ID: 930633829

View in Genome Browser
Species Human (GRCh38)
Location 2:53783480-53783502
Sequence GAATCCTATTTTTCACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930633829_930633831 -6 Left 930633829 2:53783480-53783502 CCCAGAAGTGAAAAATAGGATTC 0: 1
1: 0
2: 0
3: 22
4: 302
Right 930633831 2:53783497-53783519 GGATTCATAGAGTGCCAAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930633829 Original CRISPR GAATCCTATTTTTCACTTCT GGG (reversed) Intronic
904248418 1:29204884-29204906 GAAACCTATATTTCTCTTGTGGG + Intronic
908311764 1:62891241-62891263 GGAACTGATTTTTCACTTCTAGG - Intergenic
908478658 1:64514496-64514518 AATTCCTAGGTTTCACTTCTAGG + Intronic
908784903 1:67725257-67725279 GTATCCTATTTTGCATTTTTTGG - Intronic
908866869 1:68557874-68557896 GAAACCCATTTTTCCCTCCTTGG + Intergenic
910364717 1:86452586-86452608 GAAACCTCTTTTTCACCTCAGGG + Intronic
910544985 1:88405548-88405570 GAATCCTATTTTTTTCCTCTGGG - Intergenic
910656788 1:89628192-89628214 GAATCCTATTTTTAGGTCCTTGG + Intergenic
910760655 1:90728297-90728319 GAAACCTAACTTTCACTTGTGGG - Intergenic
913019789 1:114777369-114777391 GCATTCTACTCTTCACTTCTTGG - Intronic
913238700 1:116808223-116808245 GCATCCTGTTTCTGACTTCTTGG + Intergenic
916286819 1:163115289-163115311 TAATTTTAATTTTCACTTCTGGG - Intronic
918167650 1:181965598-181965620 GAATCATTTTTTTCCCTCCTAGG + Intergenic
923498790 1:234547302-234547324 GAATCCTATTTTACAATTGAAGG + Intergenic
1062922734 10:1292266-1292288 GAATCTTGTTTTTCACTCCCAGG + Intronic
1065794685 10:29295257-29295279 CAATCCTAGTTTTTCCTTCTGGG + Intronic
1066001298 10:31106218-31106240 CACTCCTGTTTTTCACCTCTTGG - Intergenic
1068888359 10:62121574-62121596 AAAACCAATTTTTCATTTCTTGG + Intergenic
1069730403 10:70608211-70608233 GTATCCAATTTTACACTTGTGGG - Intergenic
1071823885 10:89304971-89304993 AAATTTTATTTTTCTCTTCTGGG - Intronic
1071903491 10:90146237-90146259 GAAAGCTATTCTTCACTTCAAGG + Intergenic
1072470766 10:95711072-95711094 GAATTCTAGTTTCCATTTCTCGG - Intergenic
1072565905 10:96616397-96616419 GAATCCACTTATTCACTTCCGGG + Intronic
1072801562 10:98395684-98395706 GAATCCTATTTTACACCCCAAGG + Intronic
1075602510 10:123780782-123780804 GAATCCCTTTTTCCACTTCTAGG + Intronic
1078247296 11:9585820-9585842 GACTCATAATTTTCACTTCTAGG + Intronic
1079542597 11:21593987-21594009 GAAACCCATTTTTCCCCTCTAGG - Intergenic
1080178297 11:29393458-29393480 GATTCCTCTTTTTAAGTTCTGGG - Intergenic
1080593156 11:33741681-33741703 GAATCTTTTTTTTCTCTTCCAGG - Exonic
1081551974 11:44121854-44121876 GAAGCCTTCCTTTCACTTCTGGG + Intronic
1081879023 11:46432003-46432025 GCATCCTCTTTATCATTTCTAGG - Intronic
1082131145 11:48490834-48490856 AAATTCTAGTTTTGACTTCTGGG + Intergenic
1083837311 11:65279508-65279530 TAATACTTTTTTCCACTTCTGGG + Intronic
1085488472 11:76889813-76889835 TTATTCTATTTTTCATTTCTAGG + Intronic
1086208501 11:84289654-84289676 GAATCCTCTCTTTCTCTACTAGG - Intronic
