-168449788 TTTATACAATATTGAGTGGGAGG - Intergenic
943043122 2:182826605-182826627 ATCATACTAGAATGAATGGGAGG + Intergenic
947507041 2:230715667-230715689 TTGCTACTATAACAAATGGGTGG + Intronic
1173259922 20:41424840-41424862 TTGTTACTAAAATAATTAGGGGG + Intronic
1175519724 20:59592583-59592605 ATGATACTATAATGAGGGGTAGG - Intronic
1178251382 21:31006695-31006717 TGGAGAATATAAAGATTGGGAGG + Intergenic
1184579063 22:45400650-45400672 TTCATACTATAATCTTTGAGAGG - Intronic
951496797 3:23337764-23337786 TTGAAGCTATAAAGATTGGTAGG + Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
959522978 3:107341233-107341255 TTGATTCTATTATGATTAAGAGG + Intergenic
959620332 3:108393007-108393029 TGGATTCTACAATGATTAGGTGG + Intronic
962400437 3:135054568-135054590 TTGATACAACAATAATGGGGGGG - Intronic
972101644 4:35427441-35427463 TTTATACTAAAACCATTGGGAGG - Intergenic
974336461 4:60552346-60552368 TTCATACTATAATAAGTGTGTGG - Intergenic
974642580 4:64650490-64650512 TTGATATAATAATTTTTGGGGGG - Intergenic
978753476 4:112278704-112278726 TTGATAATAAAATGATTTGAGGG + Intronic
979040778 4:115790665-115790687 TTTATATTATTATTATTGGGTGG + Intergenic
981579471 4:146237487-146237509 TTGTTATTATTATGATTTGGCGG + Intergenic
982470129 4:155778787-155778809 TTGATACTTAAATGTTTTGGGGG + Intronic
987973898 5:24986822-24986844 TTAATCCTATAAGGCTTGGGAGG + Intergenic
989336071 5:40318343-40318365 TTGCTAGAATAATCATTGGGAGG - Intergenic
989514056 5:42321101-42321123 TTGATCCCATAATGTTTGGGAGG + Intergenic
989732812 5:44668486-44668508 TTAAAACTAAAATGAATGGGAGG + Intergenic
990266759 5:54084890-54084912 ATGATATGAAAATGATTGGGCGG + Intronic
990804115 5:59638622-59638644 GTGATACTATAAGGATTGGGAGG - Intronic
990955658 5:61335761-61335783 TTGATAGTTTAAGGATTGAGGGG + Intronic
994331748 5:98514491-98514513 TTGAAAATATCATCATTGGGAGG - Intergenic
1006533127 6:34674325-34674347 TCGATAGTATAAAGATTTGGGGG - Intronic
1007374207 6:41445199-41445221 TTGCTAGTAAAAAGATTGGGGGG + Intergenic
1008053121 6:46920510-46920532 TTGATAGAATAATATTTGGGGGG + Intronic
1009271732 6:61622980-61623002 CAGTTACTATAATGATTGGCAGG + Intergenic
1009784286 6:68312576-68312598 TTGCTACTATATTGATTATGAGG + Intergenic
1010253433 6:73731943-73731965 TTAATACTCTGATGATTTGGAGG + Intronic
1010411148 6:75563125-75563147 TTGAGACTAAAATGCTTGTGTGG - Intergenic
1015060135 6:128953462-128953484 TGGATTCTATAATAATTGGTGGG + Intronic
1015125018 6:129744629-129744651 TTGATACTGGAATCATTTGGGGG - Intergenic
1015767023 6:136729652-136729674 TTGATCCTATAATCAATGGATGG + Intronic
1016485488 6:144532999-144533021 TTGATACCACAATACTTGGGTGG + Intronic
1019117000 6:169773278-169773300 TGGTTACTATCATGTTTGGGTGG - Intronic
1022487001 7:30786705-30786727 ATGAAACTATAAGGCTTGGGGGG - Intronic
1024405565 7:48975722-48975744 TAGCTACAGTAATGATTGGGTGG + Intergenic
1026588034 7:71673384-71673406 TTGATACCATAATGCTTAAGAGG + Intronic
1027909474 7:84230956-84230978 GTGATACTCTTAAGATTGGGGGG - Intronic
1029506304 7:100965902-100965924 TTCATCCTAGAATGAGTGGGAGG - Intronic
1043003005 8:74782461-74782483 TTGATCATATAATGATTAGCAGG - Intronic
1043774726 8:84251851-84251873 TTTTTTCTCTAATGATTGGGGGG + Intronic
1044345721 8:91101933-91101955 TTGATGCTAAAATGATTAGTGGG + Intronic
1045989478 8:108288505-108288527 TTGATATTATAATGGGAGGGGGG + Intronic
1050384857 9:5078183-5078205 ATGATAGTATAATAATTTGGAGG - Intronic
1050867779 9:10525415-10525437 CTGAGTATATAATGATTGGGTGG - Intronic
1055043910 9:71905659-71905681 TGGCTACTATAATGAATGAGGGG + Intronic
1058591693 9:106572190-106572212 TTGATACTGCAGTGAGTGGGAGG - Intergenic
1061634273 9:131896650-131896672 TTGATAATAAAATGATTGAAAGG - Intronic
1186830885 X:13389275-13389297 TGGATACTAAAATTAGTGGGTGG + Intergenic
1189716706 X:43874490-43874512 TTTATACTATAAAGATAAGGTGG - Intronic
1190778556 X:53575356-53575378 TTTATACTATAATCTGTGGGAGG + Intronic
1192547255 X:72024265-72024287 TTGTAACTATAATGGTTTGGTGG + Intergenic
1199311581 X:146327215-146327237 TTGATACCATAGATATTGGGTGG - Intergenic
1199723942 X:150563963-150563985 TTTATAGTATAATGATTTGGGGG + Intergenic