ID: 930634061

View in Genome Browser
Species Human (GRCh38)
Location 2:53786008-53786030
Sequence AACCAAATCAAAAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 590}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930634061_930634066 -4 Left 930634061 2:53786008-53786030 CCTTCCTGCTTTTTGATTTGGTT 0: 1
1: 0
2: 0
3: 49
4: 590
Right 930634066 2:53786027-53786049 GGTTCAAATCTGAGGAAGTGGGG 0: 1
1: 0
2: 2
3: 8
4: 172
930634061_930634067 -3 Left 930634061 2:53786008-53786030 CCTTCCTGCTTTTTGATTTGGTT 0: 1
1: 0
2: 0
3: 49
4: 590
Right 930634067 2:53786028-53786050 GTTCAAATCTGAGGAAGTGGGGG 0: 1
1: 0
2: 0
3: 19
4: 212
930634061_930634065 -5 Left 930634061 2:53786008-53786030 CCTTCCTGCTTTTTGATTTGGTT 0: 1
1: 0
2: 0
3: 49
4: 590
Right 930634065 2:53786026-53786048 TGGTTCAAATCTGAGGAAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189
930634061_930634064 -6 Left 930634061 2:53786008-53786030 CCTTCCTGCTTTTTGATTTGGTT 0: 1
1: 0
2: 0
3: 49
4: 590
Right 930634064 2:53786025-53786047 TTGGTTCAAATCTGAGGAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930634061 Original CRISPR AACCAAATCAAAAAGCAGGA AGG (reversed) Intronic
902600122 1:17535361-17535383 AACCAGGTCACACAGCAGGAGGG - Intergenic
902861327 1:19248405-19248427 AAACAAAACAAAAAACAGGTTGG - Intronic
903110801 1:21131554-21131576 ATCAAAATCAAACAGCATGAAGG + Intronic
903901941 1:26653265-26653287 AAACAAACAAAAAAGAAGGAAGG - Intergenic
905375421 1:37516940-37516962 AAACAAAACAAAAAGCTGGCTGG + Intergenic
906011122 1:42527542-42527564 AAACAAATCAATAAGAAGAAAGG + Intronic
906277132 1:44524667-44524689 AATCAATTTCAAAAGCAGGAGGG - Intronic
906293903 1:44637295-44637317 AGCCAAAACATAAATCAGGAAGG + Intronic
906610992 1:47202557-47202579 AACAAAAAAAAAAAACAGGAAGG + Intergenic
906647592 1:47486872-47486894 AAGGAAAAGAAAAAGCAGGAAGG - Intergenic
907465064 1:54629580-54629602 AAAAAAATCAAAAAACAGGCCGG - Intronic
907537844 1:55181280-55181302 AAATAAAACAAAAAACAGGAAGG + Intronic
908548952 1:65190165-65190187 AATAAAGTCAAGAAGCAGGATGG - Intronic
908744988 1:67367779-67367801 AACAAAATAAAAAAAGAGGAGGG - Intronic
908974504 1:69881580-69881602 AACAAAATAAAAAGGCAGGCTGG + Intronic
908996028 1:70155615-70155637 AACCAATTTAAAAACCAAGATGG + Intronic
909794928 1:79721321-79721343 AACCACATCAAGCAGAAGGAAGG + Intergenic
909858216 1:80568807-80568829 AACAAAAACAAAAAGCAGCCAGG + Intergenic
909884687 1:80926415-80926437 AACTAAATCATAAAGAAGGAAGG - Intergenic
909994204 1:82258974-82258996 AAACAAAACAAAATGCAGGGAGG + Intergenic
910406511 1:86897007-86897029 AAAAAAATCAAAGAGCAGGCCGG + Intronic
912131058 1:106600907-106600929 AATAAAATGAAGAAGCAGGATGG - Intergenic
912803754 1:112739754-112739776 TACAAAATCAAAAAACAGGTAGG + Intergenic
912929846 1:113948257-113948279 AAACAAACAAAAAAGCAGTAAGG - Intronic
914863149 1:151403210-151403232 AAACAAACAAAAAAGCAGGGTGG + Exonic
915461963 1:156075774-156075796 AAGCAAAGCAAAGAGCTGGAGGG + Exonic
915632560 1:157163532-157163554 ACCGAAATAATAAAGCAGGAAGG - Intergenic
916098158 1:161369832-161369854 AAGCAAATCAAAAAGCAATGTGG - Exonic
916297685 1:163237694-163237716 AAAAAAAGAAAAAAGCAGGAGGG + Intronic
916494466 1:165333150-165333172 AAACAAAACAAAAAGAAGGAAGG - Intronic
916546976 1:165815061-165815083 AACTATATCAAAAAGCAAGATGG + Intronic
916829053 1:168472571-168472593 ATCCAAATAAAAAATGAGGATGG - Intergenic
917049176 1:170899381-170899403 AAACAAATCAAAAATAAGCAAGG + Intergenic
917307195 1:173638707-173638729 TTTTAAATCAAAAAGCAGGAAGG + Intronic
918431141 1:184462023-184462045 AACCAAATTAAACAACAGGGAGG + Intronic
918662744 1:187109183-187109205 AACCAAATAAACAAAAAGGATGG - Intergenic
918756882 1:188349314-188349336 AACCACACCAAAAAGCAGTTTGG - Intergenic
919345802 1:196376722-196376744 AACCAATTAAAAAAGAAAGAAGG + Intronic
919582683 1:199397131-199397153 AACCATAACTTAAAGCAGGAAGG + Intergenic
919951363 1:202367056-202367078 AACCAACTAAAAATTCAGGATGG - Intronic
920177574 1:204112706-204112728 AACAAAACAAAAAAGCATGAGGG + Intronic
920214180 1:204350547-204350569 CACCAAATCAAAAATCACTATGG + Intronic
920254985 1:204648632-204648654 AACCTAACCAAAAAGTAGGTTGG - Intronic
920305786 1:205017240-205017262 AACCAAACCAGAGAGCAGCAAGG - Exonic
920622945 1:207566311-207566333 AACAAAATGAAAAAGAAAGAAGG - Intronic
920635620 1:207699639-207699661 AACAAAATGAAAAAGAAGGAAGG - Intronic
921773941 1:219075167-219075189 AATCAAATCAATCATCAGGATGG - Intergenic
921970645 1:221145492-221145514 AACCAAAGAAACAAGAAGGAAGG + Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922294308 1:224235952-224235974 AAAGAAAACAAAAAGCCGGAGGG + Intronic
922708205 1:227803189-227803211 ACCCAAAGCAAACAGCAGAAAGG - Intergenic
924167923 1:241304562-241304584 AAGCAAATCACTCAGCAGGAGGG + Intronic
924588173 1:245378299-245378321 ACCCACATCAAAAAGGGGGAGGG - Intronic
1063301994 10:4858015-4858037 AACCGAATCTAACAGAAGGAAGG - Intergenic
1064513190 10:16117377-16117399 TAACAATGCAAAAAGCAGGATGG - Intergenic
1065792697 10:29275947-29275969 AACCAAAACCAAAACCAAGATGG - Intergenic
1066402859 10:35091927-35091949 AAACAAAACAAAAAGCAGGGGGG - Intergenic
1066506720 10:36052896-36052918 AACCAAATTTTAGAGCAGGAAGG + Intergenic
1066576043 10:36825996-36826018 AACAAAAACAAAAAACAGGCTGG + Intergenic
1066615719 10:37292337-37292359 AAACTAATCAAACAGCAGTAAGG - Intronic
1066617196 10:37307561-37307583 AACTAAACCAAAAAGCAGTGAGG - Intronic
1066666255 10:37785397-37785419 CACCAAATCATAAAACAGGCAGG + Intronic
1066692111 10:38039897-38039919 AACCAAATCAAGCAGAAGGCAGG - Intronic
1067377011 10:45736605-45736627 AAATAAATAAATAAGCAGGAAGG + Intronic
1067655262 10:48187061-48187083 AAACAATTCAAAAAACAAGAAGG + Intronic
1067884715 10:50077299-50077321 AAATAAATAAATAAGCAGGAAGG + Intronic