1087249195 11:95877086-95877108 AAATCCTTTTTTTCTCTTCTGGG - Intronic
1087988528 11:104716531-104716553 GAATCCTATATTTGCCTTCAGGG - Intergenic
1088177579 11:107071723-107071745 TAAAACTATTTTTTACTTCTTGG - Intergenic
1089860776 11:121588370-121588392 GAATCCTGCTTTTCAGTTGTGGG + Intronic
1090127945 11:124108752-124108774 GAATTCTATTGTTCTCTGCTTGG + Intergenic
1092958373 12:13571450-13571472 GAACCATAATTTTCACCTCTTGG + Intronic
1093350739 12:18099861-18099883 GATTCCTGTTTTTCAGTTCTGGG + Intronic
1094052688 12:26238492-26238514 GAATCCACGTTTTCACTTGTGGG - Intronic
1095730887 12:45505716-45505738 GCATCTTATTTTTTCCTTCTGGG - Intergenic
1095806867 12:46329379-46329401 TAATGCTATTTTTCATTGCTTGG - Intergenic
1096778002 12:53975317-53975339 GAAACCAAATTTTCACTTGTCGG - Exonic
1098099545 12:66999706-66999728 GAATCCTCTTTTGCATTTTTAGG - Intergenic
1098587486 12:72171248-72171270 TAATCCTATTTTTTTTTTCTTGG - Intronic
1098862191 12:75722500-75722522 TAATCCTATTTTCTCCTTCTTGG + Intergenic
1098989525 12:77049291-77049313 GAATACTATATTATACTTCTGGG + Intronic
1099366640 12:81773179-81773201 CAATCCTATTTTTGAGTTTTGGG + Intergenic
1099552047 12:84058155-84058177 AAATCCCTTTGTTCACTTCTCGG + Intergenic
1100784180 12:98061851-98061873 AAATCTTCTTTTTCATTTCTAGG + Intergenic
1100937352 12:99684233-99684255 GAATTCATTTTTTCAGTTCTAGG - Intronic
1101033874 12:100685793-100685815 AAAACCCATTTTTCCCTTCTAGG + Intergenic
1101064849 12:101009832-101009854 AATTCCTATTTTTCAGTTATTGG + Intronic
1101769911 12:107740003-107740025 GAATCTTATTTTTGCATTCTTGG - Intronic
1102421351 12:112805461-112805483 GAATCCTCTTTTTCACTGCCTGG + Intronic
1104560363 12:129838667-129838689 GAATACTATTTTTCAATGTTAGG - Intronic
1104657698 12:130585840-130585862 GATTCCCACATTTCACTTCTTGG + Intronic
1106212797 13:27666320-27666342 AAATCCTATATTTTACTTTTTGG + Intronic
1107597043 13:41973745-41973767 GGGTCCTATTTTCCACTTCCAGG + Intergenic
1108434738 13:50390602-50390624 GCATACTTATTTTCACTTCTGGG + Intronic
1108797660 13:54051328-54051350 GCATCCTATTTTTGGCTTATAGG - Intergenic
1108906308 13:55478581-55478603 GAGTGGTATGTTTCACTTCTGGG - Intergenic
1110061412 13:71043030-71043052 GAAGCCTGTTTTTCCCTTCTGGG + Intergenic
1110756475 13:79180410-79180432 GAATTCTATTTTTAATTTTTTGG + Intergenic
1111701608 13:91696384-91696406 GAGTCCTCTTTTTTACTTATGGG + Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112625106 13:101094649-101094671 GAATCCTTTTTCTCAGTTCTTGG + Intronic
1112715319 13:102178260-102178282 GAATCGTAATTTTCACGTCCTGG + Intronic
1114396655 14:22369615-22369637 GTATATTAATTTTCACTTCTGGG + Intergenic
1115009057 14:28522342-28522364 CAATACCATTTTTAACTTCTAGG - Intergenic
1115495301 14:33998303-33998325 TAGTCCTATATTTCATTTCTTGG + Intronic
1115783392 14:36796543-36796565 GGATCCTATTGTACACATCTTGG - Intronic
1116452113 14:45078391-45078413 CCATCCTATTTTCTACTTCTTGG + Intergenic