1068589283 10:58837252-58837274 AACAACATAAAACAGCAGGAAGG + Intergenic
1069559615 10:69420215-69420237 AAAGAACTCAAACAGCAGGAAGG - Intergenic
1069588390 10:69626373-69626395 ACCCAAAGCAAACAGAAGGAAGG + Intergenic
1069830762 10:71280907-71280929 AAACAAAACAAAACCCAGGAAGG - Intronic
1070806372 10:79273326-79273348 AAAGAAACCAAGAAGCAGGAGGG - Intronic
1071672641 10:87623477-87623499 AAGCAAAGCAAAGAGCAGTAGGG + Intergenic
1072395109 10:95031518-95031540 AGCCAATTCAAAAAACAAGAAGG - Intergenic
1072993031 10:100216330-100216352 AACCAAATCAAGAAGAAGCCAGG + Intronic
1073404010 10:103281077-103281099 AGCCTAATTAAATAGCAGGAAGG + Intronic
1073655554 10:105411541-105411563 AACCAAAGCAGAAAGAAGTAGGG + Intergenic
1073741951 10:106417274-106417296 AACCATACCAAAAAGCAAGCAGG + Intergenic
1074238574 10:111611715-111611737 AACCCAAACATAAAACAGGAGGG + Intergenic
1075171137 10:120115889-120115911 GACCATAGCAAAAAGCAGAAAGG + Intergenic
1075380075 10:122011913-122011935 AACAAAAACAAAAAACTGGAAGG - Intronic
1076343972 10:129767962-129767984 AACTATATCCAAAAGCCGGAAGG + Exonic
1076862907 10:133150177-133150199 AACCATTGCAGAAAGCAGGATGG + Intergenic
1077363806 11:2153273-2153295 AATCAAAAAAACAAGCAGGAGGG - Intronic
1078841846 11:15084279-15084301 AACCAAAGAAAAAAGAAGAAAGG - Intergenic
1080225627 11:29957100-29957122 AACCAACTCAAAAAACTGAACGG + Intergenic
1081553729 11:44138291-44138313 AAAGAAATCAAAGAGCTGGAAGG + Intronic
1082082190 11:48020829-48020851 AATGAAACCAAAAAGCAGCAAGG + Intronic
1082679192 11:56147799-56147821 AGCCAAATCAGACAGTAGGATGG + Intergenic
1083107935 11:60376505-60376527 AACCAAGTCAAACATCAGGGGGG + Intronic
1083375766 11:62219263-62219285 TTTTAAATCAAAAAGCAGGAAGG + Intergenic
1083999239 11:66287354-66287376 GTCCAAATCAAGAAACAGGAAGG + Intronic
1084140677 11:67226356-67226378 AAACAAAACTAACAGCAGGATGG - Intronic
1084545119 11:69811508-69811530 AAAGAACACAAAAAGCAGGAAGG + Intronic
1084629398 11:70336620-70336642 AATCAAATGAAAAAGAACGAAGG - Intronic
1084866863 11:72065865-72065887 AAACAACTCCAAAAGCAAGAAGG - Intronic
1085526935 11:77169628-77169650 AACCAAATCAGAAACCCAGATGG + Intronic
1086342373 11:85859110-85859132 AAAAAAAATAAAAAGCAGGAAGG + Intronic
1086463582 11:87030763-87030785 AACCTAACCACAAAGGAGGATGG - Intergenic
1088072608 11:105808937-105808959 AACCAAATAAAAATGCAGTTAGG + Intronic
1088489658 11:110374485-110374507 AGCCAAAGAAAAAAGGAGGAAGG - Intergenic
1088681401 11:112245903-112245925 AACCAAAAAACAAAGCTGGAGGG + Intronic
1089876956 11:121732441-121732463 ACCCAAAACAAACAGAAGGAAGG - Intergenic
1089970755 11:122691239-122691261 AACATCATCAAGAAGCAGGAAGG + Intronic
1090153421 11:124409944-124409966 AAAAAAATCAGAAAGCTGGAAGG + Intergenic
1090883019 11:130850948-130850970 CACCAAATGAGATAGCAGGATGG - Intergenic
1091027945 11:132158846-132158868 GAACAAATCACACAGCAGGAAGG + Intronic
1091072460 11:132580869-132580891 AAACAAAATAAAAAGAAGGATGG - Intronic
1091200228 11:133773521-133773543 ACCCAAAGCAAAAAGAAAGAAGG + Intergenic
1091389990 12:120297-120319 AAGGAAATCATAAAGCGGGATGG + Intronic
1091414712 12:271332-271354 AACCAAAAGAAGCAGCAGGAGGG - Intergenic
1092150689 12:6246320-6246342 AACAAAAACAAAAAACAGGCCGG - Intergenic
1092210855 12:6645626-6645648 AACCCAAACAAAAAGAAGTAGGG - Intronic
1092880010 12:12880818-12880840 AAAGAAAACAAAATGCAGGATGG + Intergenic
1092935919 12:13364204-13364226 AATCAAATAAAAAACCAAGAAGG - Intergenic
1093087489 12:14882674-14882696 AACCAAAAAAAAAACCAGGGAGG + Intronic
1094083390 12:26562656-26562678 AACCAAAACAAAGTGCAGCAGGG + Intronic
1094291685 12:28857784-28857806 TGCCAAATCAAGAAGCAGGCAGG - Intergenic
1095380048 12:41580191-41580213 ATACAAATCAAAAAATAGGATGG - Intergenic
1095912050 12:47437735-47437757 ATCCAAAGCAAACAGAAGGAAGG + Intergenic
1096026780 12:48372335-48372357 AACAAAAGCAAAAATCAGGTGGG + Intergenic
1096362883 12:51003239-51003261 AAACAAACAAAAAAGCAGGCTGG + Intronic
1097146631 12:56944192-56944214 ATCCAAATTAAAAAGGAAGAAGG - Intergenic
1098312486 12:69161439-69161461 AACAGACTCAAAAAGCATGACGG - Intergenic
1098560178 12:71864361-71864383 AACGAAAACAAAAAGCAGCCGGG - Intronic
1098746225 12:74240540-74240562 AACGAAACAAAAAAGCAGAAAGG + Intergenic
1099753633 12:86810933-86810955 ACTCAGAGCAAAAAGCAGGAAGG - Intronic
1099753696 12:86811836-86811858 ACTCAGAGCAAAAAGCAGGAAGG - Intronic
1100065672 12:90641352-90641374 AAGCAAGACAGAAAGCAGGAAGG + Intergenic
1100361128 12:93880509-93880531 AGCAAAATGAAAAAGCAAGACGG - Intronic
1100689994 12:97029563-97029585 AACCAAAAAAGAAGGCAGGAAGG + Intergenic
1101771253 12:107753456-107753478 CACCAAAACAAATGGCAGGAAGG + Intronic
1101893922 12:108740295-108740317 ACCCAAAGCAAACAGAAGGAAGG - Intergenic
1102541706 12:113624503-113624525 AAACAAAACAAAAAGAAGCAAGG + Intergenic
1103103009 12:118196778-118196800 AACAAAACCAAAAAGAAGGCAGG - Intronic
1103371586 12:120423378-120423400 AAACAAAACGAAAAGAAGGAAGG - Intergenic
1103425252 12:120828437-120828459 ACTCAAATCAAATAGAAGGAAGG + Intronic
1103713719 12:122931004-122931026 AACAAAAACAAAAAACAGAATGG - Intronic
1103768610 12:123301889-123301911 AACCAAACAAAAAAACATGAAGG + Intronic
1104006147 12:124893940-124893962 AAGAAAAAGAAAAAGCAGGAAGG + Intergenic
1104153866 12:126111300-126111322 AACCAATTCAAAAAGCATATAGG - Intergenic
1104575547 12:129963021-129963043 AAAAAAATTAAAAAGCAGGAGGG - Intergenic
1105042704 12:132973324-132973346 ACCCAATTCAAAAGGCAGGAGGG + Intergenic
1105284255 13:18992015-18992037 CACCAAAAGAAAGAGCAGGAAGG + Intergenic
1105682971 13:22748496-22748518 ACTCAAATCAACAAGAAGGATGG + Intergenic
1105703583 13:22952704-22952726 AACCAAAGCAAACAAAAGGAAGG + Intergenic
1105856541 13:24377765-24377787 AACCAAAGCAAAGAAAAGGAAGG + Intergenic