1116732349 14:48639953-48639975 GAATTCTTTTTATCAGTTCTAGG - Intergenic
1117467569 14:56008500-56008522 TAGTCCCATTTTTCCCTTCTGGG - Intergenic
1118128171 14:62932599-62932621 AATGCCTATTTTTCACTACTGGG - Intronic
1118220413 14:63850942-63850964 GTCTGCTATTTTTCTCTTCTCGG - Intergenic
1119237245 14:73029985-73030007 TAATCTTAGTTTTCTCTTCTGGG - Intergenic
1120659065 14:87230928-87230950 GAAGCCCATTTTTCCCTCCTAGG + Intergenic
1120696326 14:87649600-87649622 GAAACCAATTTTTCCCTCCTAGG - Intergenic
1122086102 14:99306285-99306307 GAAACCAACTTTTCATTTCTGGG - Intergenic
1202938192 14_KI270725v1_random:113035-113057 GTAGGCTATTTTTCAATTCTAGG + Intergenic
1125320773 15:38485173-38485195 GAATCATTTTTTTCTCTTATAGG + Exonic
1130789500 15:87138134-87138156 GAATACTATTTTTCACTAAAAGG + Intergenic
1131221314 15:90586712-90586734 GAAACCCATATTTCACTTCAAGG + Intronic
1131303470 15:91220447-91220469 GAATTCTATTTTTCACTGAAAGG + Intronic
1132305992 15:100812911-100812933 GAATAGTCTATTTCACTTCTAGG - Intergenic
1133831519 16:9327665-9327687 GAGTCTGATTTTTCACCTCTGGG + Intergenic
1133995859 16:10747630-10747652 GAATCATTTTTTTTTCTTCTTGG - Intronic
1138737758 16:59270824-59270846 CAATATTATTTTTCACTTTTGGG + Intergenic
1139321858 16:66121113-66121135 AAATTCCATTTTTCACTTTTCGG - Intergenic
1140497371 16:75400942-75400964 GAAGCCTATCCTTCACTTCTAGG - Intronic
1141742924 16:85906171-85906193 AAATGCTATTTTTCCCTTCAAGG - Intronic
1142775958 17:2139265-2139287 GAACCAGATTTTTCTCTTCTGGG + Intronic
1142922255 17:3199376-3199398 TAAGCCAAATTTTCACTTCTGGG + Intergenic
1143346804 17:6255599-6255621 GAAGCTTATTTTTCTATTCTTGG + Intergenic
1143479175 17:7218815-7218837 GAGCCCTGTTTTTCACCTCTTGG + Exonic
1144021779 17:11244405-11244427 GAAACTTATTTTTCAGTTCTGGG + Intronic
1144225217 17:13138760-13138782 CAAAACTATTTTTCCCTTCTAGG - Intergenic
1144228652 17:13176694-13176716 GAATCCTGTTGTTCCCTTCCTGG + Intergenic
1145112908 17:20180098-20180120 GAATACTATGTTTTACTACTTGG - Intronic
1145122432 17:20272758-20272780 CTATCATATTTTTAACTTCTAGG + Intronic
1146376743 17:32299632-32299654 GAATCTTATTTTTGTCTTCTAGG - Intronic
1146948117 17:36887910-36887932 GACACCTATTTGTGACTTCTAGG + Intergenic
1150044074 17:61893899-61893921 TAATGCTATTTTTCCCTTTTAGG - Exonic
1151036291 17:70804478-70804500 GAACCCTCTTTTTCTCTTCATGG + Intergenic
1203183147 17_KI270729v1_random:84814-84836 GTAGGCTATTTTTCAATTCTAGG - Intergenic
1154178264 18:12104246-12104268 GCAAACTATTTTTCACTTTTTGG + Intronic
1155994853 18:32320185-32320207 GAATGCTATTTTTCACCTGTTGG - Intronic
1156395182 18:36692925-36692947 GAATCCTATCTTGCTCTTTTAGG - Intronic
1157272231 18:46284788-46284810 GAATCATGTTCTTCACTTTTTGG - Intergenic
1158266859 18:55668716-55668738 TATTCCTGTTTTTCTCTTCTTGG + Intergenic
1158332029 18:56373577-56373599 GATTCCTATATTTCATTTCAGGG + Intergenic
1158731413 18:60027406-60027428 CGATCCTATTTTTCATTCCTAGG - Intergenic
1159187839 18:65001248-65001270 GAATCAGCTTTTTCATTTCTTGG - Intergenic
1159483640 18:69025672-69025694 GAATCATATTTTTCCCTTTCCGG - Intronic
1163209204 19:15828405-15828427 CAAGCCCAGTTTTCACTTCTTGG - Intergenic
1164143750 19:22496735-22496757 GAATCCTCTTTTTTACAACTGGG - Intronic
1165919386 19:39284759-39284781 TAATCCTATTTTTAATTTTTTGG - Intergenic
1167836796 19:52079484-52079506 GAATCCAGTGTTTCACTTGTTGG - Intronic
924991668 2:317797-317819 AAATGGTATTTTTCACTTTTTGG + Intergenic
926818137 2:16821742-16821764 GACTTCTATTGTTCAATTCTGGG + Intergenic
927351002 2:22114606-22114628 GAAAGCTATTGTTCCCTTCTGGG + Intergenic
928693869 2:33828916-33828938 GAATATTATTTTTCACGGCTGGG + Intergenic
928808860 2:35198107-35198129 GAAACCAATTTTTCCCTCCTAGG - Intergenic
928905928 2:36367598-36367620 GACTCCTGTCTATCACTTCTAGG - Intronic
930208048 2:48608004-48608026 GAATCCCCTGTTCCACTTCTGGG - Intronic
930507500 2:52302602-52302624 TATGCCTATTTTTCATTTCTAGG + Intergenic
930633829 2:53783480-53783502 GAATCCTATTTTTCACTTCTGGG - Intronic
930733612 2:54752704-54752726 AAATTATATTTATCACTTCTTGG - Intronic
931894139 2:66710471-66710493 GAATTTTATTTTTAATTTCTTGG - Intergenic
931903669 2:66820062-66820084 GAATTCTTTTTTTCTCTTCTGGG + Intergenic
932219384 2:69988110-69988132 TAATTCTATGTTTAACTTCTTGG - Intergenic
932330931 2:70897894-70897916 GAATCCTGGCTTTCTCTTCTGGG - Intergenic
933330435 2:80886461-80886483 GTATCCTATTGCTCCCTTCTAGG + Intergenic
933457386 2:82533809-82533831 CAATCGTATTTTTCAGTTCCTGG - Intergenic
933510828 2:83239494-83239516 AACTCCTATTTTTCAGGTCTAGG + Intergenic
934739506 2:96709565-96709587 GAATCCAGTTTTTCACTACCTGG - Intronic
935857463 2:107290558-107290580 GACTCCCTCTTTTCACTTCTAGG + Intergenic
936960759 2:118071933-118071955 AAGTCCAATTTTTAACTTCTTGG + Intergenic
937235146 2:120426957-120426979 CACTCCTATTCTTCAGTTCTAGG + Intergenic
937397011 2:121546292-121546314 GATTTCTATATTTCATTTCTAGG - Intronic
938197853 2:129346829-129346851 TAATCATATGTTTCATTTCTAGG - Intergenic
939573791 2:143871662-143871684 AAAACATATTTTTCACTTCAGGG + Intergenic
939671622 2:145019485-145019507 GACCCCTATTTTTCAAATCTTGG - Intergenic
939773556 2:146355629-146355651 ATATCTTATTTTTCAGTTCTAGG - Intergenic
941521716 2:166553222-166553244 GAATCATATTTTTCTGCTCTTGG - Intergenic
941563054 2:167073437-167073459 AAATCCTATGGTACACTTCTTGG + Intronic
944002851 2:194862620-194862642 GAAACCTATTCTTCTCTACTCGG + Intergenic
945522957 2:210851854-210851876 GAATGCTATTTTTTAATTTTAGG + Intergenic
946306978 2:218861570-218861592 GAATCCCCTTTTTCACTCCTGGG - Intronic
946883861 2:224203459-224203481 GAGTCAGATTTTTCACCTCTAGG + Intergenic
947103417 2:226645540-226645562 GAATCATCTTGTTCATTTCTTGG - Intergenic
1170170854 20:13410834-13410856 GAGTCCTATTTGTCTCTTTTGGG + Intronic
1170367523 20:15614287-15614309 TAATACTTATTTTCACTTCTAGG - Intronic
1171192974 20:23173300-23173322 GAATTCTTTTTATCAGTTCTAGG + Intergenic