1105956953 13:25292537-25292559 AACCACAAGAAAAGGCAGGAGGG + Intergenic
1107286466 13:38798820-38798842 AACAAAATCAGAAAGGAAGAAGG - Intronic
1107398609 13:40045852-40045874 AACCAAATAAAATGGAAGGAAGG - Intergenic
1108341704 13:49504018-49504040 AAAAAAATCAAAAAGGAGGCTGG - Intronic
1108520543 13:51243498-51243520 AACCAGGTCTGAAAGCAGGAGGG - Intronic
1108561207 13:51646078-51646100 AACCAAGTAAAAAAGGATGAAGG - Intronic
1108641648 13:52388017-52388039 AACCAAACCAAAAAGTTTGAAGG + Intronic
1108785436 13:53895457-53895479 AACCAAATCAAAAAAGGGCAAGG + Intergenic
1109220660 13:59637922-59637944 AATCATATTAAAAAGCTGGAGGG + Intergenic
1109639699 13:65174392-65174414 AACCAAACCTAAAAGCAAAATGG - Intergenic
1110082282 13:71330546-71330568 AAACAAAACAAAAAGCGGGGAGG - Intergenic
1110104599 13:71655793-71655815 AAGCAAATGAAAAAGAAAGATGG - Intronic
1110554132 13:76839552-76839574 AGCCTAATCAAAATACAGGAAGG - Intergenic
1110592779 13:77284074-77284096 AACAAAAGCAAAAAGCAAAAGGG + Intronic
1111676047 13:91390321-91390343 ACCCAAATTAAAAAGCAGATGGG + Intergenic
1112331603 13:98481297-98481319 AAGCAAATCACAGACCAGGACGG + Intronic
1112383157 13:98912443-98912465 AAACAAAACAAAAAGAAGCAGGG + Intronic
1113061668 13:106329005-106329027 AAACAAAACAAAAGGAAGGAAGG + Intergenic
1113405843 13:110039286-110039308 AACCAAACCAGACAGGAGGAAGG + Intergenic
1115149072 14:30262293-30262315 AACCAAACTAAAAAGCATTAAGG - Intergenic
1115160266 14:30386058-30386080 AACCTATTGAAAAAGCAGAATGG - Intergenic
1115282588 14:31680498-31680520 AACCAAATTAAAAAGAATAAAGG - Intronic
1115304855 14:31923455-31923477 AACAAAACCAAAAAGAAGCACGG - Intergenic
1115439493 14:33415874-33415896 AACCAAATAAAAAAATTGGAAGG - Intronic
1116102083 14:40451505-40451527 AACAAAAAAAAAAAGAAGGAAGG + Intergenic
1116123979 14:40757757-40757779 TACTAAATCAAAAAGAGGGAGGG - Intergenic
1116188065 14:41624889-41624911 AAAAAAATTAAGAAGCAGGAGGG - Intronic
1117021762 14:51578085-51578107 TGCCAAGTCAACAAGCAGGAAGG + Intronic
1117408019 14:55423565-55423587 AACAAAATCAGGCAGCAGGATGG - Intronic
1118857721 14:69637114-69637136 AAACACATCAAAAAGCTGGGAGG - Intronic
1120480264 14:85040599-85040621 AAACAAAGCCAAAAGCAGCAGGG - Intergenic
1120691280 14:87596121-87596143 AAACAAAACAAAAAACAGGATGG + Intergenic
1121345377 14:93131819-93131841 AAACAAAACAAAAAGCAGACTGG - Intergenic
1122123938 14:99569160-99569182 AACCAAAGAATAAAGCAGTAAGG + Intronic
1124056330 15:26243919-26243941 AAAAAAATCAAAAGGCAGCACGG - Intergenic
1124448564 15:29763390-29763412 AACAAAATCAAAAACCAAGATGG + Intronic
1124623026 15:31289031-31289053 ACCCAAAACAAGAAGAAGGAAGG - Intergenic
1125286980 15:38103959-38103981 AACTAAAACTAAAAGCAGGTAGG + Intergenic
1125289668 15:38131743-38131765 TAACAAAGAAAAAAGCAGGATGG + Intergenic
1125309970 15:38368058-38368080 AGACAAAACAAAAAGCAGGAAGG + Intergenic
1125766021 15:42137140-42137162 AATCAAACCAGAAAGCAGGAAGG + Intergenic
1125904940 15:43382810-43382832 AACTAAAACAAAATGCAGAATGG - Intronic
1126236648 15:46392987-46393009 AACAAAAACTAAAAGCAAGAAGG + Intergenic
1126639981 15:50814605-50814627 AAAAAAATAAAAAAGCAGAATGG - Intergenic
1126846463 15:52765093-52765115 AACAATATCAAAAAGCATGTGGG + Intronic
1127047921 15:55046970-55046992 AACAAAAAAGAAAAGCAGGAAGG + Intergenic
1127212407 15:56787311-56787333 AACAAAAACAAAATGGAGGAAGG - Intronic
1127245603 15:57170228-57170250 AAACAAATAAAAATGAAGGAAGG - Intronic
1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG + Intronic
1127737992 15:61863506-61863528 AATCATATCAAAAAGTTGGAAGG - Exonic
1127785269 15:62350129-62350151 AAACAAAACAAAAAGCATGGCGG + Intergenic
1127871139 15:63074982-63075004 AATCAAAACAAAAAGCACTAGGG + Intergenic
1128662149 15:69509543-69509565 AATCAAAGCCAAAAGCAGGAGGG - Intergenic
1128663381 15:69520026-69520048 AGCCCAATTAAAAAGTAGGATGG + Intergenic
1129884681 15:79030041-79030063 AACGAAACCACCAAGCAGGAAGG - Intronic
1130217301 15:81984445-81984467 AACAATTACAAAAAGCAGGAAGG - Intergenic
1131518785 15:93098020-93098042 AAACAAAACAAAAGGCAGGGGGG - Intergenic
1131579265 15:93625940-93625962 AACAAAAACAAAAAACAGAAGGG + Intergenic
1132353867 15:101157414-101157436 AAACAAAACAAAAACCAGGCTGG - Intergenic
1132935793 16:2480289-2480311 AAAAAAATAAAAAATCAGGAAGG - Intronic
1133544312 16:6790489-6790511 AAACAAAACAAAAAGAACGATGG - Intronic
1135015093 16:18918543-18918565 AACAAAAACAAAAACCTGGAGGG - Intronic
1135830102 16:25765475-25765497 AATCAGATCCAAAGGCAGGAGGG + Intronic
1136012091 16:27370336-27370358 TTCCTAATCAAAAAGCAGCATGG + Intergenic
1136352477 16:29719967-29719989 AACCAAAACAAAACGAAGGAAGG - Intergenic
1136388877 16:29949178-29949200 AACCACATTAAAAAGCAGTGGGG - Intronic
1136446887 16:30327557-30327579 AACAAAAACAAAAACCTGGAGGG - Intergenic
1137451825 16:48582921-48582943 AACCAATTTAAAAAGTAGGTGGG + Intronic
1137467224 16:48720784-48720806 AGGCAAATCAAAGAGGAGGAGGG - Intergenic
1137600864 16:49755222-49755244 AAGCAAATAACAAAGCAGGCGGG + Intronic
1137704321 16:50523753-50523775 AACCTAATTCAAAAGCAAGATGG - Intergenic
1138322181 16:56125067-56125089 AACCAAGTGAAAAAATAGGAAGG - Intergenic
1138518582 16:57555763-57555785 AACCATATCAATAAGTAAGAGGG - Intronic
1138872818 16:60912290-60912312 CAACAAAACAAACAGCAGGATGG - Intergenic
1139265659 16:65636080-65636102 CACCAGATCATAAAGCAGAAAGG + Intergenic
1140097835 16:71890756-71890778 AAAAAAAAAAAAAAGCAGGAAGG - Intronic
1140136683 16:72212105-72212127 AAACAAGTGAGAAAGCAGGATGG + Intergenic
1140336879 16:74115687-74115709 AACAAAATCAATAAGCAAAAAGG + Intergenic
1144471264 17:15543515-15543537 AAAGAACTCAAAAAGCATGAGGG + Intronic
1144484970 17:15656726-15656748 AACCAAATAAAAAACAAAGAAGG - Intronic
1144519919 17:15946556-15946578 AACTAAATCACAGAGTAGGAAGG + Intronic
1144545274 17:16189095-16189117 AACAGAATCAAATAGCAGGCCGG + Intronic
1144567693 17:16373565-16373587 AACCCAGTCACAAGGCAGGAGGG - Intergenic
1144712563 17:17411708-17411730 AAGCAAATTACAAAGCAGAATGG - Intergenic
1144746625 17:17620170-17620192 AACTAAATCAAAATGAAGGCCGG + Intergenic
1144925202 17:18801178-18801200 AAAGAACTCAAAAAGCATGAGGG - Intronic
1145031762 17:19509723-19509745 AAACAAAACAAAAAGTAGGCTGG + Intronic
1145098961 17:20057460-20057482 AACAACAGCAAAAAACAGGAAGG + Intronic
1145926866 17:28654452-28654474 AACCAAATCAAGAAATGGGAAGG - Intronic
1146073211 17:29703102-29703124 AAGGAAATCAAAGAGTAGGATGG + Intronic
1146257817 17:31401746-31401768 AACCAAAACAAAAACCAGAAGGG + Intronic
1146612061 17:34315102-34315124 AATCAAATCAAAGAGCAGAGAGG - Intergenic
1146821689 17:35987939-35987961 AACCACATCAGCAAGCAGAATGG - Intronic
1146896029 17:36543010-36543032 AAACAAAACAAAAACCAGGACGG - Intronic
1148436330 17:47688800-47688822 AACAAAAACAAAAAACAGGCTGG + Intergenic
1148769714 17:50059921-50059943 AACCAGAGCAACAAGCTGGAGGG - Intronic
1148816935 17:50334948-50334970 AAACAAATTTAAATGCAGGAAGG + Intergenic
1149110574 17:53023719-53023741 AAATAAAACAAAAAGCAAGAAGG + Intergenic
1149506461 17:57197971-57197993 AATAAAGTCTAAAAGCAGGAAGG - Intergenic
1149702805 17:58669358-58669380 AAACAAAAAAAAAAACAGGAGGG + Intronic
1150227682 17:63532680-63532702 AACCAAATCAATTAGCAGATGGG - Intronic
1150671922 17:67208001-67208023 AACAAAAACAAAAAACAGCATGG + Intronic
1151053194 17:71003278-71003300 AAATAAATAAAAAACCAGGAAGG + Intergenic
1151524825 17:74657873-74657895 AACAAAAACAAAAACCAAGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153488124 18:5622035-5622057 AACCAAAGCAAAATGCAGTTAGG - Intronic
1153887819 18:9482704-9482726 CACCAAATCAAAAGGCACAAGGG - Intronic
1155033347 18:22003127-22003149 AATCAAATTAAAAATGAGGACGG - Intergenic
1155102343 18:22624194-22624216 AATCAAATCAGAGATCAGGAAGG - Intergenic
1155139955 18:23036018-23036040 AACAAAAACAAAAAGTAGGCTGG + Intergenic
1155240997 18:23863449-23863471 AAACAAAACAAAAAGGAGGAGGG + Intronic
1155856020 18:30835604-30835626 AAACAAAACAAAAAGAAGTAGGG + Intergenic
1155904207 18:31429676-31429698 AAAAAAATGAAACAGCAGGAAGG + Intergenic
1155977891 18:32151350-32151372 AACTAAATCAAAATGGAGGAGGG - Intronic
1156441674 18:37195741-37195763 GAGCAAAACAAAAAGCTGGAGGG - Intronic
1156622355 18:38867566-38867588 CACAAAATCAAGAAGCAGGGAGG + Intergenic
1156877018 18:42026731-42026753 AACCAAAGCAAATAACAGGTTGG - Intronic
1157212456 18:45755328-45755350 AACCACATCAAGAAGAAGGGGGG + Intergenic
1157466101 18:47946932-47946954 AAAAAAAAAAAAAAGCAGGAGGG + Intergenic
1157804817 18:50650236-50650258 AAGCAACTCAAAAAGAAGGCAGG + Intronic
1157871866 18:51237320-51237342 AACTACATCAAAAGGCAGAAAGG - Intergenic
1158377086 18:56883217-56883239 AAAAAAAAAAAAAAGCAGGAAGG + Intronic
1158993799 18:62896589-62896611 AACAACAACAAAAAACAGGACGG - Intronic
1159112969 18:64081908-64081930 AAACAAATGAAAAAACAGCATGG + Intergenic
1159474502 18:68902399-68902421 TAGGAAATCAAAAAGCAGCATGG + Intronic
1159480139 18:68979958-68979980 AAACAAAACAAAAACCAGAATGG - Intronic
1159493582 18:69170864-69170886 AACCAAAACAAAAAACACAAAGG - Intergenic
1159721237 18:71893876-71893898 AACCAATTTAAAAAGCAAAAAGG - Intergenic
1159893697 18:73976907-73976929 AAACAAACCAAAAAGGAAGAGGG + Intergenic
1159977516 18:74732341-74732363 AACCAAGTCCAAAGGCAGGAAGG - Intronic
1160582461 18:79892481-79892503 AACCCAATCAAAAGGCAGACTGG - Intronic
1160602841 18:80027327-80027349 AAACAAAAAAACAAGCAGGAGGG + Intronic
1161970145 19:7574262-7574284 AAACAAAACAAAAACCAGGCTGG + Intergenic
1162101894 19:8343720-8343742 AAACAAAACAAAAAACAGTAGGG - Intronic
1162626524 19:11888978-11889000 AACAAAAACAAAAAACAGAAAGG + Intronic
1162784106 19:13023516-13023538 AACAAAAACAAAACCCAGGAGGG - Intronic
1163946000 19:20535295-20535317 AACAAAATAAAAGAGAAGGAAGG + Intergenic
1164623825 19:29714030-29714052 AGCAACAACAAAAAGCAGGAAGG - Intronic
1164726045 19:30466401-30466423 AACCAAAACAAAAATCAGCTGGG + Intronic
1165385343 19:35507252-35507274 ATCCAAATCAAAAGGAAGGAAGG + Intronic
1165581668 19:36870487-36870509 AACCAAACCAAGAAACAGGAAGG - Intronic
1165662349 19:37592889-37592911 AACCAAAACAAAACACAGGAGGG + Intronic
1166086185 19:40476881-40476903 AACAAAAACTAAAAACAGGACGG - Intronic
1166264249 19:41667920-41667942 ACCAAAATCCAGAAGCAGGAAGG - Intronic
1166922891 19:46243195-46243217 AACCAAAGCAAGGAGAAGGAAGG - Intergenic
1167783840 19:51619787-51619809 AACCAAAACAAGTAGAAGGAAGG + Intronic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
927645051 2:24872304-24872326 AAACAAAACAAAGAGCAGGAAGG + Intronic
928035453 2:27818420-27818442 CACCAAATCAAGAGGCAGGGTGG + Intronic
928038412 2:27849062-27849084 AAACATAACAGAAAGCAGGAGGG + Intronic
928634561 2:33230086-33230108 AACAAAATCAAAAAGCTTCAAGG - Intronic
928690777 2:33796531-33796553 AACCTAAACAAAAGGTAGGATGG - Intergenic
929120465 2:38480111-38480133 AGACACATCCAAAAGCAGGAGGG + Intergenic
929311141 2:40427259-40427281 AAACAAACCAAAAAGGGGGAGGG - Intronic
930223879 2:48772353-48772375 AGCTAGTTCAAAAAGCAGGAGGG + Intronic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
930692650 2:54380149-54380171 AATAAAATAAAAAAGAAGGAAGG + Intronic
931111376 2:59114924-59114946 AACCATATCAGACAGCAAGAGGG + Intergenic
931156423 2:59636547-59636569 AAACAAAACAAAAAACAGGAAGG - Intergenic
932235508 2:70117870-70117892 AACCAAAACCAAAAGCTGCAAGG + Intergenic
932554551 2:72809532-72809554 ACCCAAAGTAAACAGCAGGAAGG + Intronic
932969398 2:76521629-76521651 ATCCAAATGAAATAGCAGGTGGG + Intergenic
933540942 2:83642020-83642042 AAACACAACAAAAAGAAGGAAGG - Intergenic
933936687 2:87210391-87210413 AACCAAAACAGAAAGAAGGAAGG - Intergenic