1172112539 20:32555677-32555699 GTATCCTAATCTTCTCTTCTTGG - Intronic
1172464052 20:35142291-35142313 AAATCCTATTTACCACTTCTTGG + Intronic
1172720777 20:36999399-36999421 GAAGCTTATTTTTCTATTCTTGG - Intronic
1173042919 20:39481725-39481747 GAATTCTGTTTTTCTCCTCTTGG - Intergenic
1173187547 20:40852460-40852482 GAAACCTTCTTTTCTCTTCTGGG - Intergenic
1173416898 20:42864964-42864986 AAATCTTATTTTTCTTTTCTGGG - Intronic
1175165838 20:57043933-57043955 GATTCCTATTTTCTGCTTCTAGG + Intergenic
1178133908 21:29604511-29604533 GGATCCTATTTATCACATCCAGG - Intronic
1178929752 21:36807091-36807113 AACTCCTTTTTTGCACTTCTGGG - Intronic
1180499793 22:15921491-15921513 GAATCCTACTCTTCACATCAGGG - Intergenic
1184543190 22:45143695-45143717 ATATCCTATTTTTCATTTTTAGG - Intergenic
1203290799 22_KI270735v1_random:36626-36648 GTAGGCTATTTTTCAATTCTAGG + Intergenic
949230472 3:1744277-1744299 CAAACCCATTTTTCCCTTCTGGG + Intergenic
951815506 3:26749568-26749590 AATTCCTTTTTTTCATTTCTGGG - Intergenic
951915366 3:27795389-27795411 CAATTATTTTTTTCACTTCTAGG - Intergenic
951940500 3:28072841-28072863 GACCCCAATTTTTCACTTGTAGG + Intergenic
954835615 3:53464755-53464777 GAATCCTATTTCTCAGATGTTGG + Intergenic
957318372 3:78597010-78597032 TGATCCAATTATTCACTTCTAGG + Intergenic
958703466 3:97622630-97622652 TAATTCTATTTTTAACTTTTAGG + Intronic
959993092 3:112650599-112650621 GACTTCTGTTTTTCCCTTCTTGG + Intergenic
960114132 3:113876473-113876495 CACTCATATTTTTCATTTCTAGG + Intronic
960425485 3:117501949-117501971 GATTTCTATGTTTCACTTCCAGG - Intergenic
960504358 3:118474559-118474581 GAATCCTACTTTTCCTTTTTGGG - Intergenic
960520415 3:118648093-118648115 GAATCCTAATGTCCACTTCAAGG + Intergenic
961160712 3:124722360-124722382 TCATCCTACTTTTCATTTCTAGG - Intronic
962165830 3:133046783-133046805 GAATCATAATTTTCCCTTCAAGG - Intronic
963938098 3:151075089-151075111 TAATCCTACTTTTTACTCCTAGG + Intergenic
964800258 3:160548832-160548854 TAATTCTATTTTTCACTTTTTGG + Intronic
965841418 3:172909971-172909993 TAATCCAATTATTAACTTCTAGG - Intronic
966165325 3:177010359-177010381 GAATCATAGTTTACTCTTCTGGG - Intergenic
967645929 3:191923879-191923901 GAAAACAATTTTTGACTTCTTGG - Intergenic
970043509 4:11823232-11823254 GAATCCTGTTTTTTTCTTATAGG - Intergenic
970577424 4:17441147-17441169 GAAACCTCTTTTTCCATTCTAGG - Intergenic
971008882 4:22407632-22407654 GAACTTTATTTTTCATTTCTTGG - Intronic
971206542 4:24575487-24575509 GAATGCAATTTTTCACCTATTGG + Intronic
971462404 4:26915054-26915076 GAATCCCAGTTGTCATTTCTAGG + Intronic
972052904 4:34763158-34763180 TAGTTCAATTTTTCACTTCTAGG - Intergenic
972159367 4:36204206-36204228 ATAGCCTATTTTTCAGTTCTTGG - Intronic
972469948 4:39394796-39394818 GAAATGTATTTTTCAGTTCTGGG + Intergenic
972718695 4:41674791-41674813 CCATTCTATTTTTCACTTTTAGG - Intronic
972822423 4:42716926-42716948 GAAATCTATTTCTCAGTTCTAGG - Intergenic