934073197 2:88404764-88404786 AACAAAAACAAAAAACAGGCAGG + Intergenic
935225936 2:101053235-101053257 AAGCATTTCAAAAAGAAGGAAGG + Intronic
935540765 2:104345527-104345549 ACCCAAAACAAACAGAAGGAAGG + Intergenic
936356458 2:111755434-111755456 AACCAAAACAGAAAGAAGGAAGG + Intergenic
936408831 2:112235728-112235750 ACCAAAATCAAAATACAGGAAGG + Intronic
936414928 2:112298263-112298285 ACCCCAATCCAAAAGAAGGACGG + Intronic
936981355 2:118268350-118268372 AACTAATTCAAATACCAGGAGGG - Intergenic
937394651 2:121524297-121524319 AACAAAACCAAAAGGGAGGAAGG + Intronic
937726118 2:125168385-125168407 AATCAAAGCAGAAAACAGGAGGG - Intergenic
938926847 2:136051201-136051223 AACCAAAGCTAAAAGCAGGGGGG - Intergenic
938984791 2:136564236-136564258 AAACAAATCACAAGACAGGAAGG - Intergenic
939044255 2:137231384-137231406 AATCAAAGCAAAAAGCATGGAGG - Intronic
939303988 2:140385833-140385855 AGCCCATTCAATAAGCAGGATGG - Intronic
940016093 2:149106631-149106653 ATCAATATCAAAAAGGAGGAAGG - Intronic
940479244 2:154206797-154206819 AACAAAAAAAAAAAACAGGAAGG + Intronic
940951647 2:159682156-159682178 AAGCAAAGAAAACAGCAGGAGGG - Intergenic
941177325 2:162214715-162214737 AAGGAAATCACAAAGCTGGAAGG + Intronic
941698975 2:168583461-168583483 AAGCAAATGAAAAAGAAGCAAGG - Intronic
942011124 2:171763366-171763388 AACAGATGCAAAAAGCAGGAGGG + Intergenic
942949622 2:181707615-181707637 AAACAAAACAAAAAACAGAAAGG + Intergenic
943482257 2:188434479-188434501 AACCAAAACAAGAGGCAGAATGG - Intronic
943780965 2:191823286-191823308 AACAAAAACAAAAAAGAGGAAGG + Intergenic
943901526 2:193444447-193444469 AACCAAATAAGTAAGCTGGATGG + Intergenic
944293859 2:198040075-198040097 TACCAAATCCAAAAGTAGAATGG + Intronic
944888717 2:204093794-204093816 ATCCAAATCAGAAAGGAAGAAGG - Intergenic
945804185 2:214470019-214470041 AAGCAAAGCAAAAGGCAGAATGG + Intronic
947162757 2:227230523-227230545 AATCACATAAAAAACCAGGATGG - Intronic
947445434 2:230159249-230159271 AACTAAATAAAAAAGCAGCTGGG - Intergenic
948575716 2:238948183-238948205 AACCAAATCCACAAACAGGATGG + Intergenic
949069034 2:242012400-242012422 AAACAAATAAAAAAGAAAGATGG - Intergenic
1168995890 20:2132970-2132992 AAACAAACAAAATAGCAGGATGG - Intronic
1169587825 20:7106064-7106086 AACCAAAACAAAAATTATGACGG + Intergenic
1169898326 20:10527889-10527911 TCCCAAATGAAAAAGCAGGATGG - Intronic
1170490049 20:16863525-16863547 ACCCAAGTCACATAGCAGGAAGG - Intergenic
1170519404 20:17168538-17168560 AAACAAAACAAAAAGCACCACGG - Intergenic
1170575652 20:17659717-17659739 AACCAAGGCAAAAAGGCGGAGGG - Intronic
1171061099 20:21960961-21960983 ACCCAAAGCAAACAGAAGGAAGG - Intergenic
1171453989 20:25256513-25256535 AACAAAAACAAAAAACAGGCTGG + Intronic
1173483311 20:43420880-43420902 AACCAAAACCAAAAGCAAGCAGG + Intergenic
1173881554 20:46416868-46416890 AACCATATGGAAAATCAGGAAGG + Intronic
1174119933 20:48257109-48257131 AACCAAATGCAACAGCTGGAAGG - Intergenic
1174187698 20:48718502-48718524 ACAGAAATCAAAAAGAAGGACGG + Intronic
1175288427 20:57854821-57854843 AATCAAATTAAAAATCAGAAAGG - Intergenic
1177124217 21:17175925-17175947 AACCAAAGCAAGCAGAAGGAAGG + Intergenic
1177293334 21:19143685-19143707 AAACAAAACAAAAAGCACAATGG - Intergenic
1178139159 21:29662476-29662498 AACAAAATCTAGAAGCTGGAAGG + Intronic
1178153144 21:29819407-29819429 AGCCAAATTAAAAATCAGAAAGG + Intronic
1178620937 21:34174336-34174358 AACCACAACATAAAGGAGGATGG + Intergenic
1178779986 21:35593514-35593536 AAACAGAACAAAAAGCAGGTAGG + Intronic
1178900793 21:36596963-36596985 CACCAACTCAAAGAGCTGGAGGG + Intergenic
1178936135 21:36863445-36863467 AACTAAAACAGAAAGCATGAGGG + Intronic
1180978485 22:19866149-19866171 AACCAAAGTAAATAGAAGGATGG - Intergenic
1181319396 22:21992879-21992901 AGCCAAAACAAAAAGCAGATTGG - Intergenic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1181947209 22:26527658-26527680 AACCAAAGCACAGAGAAGGAAGG - Intronic
1182863154 22:33578998-33579020 CACCAAAATACAAAGCAGGAAGG + Intronic
1183200563 22:36383222-36383244 AACGAAATCAAAAAACAAAAAGG + Intronic
1185157485 22:49202956-49202978 AAACAAAACAAAATCCAGGAAGG - Intergenic
949217614 3:1588566-1588588 AAACAAATCAACAAGCAAAAAGG + Intergenic
949433314 3:4002016-4002038 AAGCAAATCACATAGCAAGAGGG + Intronic
949519538 3:4837182-4837204 AACAAAACCAAAAAAAAGGAGGG + Intronic
949574048 3:5321548-5321570 AACAACATCCAAAAGTAGGAAGG - Intergenic
949688485 3:6606943-6606965 AACCAAAGTAAACAGAAGGAAGG - Intergenic
949695888 3:6695094-6695116 AACCAAACCAAAAAAAAGGATGG - Intergenic
949967201 3:9367545-9367567 AACCTAACCAAAAAGCAGTGTGG - Intronic
950220065 3:11188200-11188222 AATCAAAGCATAAAGCAGCATGG + Intronic
950250779 3:11463510-11463532 AACCAAGTCTAAATGCGGGAAGG - Intronic
950923386 3:16716954-16716976 AACCAATTTAAAAAGCAGTCTGG + Intergenic
951292911 3:20895942-20895964 AACCAAAGCAACCAGAAGGAAGG + Intergenic
951865668 3:27304631-27304653 AAAGAAATCCCAAAGCAGGAGGG + Intronic
952047104 3:29335870-29335892 AACAAAATGAAAAAGAGGGAGGG - Intronic
952689046 3:36182036-36182058 AACCATATCAAATAGCAATATGG + Intergenic
953388418 3:42520437-42520459 AACCCAATCACAAGGCAGGCAGG + Intronic
953690268 3:45112049-45112071 AACCTAATCAGATAGCAGGGAGG + Intronic
954103278 3:48394425-48394447 AACCAAATCTAAGAGCACGAAGG + Intronic
954352453 3:50056146-50056168 AACCAAACCAAAATGTGGGAAGG + Intronic
954387780 3:50253318-50253340 CCCCAAACCAAAAAACAGGAAGG - Intronic
954990795 3:54839341-54839363 AAACAAATCAAAAAGTGGGAGGG + Intronic
955021301 3:55124181-55124203 AGCCAATTAAAAAATCAGGAAGG - Intergenic
955581630 3:60429416-60429438 AACCCAAGCAAAAAGAAGGAAGG + Intronic
955695618 3:61633026-61633048 CGCCAAATCAAGAAGAAGGATGG - Intronic
956262458 3:67359832-67359854 AACAACATCCAAAATCAGGAAGG - Intergenic
956321909 3:68007310-68007332 AAACAAAACAAAAATCAGGTGGG - Intronic
957391869 3:79584895-79584917 AACCAGATCAAAAAGCTGTCAGG - Intronic
957908805 3:86593918-86593940 ATCAAAATCAAAAAAGAGGAGGG - Intergenic
958076355 3:88685086-88685108 AACCAGACCAAAAATCAGGTTGG + Intergenic
958147540 3:89645885-89645907 ATCAAAATCAAATAGCAGAAGGG - Intergenic
958951368 3:100420317-100420339 CACCATCTCAAAAAGAAGGAAGG - Intronic
959360428 3:105383020-105383042 AACCCACTCAGGAAGCAGGAAGG - Intronic
959569780 3:107870720-107870742 AAGAAAATTAAAAAGAAGGAAGG - Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
960510268 3:118541217-118541239 AGCCAAAGAAAGAAGCAGGAGGG + Intergenic
960572270 3:119196832-119196854 AAACAAAACAAAAACCAGGCTGG - Intronic
961476893 3:127152678-127152700 AACCATGTCAGAAACCAGGAGGG - Intergenic
963658685 3:148094429-148094451 AACCAAATGAAATAACAGTATGG + Intergenic
965323032 3:167270736-167270758 TACTAAATCAAAAAGCTGGGAGG + Intronic
967137846 3:186527607-186527629 AAACAAGTCAAAAAACAGAAGGG - Intergenic
967182195 3:186915604-186915626 AACAAAAACAAAAAGCCTGAAGG - Intergenic
967313429 3:188128042-188128064 AAGCAAAACAAAAAGAAAGATGG + Intergenic
969903491 4:10371702-10371724 AACCAAAACCAACAGCAGGGTGG - Intergenic
970092435 4:12425880-12425902 AAAGAAATGAAACAGCAGGAGGG - Intergenic
970144253 4:13017140-13017162 ATCCAAATCAGAAAGGAAGAAGG + Intergenic
970145138 4:13028186-13028208 AAACAAATCAAAAAGGATGGAGG + Intergenic
970242326 4:14022359-14022381 TACCAAATAAATGAGCAGGATGG - Intergenic
970338332 4:15077440-15077462 AATCAAATAAAAAATCAGAAGGG + Intergenic
971067297 4:23047837-23047859 AACCAAAACAAAAAGCATAATGG - Intergenic
972263224 4:37432836-37432858 AAGCAAATGAAAAAGGAAGAGGG + Intronic
972393636 4:38636798-38636820 AACCACATCAAAATTGAGGAGGG + Intergenic
972834460 4:42853141-42853163 AACAAAAGCAAAATGCAAGAAGG - Intergenic
972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG + Intronic
972992781 4:44842604-44842626 AAACAAATCAAATAGAAGGGGGG + Intergenic
974192228 4:58520617-58520639 ACCCAAATAAAAAAGCACTATGG - Intergenic
974643588 4:64665613-64665635 AACCACAAGAGAAAGCAGGAAGG + Intergenic
974698616 4:65408201-65408223 AAACAAACCAACAAGCATGAAGG - Intronic
974771890 4:66425330-66425352 AAAAAAGTTAAAAAGCAGGAGGG + Intergenic
974861225 4:67524026-67524048 AACCCAATCAAGCAGAAGGATGG + Intronic
976200909 4:82577908-82577930 AACCAAAGCAAAATGGAGAATGG + Intergenic
976860596 4:89661352-89661374 AACAAAAACATAAAGCAGGAAGG + Intergenic
977236038 4:94508391-94508413 AACCTAAACAAAGAGCTGGAAGG + Intronic
977492636 4:97733965-97733987 ACCCAAATCAGAAAGGAAGAAGG - Intronic
977620663 4:99133387-99133409 AAGCACATCAAAAAGAAAGAGGG + Intronic
977944375 4:102894791-102894813 AACCAAAACAAAAAGCTAGTTGG + Intronic
978085947 4:104654918-104654940 AAAAAAATGAAAAAGAAGGAAGG + Intergenic
978272124 4:106903499-106903521 AACAAAAGAAAAAAGCAGAAAGG + Intergenic
978791197 4:112665079-112665101 AACAAAATAAAAAGGAAGGAAGG + Intergenic
978829250 4:113063886-113063908 AATGAAATAAAGAAGCAGGAAGG - Intronic
979289530 4:118964654-118964676 AATCAAATCAAAGAGTGGGAGGG - Intronic
979546461 4:121945668-121945690 AACCATATCAATTAGCAGGTGGG - Intronic
980415255 4:132479956-132479978 AACCAAAACATAAAACAGGTAGG + Intergenic
980767273 4:137322765-137322787 AACCCAAACAAACAGAAGGAAGG + Intergenic
981985619 4:150851309-150851331 AACAAAAACAAAAAAAAGGAGGG + Intronic
982815148 4:159875395-159875417 AAACAAATTAAAAAGCTAGAAGG - Intergenic
983568806 4:169182853-169182875 AACCAAAAAAAAAAGGAGAAAGG + Intronic
983658112 4:170103081-170103103 AACAAAGTTAAAAAGCAGGGTGG + Intergenic
983982050 4:174009878-174009900 AACCAGACCTAAAAGCAGAAGGG - Intergenic
984410809 4:179395712-179395734 AAGCTAATCAAAACGCAAGAAGG + Intergenic
984418545 4:179490410-179490432 AAACAAATCAAATAGCACAAGGG + Intergenic
985237496 4:187891993-187892015 AAACAAAACAAAAAGAAAGATGG + Intergenic
986265471 5:6186562-6186584 AGACAAATCATAAAGCAGAAAGG - Intergenic
986664854 5:10093030-10093052 AAGCAAATCAAGAAACATGAGGG + Intergenic
986853096 5:11835832-11835854 AACCAAAACAAACAGAAAGAAGG - Intronic
986951000 5:13084835-13084857 AACCAAAGCAAAGGGAAGGAGGG - Intergenic
987320818 5:16767539-16767561 TTCCAAATCAGAAAACAGGAAGG - Intronic
987762141 5:22178827-22178849 AATCAAATTAGAAAGCAGAAAGG - Intronic
988413143 5:30912269-30912291 AAACAAATGAAAAATAAGGAAGG - Intergenic
988550249 5:32194356-32194378 AACCATAAGAAAAAGCAGCAGGG + Intergenic
989703253 5:44296241-44296263 AACCAAAACAAAAATCAAAATGG + Intergenic
990403131 5:55460279-55460301 AAACAAAACTAAAAGCAGGCAGG + Intronic
990491601 5:56308395-56308417 AAGCATATCAAAAGGCAAGATGG - Intergenic
991041558 5:62181168-62181190 AACCCAGTCAAAAAGCATCATGG + Intergenic
991531646 5:67621802-67621824 ATCCAAATCAGAATGCAGGCAGG + Intergenic
991775076 5:70076528-70076550 GACAAAATCAAAAAGAAGGAAGG + Exonic
991854369 5:70951948-70951970 GACAAAATCAAAAAGAAGGAAGG + Exonic
991896924 5:71412291-71412313 AATCAAATTAGAAAGCAGAAAGG - Intergenic
992031237 5:72723545-72723567 AACCTATTCAAAAGGCAGGCTGG - Intergenic
992220954 5:74572953-74572975 AACAAACTGCAAAAGCAGGAAGG + Intergenic
992227157 5:74630018-74630040 AACAAAACAAAAAAGCATGAAGG + Intronic
992357995 5:76005444-76005466 AACCAACTAAAAAACCATGAAGG - Intergenic
992694886 5:79276413-79276435 AAACAAAACAAAAAGCAGCCAGG - Intronic
993356531 5:86915910-86915932 AATCATATCAAAAAACAGAAGGG - Intergenic
993729304 5:91403719-91403741 CACCAAAATGAAAAGCAGGAGGG + Intergenic
993881935 5:93373435-93373457 AACCAAAACAAAAATGAGAAAGG + Intergenic
994306565 5:98212570-98212592 AACCGCATCAAACAGCAGGGAGG + Intergenic
994760173 5:103842162-103842184 AACAAAAACAAAAAACAAGAGGG + Intergenic
994975261 5:106796521-106796543 GACCTAATGAAAAAGAAGGAAGG + Intergenic