973713009 4:53648145-53648167 CAATTCTATTTTTCATTTTTTGG + Intronic
973948244 4:55983245-55983267 AAATCCTATTTTTACATTCTTGG - Intronic
974592180 4:63966967-63966989 GAAAATTATTTTTCACTTCTAGG - Intergenic
977829351 4:101571939-101571961 AATTCCTATTTTTCCCTTCAAGG - Intronic
978517340 4:109582574-109582596 AAATCCCATTTGTCAATTCTTGG + Intronic
979776411 4:124593711-124593733 GAAAACCATTTTTCTCTTCTAGG - Intergenic
981852923 4:149252507-149252529 GCATCCTATTTTTAACTTTACGG - Intergenic
982179672 4:152738172-152738194 GAACCCTATTTTTGCCTTTTGGG - Intronic
983833155 4:172357046-172357068 GAATCCTCTATTTCAATACTTGG - Intronic
984505876 4:180618009-180618031 GAAACCAATATTTCACTTTTTGG + Intergenic
984664151 4:182407257-182407279 AAAACCAATTTTTTACTTCTAGG + Intronic
986081598 5:4400301-4400323 GATTTCTAATTTTCACCTCTAGG - Intergenic
986155720 5:5174101-5174123 GAATTCTCTTTATCATTTCTTGG + Intronic
986666147 5:10106274-10106296 GAGTGCTAGTTTTCACTTTTTGG - Intergenic
987060268 5:14236204-14236226 TAATCATATTTTTCCTTTCTGGG - Intronic
988784962 5:34558139-34558161 GAGTCCTGTTTTTGCCTTCTGGG - Intergenic
989171934 5:38479947-38479969 GAATCCTGATTTTAACTGCTAGG - Exonic
989807497 5:45627749-45627771 GAATACTATGTTTAACTTCAGGG + Intronic
990274189 5:54177906-54177928 TAATCCTTTCTTCCACTTCTTGG + Intronic
990380634 5:55219438-55219460 CAATCATATTTTACATTTCTTGG - Intergenic
990545650 5:56817493-56817515 GAAGCATATTTTTTAGTTCTTGG - Intronic
990808453 5:59694412-59694434 GAATCTTATTTTAATCTTCTTGG + Intronic
991301550 5:65133599-65133621 GAATCCCATTTCTCTCCTCTTGG + Intergenic
991582032 5:68165909-68165931 GAATACTATTTTTAAATTGTTGG - Intergenic
992310902 5:75498405-75498427 GAAACCCATTTTTCCCTCCTAGG - Intronic
992415301 5:76546923-76546945 GGATTCTTTTTTTCTCTTCTTGG + Intronic
992737149 5:79733743-79733765 GAATCCTCTGTTTCAGTTATGGG - Exonic
992832229 5:80604995-80605017 TACTCCTATTTTTCAATTCTAGG + Intergenic
992912382 5:81408682-81408704 GAATGCAATTTTACAATTCTGGG + Intergenic
994073270 5:95624182-95624204 GAATCCTCTCTCTCTCTTCTTGG + Intergenic
995029834 5:107467688-107467710 GACTCTTATATTTTACTTCTAGG - Intronic
995918885 5:117286703-117286725 CAAACCTATATTTCACTTCATGG - Intergenic
996010132 5:118473093-118473115 GAATCATTTTATTTACTTCTAGG - Intergenic
996462352 5:123760754-123760776 GAATAATATTTGTCTCTTCTAGG + Intergenic
996760885 5:126984666-126984688 TAATTCTGCTTTTCACTTCTGGG + Intronic
996792306 5:127306120-127306142 GAAGACCATTTTTCATTTCTTGG + Intronic
998477492 5:142433953-142433975 TAATCAGATTTTTCCCTTCTGGG + Intergenic
1000412775 5:160950904-160950926 GAGTCCTATTTCTCTCTTCTCGG + Intergenic
1000531054 5:162420328-162420350 GACTCCTTTTTTTGACCTCTAGG + Intergenic
1000606066 5:163328871-163328893 GAACCCTAATCTTCTCTTCTTGG + Intergenic
1001665340 5:173428671-173428693 GAACCCTAATTTTTCCTTCTGGG - Intergenic
1001973564 5:175977929-175977951 TAATTCTATTTTTAACTTTTTGG - Intronic