995043666 5:107619391-107619413 AAGCAAATTAAAATGCAAGAAGG + Intronic
995758208 5:115535055-115535077 AACCATATGCCAAAGCAGGAAGG + Intronic
996023451 5:118617170-118617192 TCCCAAATCAAAAATTAGGATGG + Intergenic
996141546 5:119915357-119915379 AAACACATGAAAAAGCAGCAGGG - Intergenic
996896306 5:128487178-128487200 TACCAAAGCAAAGAGCCGGATGG - Intronic
997318720 5:132960074-132960096 AACCAAAGGAAAAAGCAGCAAGG + Intronic
998761226 5:145434259-145434281 TACTAAATCATTAAGCAGGAAGG + Intergenic
999263671 5:150252970-150252992 ACCAAAATCACAAAGCAGGCTGG + Intronic
1000111526 5:158112585-158112607 AAACAAATAATAAAGCAGGCTGG + Intergenic
1000297252 5:159922678-159922700 AACCAAAAGAAAAAGTGGGAGGG + Intronic
1000581778 5:163043084-163043106 AAAAAACTCAAAAAGCAGGGAGG + Intergenic
1000801641 5:165734987-165735009 AACAGAAACCAAAAGCAGGAAGG - Intergenic
1001378886 5:171289289-171289311 GACCTTATCAAAGAGCAGGATGG - Intronic
1001496449 5:172190995-172191017 AATCAAATCAAGAATCAGGCCGG + Intergenic
1002159289 5:177305592-177305614 AACAAAATCCAGGAGCAGGATGG + Intronic
1003869715 6:10391780-10391802 AAACAAAACAAAAACCCGGAAGG + Intergenic
1004040885 6:11973983-11974005 AAGAAAATTAAAATGCAGGATGG + Intergenic
1004477470 6:15987231-15987253 AACTAAAACAAAAATCAGGATGG + Intergenic
1004761960 6:18677214-18677236 AGACAAAGCAAAATGCAGGATGG + Intergenic
1005076598 6:21914190-21914212 AAGCAAAACAAAAGGCAGCACGG - Intergenic
1005883464 6:30076649-30076671 AAAAAAATCAGGAAGCAGGAGGG - Intergenic
1006243008 6:32703098-32703120 ACCAAAAACAAAAAGCAGCAAGG - Intergenic
1006426946 6:33970467-33970489 AGCCAAAGCAAAGAGAAGGAGGG + Intergenic
1007875659 6:45098126-45098148 AGCCAAAGAAAAAAGCAGGAAGG + Intronic
1008599746 6:53080289-53080311 AACAAAAAAAAAAACCAGGAAGG - Intronic
1008870219 6:56264241-56264263 AACCAAATCAAAATGCAAATGGG - Intronic
1008919728 6:56829500-56829522 AACTATATCAAAAGGCTGGAAGG + Intronic
1008967846 6:57331926-57331948 AACCAAAGCAAGCAGAAGGAAGG - Intronic
1009419827 6:63453581-63453603 AAACAAAAAAAAAAGCAGGGTGG - Intergenic
1009746015 6:67816913-67816935 AATAAAATTAAAAAGCAAGAAGG - Intergenic
1009842548 6:69094439-69094461 AACCAAATCAGAAAGTAGTTTGG - Intronic
1010381077 6:75225468-75225490 CAGAAAATCAAAAAGCAGGAAGG + Intergenic
1010985964 6:82424551-82424573 ATCCAAATCTTAAATCAGGAAGG - Intergenic
1011306235 6:85930569-85930591 AACCTAACCTAAAAGCAGAAAGG - Intergenic
1012215510 6:96578038-96578060 CACCAAATCTAAAAGCTGGGAGG - Intronic
1012237327 6:96834236-96834258 AACCAAATCCTAAAGCATGTTGG + Intronic
1012559708 6:100565549-100565571 CTCCAAATAAAAAAGCAGTAAGG - Intronic
1012585656 6:100919119-100919141 AAACAAATAAAAAACCATGAGGG - Intergenic
1012944730 6:105453132-105453154 AACCAAATCAAAAATTGAGAAGG - Intergenic
1013534306 6:111049696-111049718 ACCCAAAGCAAGCAGCAGGAAGG - Intergenic
1014059788 6:117058421-117058443 ACCCACATCAAAAAGTAGAAAGG - Intergenic
1014783856 6:125595848-125595870 GACCAAAACAAAATGCAGCAAGG - Intergenic
1014964524 6:127730493-127730515 AAAGAAATGAAAAAGAAGGAAGG + Intronic
1014982540 6:127961777-127961799 AACAAAAGCAAACAGAAGGAAGG - Intergenic
1015068754 6:129063454-129063476 AAACAAATCAAAGGGCATGACGG - Intronic
1016003801 6:139068595-139068617 AACCAACACATAAAGCATGATGG + Intergenic
1016318617 6:142818037-142818059 AACTAAATCTCAAAGGAGGAAGG + Intronic
1016672767 6:146728132-146728154 AAAAAAATCATAAAGCAAGAAGG - Intronic
1017578389 6:155832396-155832418 AAGCAAAGAAAAAAGGAGGAAGG - Intergenic
1017755528 6:157526073-157526095 AACCAAAACAAGAAACAGCAGGG + Intronic
1018797385 6:167196996-167197018 GCCCACATCAGAAAGCAGGAAGG - Intergenic
1019200312 6:170308368-170308390 AACCAAACAAAAAAACTGGAAGG - Intronic
1020790576 7:12623326-12623348 TACCAAATGAAACAGCTGGAGGG + Intronic
1023217076 7:37874140-37874162 AACCAAATCAAAAATATGGGAGG + Intronic
1023466609 7:40462752-40462774 TACCAAATGAAAATTCAGGAGGG - Intronic
1023909956 7:44546826-44546848 AACAAAATAGAAAAGCAGGCTGG + Intergenic
1024001564 7:45193104-45193126 AACCATATCAACAATCAGGATGG + Intergenic
1025902822 7:65760794-65760816 AACCAAAACAAAAAGCAAGTTGG - Intergenic
1025915838 7:65865259-65865281 AAACAAAAAAAAAAGAAGGAAGG - Intergenic
1026066695 7:67080692-67080714 AACCAAAACCAAAAGCAGCTGGG - Intronic
1026147102 7:67756749-67756771 AAACAAACCAAAAAACAGGCTGG + Intergenic
1026710220 7:72731646-72731668 AACCAAAACCAAAAGCAGCTGGG + Intronic
1027179052 7:75925007-75925029 AACCAAACCAAAAACCAGAGGGG + Intronic
1027234565 7:76290476-76290498 AAGAAAAGAAAAAAGCAGGAGGG - Intergenic
1027344481 7:77243210-77243232 AACAAAAACAAAAACCAGAACGG + Intronic
1027967777 7:85035541-85035563 AATAGAATCAAAAAGCAGAATGG + Intronic
1028179805 7:87705915-87705937 AAGAAAATGAAAAAGCAAGAAGG - Intronic
1028640254 7:93034458-93034480 ATCCTAAGGAAAAAGCAGGAGGG + Intergenic
1028930119 7:96403726-96403748 AAACAAAAACAAAAGCAGGAAGG + Intergenic
1029246591 7:99206456-99206478 AACCAAATAAAAAACCAGGCTGG - Intronic
1029371170 7:100151683-100151705 AAACAAACAAAAAAACAGGACGG - Intronic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1030431160 7:109451078-109451100 AACCAAATCCAAAATTAGTAGGG - Intergenic
1031308669 7:120165752-120165774 AACCAAATAAAAGAGCATCAAGG - Intergenic
1032176379 7:129631378-129631400 AAAAAAATTAAAAAGAAGGAAGG - Intronic
1032656791 7:133939100-133939122 AAGCAAAAGAAACAGCAGGAAGG + Intronic
1033003957 7:137539718-137539740 ACCCAAATCAAGCAGAAGGAAGG + Intronic
1033487553 7:141805802-141805824 AACCAAATCAAATAGCATGGGGG - Intergenic
1033822254 7:145148676-145148698 AAACAAACCAAAAAGCAGCCAGG + Intergenic
1033883752 7:145918694-145918716 AAGCAAATAAAAATGAAGGATGG + Intergenic
1035166899 7:156996066-156996088 AACAAAAGAAAAAAGAAGGAAGG - Intronic
1035848030 8:2886001-2886023 AAGCAAACCAAATGGCAGGAAGG - Intergenic