1002243869 5:177865850-177865872 TAATTCTATTTTTAACTTTTTGG + Intergenic
1003219662 6:4147950-4147972 GACTCCTAGTTTTCAATTTTGGG + Intergenic
1004523495 6:16384041-16384063 GAATTCTATTTTGCACATCCAGG + Intronic
1004750312 6:18555846-18555868 GAATACTGTTTTCCTCTTCTTGG - Intergenic
1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG + Intergenic
1005343866 6:24870169-24870191 GAATCCTTTTTTTCTCTTCATGG + Intronic
1006991034 6:38214931-38214953 GAATGCAATTTTTGACTTTTTGG - Intronic
1008492762 6:52103260-52103282 GCTTCTAATTTTTCACTTCTAGG - Intergenic
1009825494 6:68861034-68861056 GGATCTTATTTTTCACCTCATGG + Intronic
1012653284 6:101784183-101784205 GAAGCCAATTTTTCCCTCCTAGG - Intronic
1013211968 6:107995095-107995117 GAATCCTAGTTTCCATTTATTGG + Intergenic
1013741472 6:113291653-113291675 GCATTCTACTCTTCACTTCTTGG - Intergenic
1014134290 6:117870056-117870078 AATTCCTTTTTTTCACTTCCTGG - Intergenic
1014314486 6:119846355-119846377 GAATTCCATTTTGCACTGCTAGG + Intergenic
1014339027 6:120179515-120179537 GATTATCATTTTTCACTTCTGGG - Intergenic
1015075624 6:129153136-129153158 GAAAGTGATTTTTCACTTCTTGG + Intronic
1015107829 6:129557375-129557397 GAATCCTATCTATCACATGTGGG + Intergenic
1015162337 6:130167404-130167426 GAATCCAACTTCTCACTTCATGG - Intronic
1015566884 6:134582284-134582306 GAATAATATTTTTCTCTTTTTGG - Intergenic
1016092920 6:140000161-140000183 GATTCCTATTGATCAATTCTTGG - Intergenic
1016673351 6:146733922-146733944 GAATACTCTTTATCACTTGTGGG - Exonic
1017417674 6:154238890-154238912 GAATCCAACTTTTTACTTTTTGG - Intronic
1021303487 7:19002155-19002177 GATTATTATTTTTCACATCTGGG - Intronic
1021306798 7:19041637-19041659 TAAACGTATTTTTCACTTTTAGG + Intronic
1023204438 7:37732949-37732971 AAAGCCTAATTTTCCCTTCTAGG - Intronic
1023236821 7:38098949-38098971 GAAAACCATTTTTCCCTTCTAGG - Intergenic
1023423734 7:40012256-40012278 GAATTCTATTTTTGATTTTTGGG - Intronic
1023664997 7:42513739-42513761 TAATCTTATTTTTCCCTTATAGG - Intergenic
1025084389 7:56010857-56010879 AAGTCCTTTTTTTTACTTCTTGG - Intergenic
1025557639 7:62329047-62329069 ATAGGCTATTTTTCACTTCTAGG + Intergenic
1027573667 7:79904365-79904387 CAATTCTATTTTCCACCTCTAGG - Intergenic
1028664811 7:93329281-93329303 AAATTGTATTTTTCATTTCTAGG - Intronic
1029089974 7:98040502-98040524 GAGTCCTATTTTTCTGTTATGGG + Intergenic
1030080246 7:105771421-105771443 GAATCCTATGATCCACTACTAGG - Intronic
1030216610 7:107049662-107049684 GAATCCAGTATTGCACTTCTTGG + Intronic
1031461495 7:122055161-122055183 GAATCATGCTTTTCATTTCTAGG - Intronic
1031662217 7:124439378-124439400 TAATCTTACTTTTCACTACTTGG - Intergenic
1031751652 7:125582314-125582336 GAAACCTGTATTTCACATCTGGG + Intergenic
1033371804 7:140715620-140715642 GAATCCTCTTTTCCACATGTGGG + Intronic
1033716243 7:144005548-144005570 GAATTTTATATTTCCCTTCTAGG + Intergenic
1033884854 7:145932698-145932720 GGATACTATTTTTCCCTCCTAGG - Intergenic
1034874561 7:154713712-154713734 GAAAACTATTTTTCCCTCCTAGG + Intronic
1035874747 8:3176157-3176179 TAATCATATTTTTCACTTTCAGG - Intronic
1036085226 8:5606450-5606472 GAATCATATTTTTGACTTGGTGG + Intergenic
1036486348 8:9182877-9182899 GAATCCCATTTGTCACCTCCTGG - Intergenic
1036640681 8:10581546-10581568 GAATCCTATTTTTTTTTTTTGGG + Intergenic
1037172274 8:15907245-15907267 AAATGTTTTTTTTCACTTCTTGG + Intergenic
1037195968 8:16190277-16190299 GAAAACTATTTTGAACTTCTTGG + Intronic
1037418641 8:18678117-18678139 GAAGCCTATTTTTCTTTTCTTGG - Intronic
1037751056 8:21682743-21682765 GAATCCAATCATTCTCTTCTAGG - Intergenic
1037794578 8:21981615-21981637 GAATCTACTTTTTAACTTCTGGG - Intronic
1039644009 8:39260022-39260044 GAATCCTACTTTTTCATTCTAGG + Intronic
1040338990 8:46430400-46430422 GAAGCCCCGTTTTCACTTCTGGG - Intergenic
1041519788 8:58742607-58742629 CAATCCAATTTTTCAGTTCTGGG + Intergenic
1041977406 8:63815854-63815876 GAATCCTCATTCCCACTTCTAGG + Intergenic
1043078655 8:75736037-75736059 GAATCCTATTTTACCTTTGTTGG + Intergenic
1046388230 8:113532037-113532059 GAAACCTATTTTACATGTCTTGG - Intergenic
1050810826 9:9745357-9745379 GAAGCCTTCATTTCACTTCTAGG - Intronic
1051207659 9:14705230-14705252 TCATTGTATTTTTCACTTCTAGG - Intergenic
1051979045 9:22990836-22990858 GAACCCTAATTTCCACTTCCTGG - Intergenic
1052054003 9:23882900-23882922 GAAACCATTTTTTCCCTTCTAGG + Intergenic
1052552961 9:29974875-29974897 GAATTTTATATTTTACTTCTTGG + Intergenic
1053116504 9:35508876-35508898 GACTCATATTCTTCAGTTCTGGG - Intronic
1053510368 9:38682765-38682787 GGATCCTATTTTTCTCTTTCTGG + Intergenic
1056273580 9:84970916-84970938 GAATCCTACTTTTTCCCTCTTGG + Intronic
1056617697 9:88182703-88182725 GAAACACATTTTTCACTGCTCGG + Intergenic
1057027116 9:91742505-91742527 GACTCTTATGTTTCAGTTCTAGG - Intronic
1058147306 9:101426313-101426335 GAATCCGCTTTTCCACTTGTGGG - Intronic
1058410820 9:104729224-104729246 GAATTCTTTTTATCAGTTCTAGG - Intergenic
1058616816 9:106838360-106838382 AAATCCTATCTTTCCCTTTTTGG - Intergenic
1060307129 9:122423974-122423996 GAAACCTATTTGTTATTTCTGGG + Intergenic
1061129253 9:128698936-128698958 GAATACAATTTTTTCCTTCTTGG - Intergenic
1062161321 9:135081778-135081800 AGATCCTATTTCTTACTTCTTGG - Intronic
1185941890 X:4331259-4331281 CAATCCTATTTTGTCCTTCTGGG + Intergenic
1189579835 X:42394435-42394457 GAATCCCATCTCCCACTTCTTGG + Intergenic
1190220026 X:48506498-48506520 ATATACTATTTTTCACTTATGGG - Intergenic
1194043367 X:88970799-88970821 AAAGCCCATTTTTCCCTTCTAGG + Intergenic
1195514987 X:105763812-105763834 GAAGCCCACATTTCACTTCTTGG - Intronic
1197414758 X:126161777-126161799 GGATGCAATTTCTCACTTCTGGG - Intergenic
1197576953 X:128225749-128225771 GAATTGTATTTATAACTTCTGGG + Intergenic
1198126079 X:133645210-133645232 GAATAATATTTCTAACTTCTCGG + Intronic
1199070439 X:143469325-143469347 GAATACCATTTTTCTCTCCTAGG + Intergenic
1199577979 X:149333124-149333146 GGATACTACCTTTCACTTCTTGG - Intergenic