1035980140 8:4361225-4361247 AAGTTACTCAAAAAGCAGGAAGG + Intronic
1037169302 8:15872058-15872080 AACCTAAGCAAAAAGAAAGAAGG + Intergenic
1037383219 8:18310495-18310517 AATCAAATCACATAGCAGCACGG + Intergenic
1037476324 8:19261649-19261671 AAACAAAACAAAAAACAGAAAGG - Intergenic
1037638428 8:20721128-20721150 AACAAAAGCAGAAAGCAGGCTGG + Intergenic
1037638471 8:20721527-20721549 AGCAAAAGCAGAAAGCAGGATGG - Intergenic
1038137291 8:24801561-24801583 AACTAAATCCAAAAGAAGGAGGG + Intergenic
1038432141 8:27508938-27508960 AAAAAAAAAAAAAAGCAGGATGG - Intronic
1038503674 8:28065823-28065845 AACCAAATGATAAACCACGACGG + Intronic
1039689447 8:39848549-39848571 TACTAAATCAAAAAGCTGGGAGG - Intergenic
1041085303 8:54251218-54251240 CACCATAGCAAAAAGCAGAAGGG - Intergenic
1042179739 8:66075064-66075086 AAACAAACAAAAAAACAGGAAGG - Intronic
1042291665 8:67175406-67175428 AACAGAATAAAAATGCAGGAAGG + Exonic
1042683868 8:71416187-71416209 AAGCAAGGCAGAAAGCAGGAGGG - Intronic
1043827825 8:84950096-84950118 AACAAAATAAAAAAGTATGAAGG - Intergenic
1044315553 8:90746540-90746562 AAACAAATCCAAAAGCTGGCAGG - Intronic
1044482585 8:92709770-92709792 AGCCAAAGCAAAAAGCAGGTGGG + Intergenic
1044689133 8:94859408-94859430 AACTGAATAAAAAAACAGGACGG - Intronic
1044860819 8:96521902-96521924 AACCAAGAGAAAAATCAGGATGG + Intronic
1045143743 8:99315933-99315955 AACAAATTCAAAAAACTGGAAGG - Intronic
1045233855 8:100332163-100332185 AACCAAATCAGATATCAGTATGG - Intronic
1045640261 8:104242054-104242076 AACTATATCAAAAAGTAGGCTGG - Intronic
1046170912 8:110504394-110504416 AAAGAAAACAAAAAGCAGAATGG - Intergenic
1046581775 8:116102095-116102117 AAACAAGTCATAAAACAGGAAGG + Intergenic
1046867931 8:119171613-119171635 AACCAAATGAAGAAAAAGGAAGG + Intronic
1046929971 8:119832440-119832462 AACAAAACCAAAAGGAAGGAAGG + Intronic
1046987328 8:120402810-120402832 AACCCCATTAAAAAGCAGGCAGG + Intronic
1047169603 8:122479007-122479029 GGCCAAATCAGAATGCAGGATGG - Intergenic
1047935309 8:129770685-129770707 AATCAAATCACAAAGGAAGATGG + Intronic
1048017557 8:130511232-130511254 AGCTCAATCCAAAAGCAGGATGG - Intergenic
1048578460 8:135711156-135711178 AAGCAAAGCAAAAAGAGGGAAGG + Intergenic
1049263881 8:141654741-141654763 ACCCAAAGCAAACAGGAGGAAGG - Intergenic
1049640823 8:143714828-143714850 AAAAAAAGCAAAAAGCAAGATGG - Intergenic
1051051072 9:12931792-12931814 AATAAAATCAAAGTGCAGGAAGG + Intergenic
1052190800 9:25659116-25659138 AAAAAAAACAAAAAACAGGAGGG - Intergenic
1053167269 9:35853599-35853621 CACAAAAGCATAAAGCAGGACGG - Exonic
1053519019 9:38758547-38758569 AATCAAATAAATAAACAGGAAGG - Intergenic
1055482907 9:76727523-76727545 AAACAAAGAAAACAGCAGGATGG + Intronic
1055763784 9:79639072-79639094 AACCATATTAAAATGCAGAAGGG - Intronic
1055899185 9:81214712-81214734 AGCCAAATGAAACAGAAGGAAGG - Intergenic
1056009511 9:82312405-82312427 AACCAAAACAAAAAGCCAGCAGG + Intergenic
1056293991 9:85173207-85173229 CACCAACTCTAAAGGCAGGAGGG - Intergenic
1057257266 9:93559679-93559701 AAGCAAATCAAGAAGCAGAGAGG - Intronic
1057534927 9:95892049-95892071 AACCAAATAAAAAAACAGATTGG - Intronic
1058561845 9:106238369-106238391 ATCCAAACTAAAAAGCAGGGAGG - Intergenic
1059083618 9:111276023-111276045 AAACAAAACAAAAAACAGCATGG - Intergenic
1059768872 9:117409370-117409392 AACCAAACCAGAAAGCAATAAGG + Intronic
1060294177 9:122332154-122332176 AACAAAAACAAAAAGAAAGAAGG + Intergenic
1060884042 9:127138065-127138087 AACCATGTCAGAAGGCAGGAGGG + Intronic
1060975880 9:127764685-127764707 AACAACAACAAAGAGCAGGAGGG - Intronic
1061104224 9:128516613-128516635 AACAAAAACAAAAAACAGGCCGG - Intronic
1061114690 9:128602182-128602204 AAACAAAAAAAAAAACAGGAGGG - Intronic
1061278886 9:129585762-129585784 AACGAAAAAAAAAAGCAGGAGGG - Intergenic
1062157315 9:135060223-135060245 AAACAAACCAAAAAGGAGCAAGG + Intergenic
1062635834 9:137490880-137490902 AACCACATCATAAAGGGGGAAGG + Intronic
1185510624 X:661623-661645 AAACAAAACAAAAAGCAAAAAGG + Intergenic
1185548083 X:961838-961860 AAGAAAATAAAAAAGCAGGCTGG - Intergenic
1186546064 X:10451092-10451114 CACTAAATCCAAAAGAAGGATGG + Intronic
1187386817 X:18856629-18856651 AAGGAAATGAAAAAGCAGAAGGG - Intergenic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1189077191 X:37928691-37928713 GACAAAATCAAAAGGCACGAGGG - Intronic
1189093549 X:38113589-38113611 AACCATATCCAAAAGTAGTAGGG - Intronic
1189114529 X:38329175-38329197 AACATAAGCAAATAGCAGGAGGG + Intronic
1189287107 X:39859413-39859435 AATAAAATAAAAAAGAAGGAAGG + Intergenic
1189575371 X:42346455-42346477 AAACAAATAGAAAAGCAGCAAGG - Intergenic
1189577786 X:42373755-42373777 AAGAAAAAAAAAAAGCAGGATGG + Intergenic
1190599701 X:52077826-52077848 AACCAAATGGAAAAGATGGATGG + Intergenic
1191016162 X:55812177-55812199 AATAAAATGAAAGAGCAGGAGGG - Intergenic
1191155134 X:57265845-57265867 AACCACGTAAAAAAGCAGTATGG - Intergenic
1192588677 X:72341245-72341267 AATCTAATCTAAAACCAGGAAGG - Intronic
1192596694 X:72416564-72416586 AACCAAAGCAAGTAGAAGGAAGG - Intronic
1193045144 X:77045918-77045940 AAACAAATCAGAAAGAAAGAAGG + Intergenic
1193141529 X:78032817-78032839 ACCCAAATCAAACAGCAGAGAGG + Intronic
1194471264 X:94300781-94300803 AAGGAAATAAAAAAGCAGCAAGG - Intergenic
1194619745 X:96156205-96156227 AAACAATTCATAGAGCAGGAAGG - Intergenic
1196969220 X:121090585-121090607 AACCACAGGAAAAAGCAGGTTGG - Intergenic
1197982629 X:132233578-132233600 TTCCAAATTAAAAAGGAGGAAGG - Intergenic
1198373172 X:136011565-136011587 ACCCAAAACAAAAAGCCAGAAGG + Intronic
1198740579 X:139837918-139837940 AACAAAAACAAAAAGGAGAAGGG + Intronic
1199087851 X:143649649-143649671 AACTAACTCAAAAAGGAGGAAGG - Intergenic
1200875868 Y:8154230-8154252 AATCAAAACAAAAAGCACTAAGG + Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic