ID: 930634703

View in Genome Browser
Species Human (GRCh38)
Location 2:53791444-53791466
Sequence GGATTCTGATTGTATAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930634703 Original CRISPR GGATTCTGATTGTATAAAAC AGG (reversed) Intronic
900858121 1:5202493-5202515 GGATTATGAGTGTATAAACCAGG - Intergenic
905488347 1:38323786-38323808 GCATTCCAATTGTATAAAACAGG + Intergenic
911550484 1:99273269-99273291 GGTTTCTGCCTGTGTAAAACTGG + Intronic
912201477 1:107462856-107462878 GGCTTCTGCATCTATAAAACAGG - Intronic
913957667 1:143319460-143319482 GGATTCTGGTTATAAAACACTGG - Intergenic
914051977 1:144144824-144144846 GGATTCTGGTTATAAAACACTGG - Intergenic
914127220 1:144821717-144821739 GGATTCTGGTTATAAAACACTGG + Intergenic
918151943 1:181804836-181804858 GGATTCAGATTCCATTAAACAGG - Intronic
918569193 1:185967842-185967864 TGATTCTGATTGAATAAAGTAGG + Intronic
919495113 1:198255404-198255426 TGATTCTGAGTGTGGAAAACAGG + Intronic
920956724 1:210626382-210626404 GAACTCTGATTCTATAAAAGTGG + Intronic
923240721 1:232082921-232082943 TGATTCTTATTTTTTAAAACTGG - Intergenic
923845328 1:237724334-237724356 GGGTTCAGATAATATAAAACAGG - Intronic
924027900 1:239856391-239856413 GAAATCTGATTGTTTAAAAGTGG + Intronic
1063999489 10:11651675-11651697 GGACTCTGATTGGAGAAAAAAGG + Intergenic
1065738596 10:28776110-28776132 GGATTCTGATTCAGTAAATCTGG + Intergenic
1066760005 10:38741123-38741145 GGATTCTGGTTATAAAACACTGG + Intergenic
1066961612 10:42231645-42231667 GGATTCTGGTTATAAAACACTGG - Intergenic
1068037573 10:51780110-51780132 GTAATCTGATTCTATAAAATAGG + Intronic
1070261973 10:74865486-74865508 TAATACAGATTGTATAAAACTGG - Intronic
1071110241 10:82147236-82147258 AGATTCTGCATCTATAAAACAGG - Intronic
1071787841 10:88922376-88922398 GGTTTCTGCTTGTAAAAAAAAGG + Exonic
1074493858 10:113961617-113961639 GGAGTCCTCTTGTATAAAACTGG + Intergenic
1074652808 10:115543753-115543775 GGATTCTTAATGTAAAAAAATGG - Intronic
1078648307 11:13163384-13163406 AGATTCTGATTGAATTGAACTGG - Intergenic
1080035255 11:27702767-27702789 GGATTCTTCTTTTATAAAACGGG - Intronic
1080453500 11:32398052-32398074 GGATTCTGATTGTATTCGTCAGG + Intronic
1080752577 11:35164607-35164629 AGTTTTTGATTGTATAAATCTGG + Intronic
1080793186 11:35539323-35539345 GGATTCTGAGTGAAGAAACCTGG + Intergenic
1081096373 11:38941349-38941371 TCATACTCATTGTATAAAACAGG + Intergenic
1082177356 11:49076372-49076394 GGTTTCAGAATTTATAAAACAGG - Intergenic
1082267692 11:50137405-50137427 GGATCCTGAGTATATGAAACTGG - Intergenic
1082288397 11:50341155-50341177 GGATCCTGAGTATATGAAACTGG + Intergenic
1084056439 11:66637065-66637087 GGAATCTGACTGCAGAAAACTGG - Intronic
1086760043 11:90617985-90618007 GGATTCTGATTGTTTTCAATTGG + Intergenic
1090908407 11:131097033-131097055 GGCTCCTGATTGTATAAGCCAGG - Intergenic
1091075305 11:132610129-132610151 GGAATGTTATTTTATAAAACTGG - Intronic
1091866625 12:3842707-3842729 AGATTCTGAATGAAGAAAACCGG - Intronic
1092927876 12:13288562-13288584 AGATTCTCATTGTAGAAAACAGG - Intergenic
1093846378 12:23976960-23976982 GGATTCTGATTCTACAAGATGGG + Intergenic
1094131898 12:27083397-27083419 GGATGATCATTGTATAAAATTGG + Intergenic
1096879449 12:54655590-54655612 GGACTATGAATGCATAAAACAGG - Intergenic
1097576402 12:61398853-61398875 TGAGTCTGACTTTATAAAACAGG + Intergenic
1097719909 12:63009309-63009331 GGATTCTGATACCAGAAAACAGG - Intergenic
1098516595 12:71384339-71384361 CTAGTCTGATAGTATAAAACTGG - Intronic
1098958021 12:76707605-76707627 GGATTATAAATGTATAAAATCGG - Intergenic
1101600133 12:106202209-106202231 GGATGCTCATTGTAAACAACTGG - Intergenic
1103086677 12:118066854-118066876 AGGTTCTGAATGTAGAAAACAGG - Intronic
1106161628 13:27205945-27205967 AGATTCTGATTCAATTAAACTGG + Intergenic
1107190177 13:37573207-37573229 GGAATCTGATTTTTAAAAACAGG + Intronic
1110773590 13:79379181-79379203 GAATTCAGATTTTATAAAAGTGG + Intronic
1111788748 13:92825791-92825813 GTATTCTGATTATATATAAATGG + Intronic
1113303793 13:109053834-109053856 GTATTGTGTTTGTAGAAAACGGG + Intronic
1113629312 13:111870714-111870736 GGATTCTGAGGGTAAAAAATTGG - Intergenic
1114734960 14:25034652-25034674 GGTTTCTGACTCTGTAAAACAGG + Intronic
1117373502 14:55100181-55100203 GGATTCTTATTTTATTCAACGGG - Intergenic
1117863838 14:60123729-60123751 GCATTCTGATGTTATAAATCTGG + Intronic
1121630725 14:95420111-95420133 AGACACTGATTTTATAAAACAGG + Intronic
1202930714 14_KI270725v1_random:30630-30652 GGATTCTGGTTATAAAACACTGG + Intergenic
1123421642 15:20140782-20140804 GGATTCTGGTTATAAAACACTGG - Intergenic
1123530868 15:21147322-21147344 GGATTCTGGTTATAAAACACTGG - Intergenic
1124992586 15:34690710-34690732 GGTTTCCGTTTGTATAAAATGGG + Intergenic
1126797845 15:52274831-52274853 GGATTTTGATTTGAGAAAACAGG + Intronic
1128274048 15:66337629-66337651 GGATCTTAATTGTATAAAAATGG - Intronic
1128595276 15:68940480-68940502 GAATTCTGATTCTATCAAACTGG - Intronic
1129102442 15:73278766-73278788 AGTTTCTGAATGTATTAAACGGG - Intronic
1130723831 15:86418040-86418062 GGAATCTAATTGGATGAAACTGG - Intronic
1131158202 15:90087918-90087940 GGCTTCTGATTGGATAAGCCAGG - Intronic
1131739459 15:95371945-95371967 GGATTCTGATTGAAAACCACAGG - Intergenic
1132344844 15:101101986-101102008 GCATTCTGATAGGATAAAAATGG + Intergenic
1134908261 16:18000692-18000714 GGTTTCTGATTCTATACATCTGG - Intergenic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136722800 16:32338153-32338175 GGATTCTGGTTATAAAACACTGG - Intergenic
1136841123 16:33544152-33544174 GGATTCTGGTTATAAAACACTGG - Intergenic
1136863194 16:33714855-33714877 GGATTCTGGTTATAAAACACTGG + Intergenic
1140472104 16:75221664-75221686 GGTTTCTTATTTAATAAAACTGG - Intronic
1203003631 16_KI270728v1_random:179611-179633 GGATTCTGGTTATAAAACACTGG + Intergenic
1203124686 16_KI270728v1_random:1563008-1563030 GGATTCTGGTTATAAAACACTGG + Intergenic
1203135239 16_KI270728v1_random:1716018-1716040 GGATTCTGGTTATAAAACACTGG + Intergenic
1203151288 16_KI270728v1_random:1844449-1844471 GGATTCTGGTTATAAAACACTGG - Intergenic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1147293179 17:39460323-39460345 GGATTCCTTTTCTATAAAACAGG + Intergenic
1148883609 17:50754180-50754202 GCAATCTGATTGATTAAAACTGG - Exonic
1149277501 17:55059704-55059726 AGATTCTGATTCTATAGATCTGG - Intronic
1149853803 17:60060556-60060578 GCATTCTGCTTGAATAAACCAGG - Intronic
1150158836 17:62876585-62876607 GGATTCTGTTTGAATAAAAAAGG - Intergenic
1152651881 17:81498763-81498785 AGATTCTGCTTGTATGCAACAGG - Intergenic
1153993523 18:10420468-10420490 GGATTCTCATGGTCTAAAAAGGG + Intergenic
1155465451 18:26129976-26129998 GGATTGAGATTATTTAAAACTGG + Intergenic
1158841439 18:61392360-61392382 AGATACTGATTGTATATAAAAGG - Intronic
1159747389 18:72254808-72254830 GGGCTCTGGTTGTAAAAAACTGG + Intergenic
1165048418 19:33124859-33124881 GGATACTGATTGGATCACACAGG + Intronic
1166895559 19:46019900-46019922 TGATTCTGTCTATATAAAACGGG - Intronic
1166906253 19:46110592-46110614 GGATTCTCTGTGTATAAAACTGG - Intergenic
1202691376 1_KI270712v1_random:97248-97270 GGATTCTGGTTATAAAACACTGG - Intergenic
929182548 2:39058600-39058622 ATATTCTTATTGTATAAAAATGG + Intronic
929956144 2:46460188-46460210 GGTTTCTGCTTCTGTAAAACGGG - Intronic
930061810 2:47295960-47295982 TGACTCTGAGAGTATAAAACTGG + Intergenic
930321987 2:49866903-49866925 GGATTCTGATTATTTATAAAAGG + Intergenic
930634703 2:53791444-53791466 GGATTCTGATTGTATAAAACAGG - Intronic
930933687 2:56920192-56920214 TGATTCTAAATGTCTAAAACTGG - Intergenic
934239205 2:90252916-90252938 GGATTCTGGTTATAAAACACTGG + Intergenic
934273980 2:91563782-91563804 GGATTCTGGTTATAAAACACTGG - Intergenic
934323323 2:91985464-91985486 GGATTCTGGTTATAAAACACTGG + Intergenic
934461646 2:94216270-94216292 GGATTCTGGTTATAAAACACTGG + Intergenic
937742232 2:125368843-125368865 GAAATCTGATGGTTTAAAACTGG - Intergenic
939447163 2:142324865-142324887 GGACTCTGATTCTACAAGACTGG - Intergenic
940063169 2:149595365-149595387 AGATTCTGATTCTATATATCTGG - Intergenic
940827284 2:158427396-158427418 TGTTTATAATTGTATAAAACTGG - Intronic
943818406 2:192285696-192285718 GAATTTTAATTGTATACAACTGG - Intergenic
943829210 2:192437577-192437599 GGATTCTGATTTAATAATGCAGG - Intergenic
944857327 2:203780559-203780581 TGATCCTGATGGAATAAAACTGG - Intergenic
1175550628 20:59814924-59814946 GGCTTCTGTTTGGATCAAACAGG + Intronic
1175763273 20:61575558-61575580 GGATCATGATTCTATAGAACAGG + Intronic
1176592735 21:8659253-8659275 GGATTCTGGTTATAAAACACTGG + Intergenic
1177904433 21:26958537-26958559 GGATAGAGATTGTATAAAATGGG - Intronic
1180235184 21:46454745-46454767 GAATCCTGATTTTTTAAAACTGG + Intergenic
1180275588 22:10636395-10636417 GGATTCTGGTTATAAAACACTGG + Intergenic
1180550066 22:16531335-16531357 GGATTCTGGTTATAAAACACTGG + Intergenic
1183755776 22:39762848-39762870 AGATTCTGAATGTATAAGATAGG - Intronic
951061884 3:18218344-18218366 GGATACTCTTTATATAAAACAGG - Intronic
952386360 3:32844190-32844212 AGATTCTGATTCTCTAAAACTGG + Intronic
952747434 3:36794508-36794530 GGAGTGGGACTGTATAAAACTGG - Intergenic
955357297 3:58241659-58241681 GGATTCTGAGAGTATAAAGATGG + Intronic
956239614 3:67115141-67115163 GAAATCTGATTGTTTAAAAATGG + Intergenic
956909421 3:73802247-73802269 GGATCCTGAGTATATGAAACTGG - Intergenic
958971997 3:100621755-100621777 AGATTTTCAGTGTATAAAACAGG + Intronic
962026309 3:131551417-131551439 GAATTCTAAGAGTATAAAACAGG + Intronic
963080122 3:141383997-141384019 GTTTTCTGAAAGTATAAAACAGG + Intronic
963439323 3:145316842-145316864 GAAATCTGATTGTAAAAAATGGG - Intergenic
963490697 3:145996535-145996557 GGATTCTGATTCAATAGACCTGG - Intergenic
963777446 3:149453299-149453321 GAAATCTGATTGTTTAAAAGTGG - Intergenic
965840719 3:172902350-172902372 GGATTTTAATTGTATATAATGGG + Intronic
967332371 3:188303787-188303809 AGATTCTGATTTTGTAAGACAGG + Intronic
969976357 4:11106005-11106027 GTTTTCTGATTGCATAATACAGG + Intergenic
974618633 4:64325469-64325491 TGATTAGGATTGTATAAGACTGG - Intronic
975606532 4:76160248-76160270 GGATTTTTTTTGTTTAAAACTGG - Exonic
978441198 4:108735862-108735884 GGATTCTGAATTTTTAAAAAAGG + Intergenic
978560474 4:110028646-110028668 ACAGTCTGATTGTATAAAACCGG + Intergenic
978827625 4:113043877-113043899 GGATTGTGATTCTATAGATCTGG + Intronic
979737781 4:124109125-124109147 GAACACTGATTGTATAATACTGG + Intergenic
979855124 4:125622802-125622824 AGATTCTGATGGAATAGAACTGG + Intergenic
980721327 4:136699202-136699224 GGACTCTGATTGTAGATAACAGG + Intergenic
980772483 4:137394937-137394959 AGATTTTCATTTTATAAAACGGG + Intergenic
981254530 4:142645956-142645978 TCTTTCTGATTGTATAACACAGG - Intronic
981304231 4:143229159-143229181 TGATTCTGTTTCTATAAAACAGG + Intergenic
981471148 4:145137216-145137238 AGATTCTGAATGAAGAAAACTGG + Exonic
982345033 4:154348048-154348070 GCTTTCTGATTTTATAAAGCTGG + Intronic
984966834 4:185146708-185146730 TGACCCTGATTTTATAAAACTGG + Intronic
987057517 5:14208939-14208961 GGATTGTGATGTTGTAAAACTGG + Intronic
987071804 5:14344300-14344322 GCATACTGATTTTAAAAAACAGG + Intronic
989251065 5:39316240-39316262 TGATTCTTAGTCTATAAAACAGG + Intronic
989791256 5:45404310-45404332 GGATTCAGATTATATGAAACTGG - Intronic
992984799 5:82217108-82217130 GTATTCTGCTTCTATAAAACAGG - Intronic
993221562 5:85104783-85104805 AGATTCTGATGGTTTACAACAGG + Intergenic
995732321 5:115259085-115259107 AGATTCTGATTGCATAAGCCTGG - Intronic
996377452 5:122827872-122827894 GGTTTCTGATGGCCTAAAACTGG - Intronic
996395822 5:123012865-123012887 GGATTCTGAATCAATAAATCTGG + Intronic
996548719 5:124708051-124708073 AGTTTCTGCTTCTATAAAACAGG - Intronic
998013863 5:138716864-138716886 GGAATCTGCTTGTAAAAGACAGG - Intronic
999364330 5:151011994-151012016 GGATTCAGAGTGAATAAGACAGG - Intergenic
999524421 5:152388105-152388127 GAATTCTGATTTATTAAAACTGG + Intergenic
999901833 5:156093876-156093898 CTTTTCTGATTGAATAAAACAGG + Intronic
1000152230 5:158514678-158514700 GCATTCTGAATGCATTAAACTGG - Intergenic
1000627087 5:163551095-163551117 GGATACTCATTGTAGAAAACAGG + Intergenic
1001145947 5:169184825-169184847 GGATTCTGATTGTGTAAGTCTGG - Intronic
1003141699 6:3477338-3477360 GGATTCTGATTCTGTAAGTCTGG - Intergenic
1004026645 6:11825772-11825794 GGATTCTGATTGTAATGAACAGG - Intergenic
1004450948 6:15745850-15745872 AGATTCTGATTCTGTAGAACTGG + Intergenic
1007201992 6:40117284-40117306 GGATTCAGATTATAACAAACTGG - Intergenic
1010798288 6:80143841-80143863 GGATTCTTATTCTGTAATACTGG + Intronic
1011524532 6:88249248-88249270 GGATTCTGATTGCATCATAAAGG + Intergenic
1012385939 6:98683054-98683076 GGATTCTGGTTTCATAAAACTGG + Intergenic
1014269057 6:119315377-119315399 GAATTCTCATTTTTTAAAACTGG - Intronic
1014522108 6:122457246-122457268 TGATTCTGATCCTAGAAAACTGG - Intronic
1015018729 6:128445967-128445989 GGATTCTAATTGAAGAAAACTGG - Intronic
1016718406 6:147262842-147262864 AGATACTGATTATATGAAACTGG - Intronic
1017156949 6:151331014-151331036 GGAGACTGATTTTATAAATCGGG + Intronic
1020583783 7:10038821-10038843 TGATTATTATTGTATAAACCAGG - Intergenic
1020886764 7:13828053-13828075 TGTTTCTGACTGTACAAAACTGG - Intergenic
1022146364 7:27546015-27546037 TGAGTCTCAGTGTATAAAACAGG + Intronic
1024389166 7:48787274-48787296 GGCTTCTGATGGCATAAAGCTGG - Intergenic
1032632287 7:133666796-133666818 GGATCTTGATTGTATACTACTGG - Intronic
1033629085 7:143139606-143139628 GGATTTCAATAGTATAAAACCGG - Exonic
1038503740 8:28066786-28066808 GGATTCTGCTGGCATAAAAGAGG - Intronic
1038709455 8:29928174-29928196 AGATTCTGCTTGTATATAAGGGG - Intergenic
1039539337 8:38350657-38350679 AGATTCTAATTGAATAAATCTGG + Intronic
1039916442 8:41863884-41863906 GGGTTCTTATTCTATGAAACAGG + Intronic
1040842626 8:51800891-51800913 GAAATCTGATTGTAAAACACGGG + Intronic
1042520435 8:69706000-69706022 GCATTATAATTGTAAAAAACTGG + Intronic
1042531262 8:69818410-69818432 AGATTCTGTTTCTATAAACCTGG - Intronic
1043031004 8:75133434-75133456 AGATTCTGATTCTGTAAATCTGG + Intergenic
1043860597 8:85311867-85311889 GCATTCTGATTTTATAATTCTGG + Intergenic
1043913397 8:85891232-85891254 GGACTCTGCTTGTTTAAAAAAGG + Intergenic
1044625335 8:94231030-94231052 GGATGCTGAATGAATAAAACAGG + Intergenic
1046259114 8:111742878-111742900 GGACTCTGATTCTATAGATCTGG - Intergenic
1047056728 8:121173387-121173409 GAATTCTGTTGATATAAAACAGG + Intergenic
1050916280 9:11138030-11138052 GTTTTCTGATTGTAGAAAAGTGG - Intergenic
1051485548 9:17604320-17604342 TGTTTCTGAATGTATAAAATGGG + Intronic
1051719918 9:20026224-20026246 TGGTGCTGATTGTAGAAAACTGG + Intergenic
1053692119 9:40591922-40591944 GGATTCTGGTTATAAAACACTGG + Intergenic
1054272681 9:63045563-63045585 GGATTCTGGTTATAAAACACTGG - Intergenic
1054303377 9:63392888-63392910 GGATTCTGGTTATAAAACACTGG + Intergenic
1054402157 9:64719398-64719420 GGATTCTGGTTATAAAACACTGG + Intergenic
1054435762 9:65203713-65203735 GGATTCTGGTTATAAAACACTGG + Intergenic
1054494631 9:65817974-65817996 GGATTCTGGTTATAAAACACTGG - Intergenic
1056120989 9:83488551-83488573 GGCATCTGATTTTTTAAAACGGG - Intronic
1057685151 9:97226372-97226394 AGATGCTGGTTGTACAAAACTGG + Intergenic
1203622780 Un_KI270749v1:138059-138081 GGATTCTGGTTATAAAACACTGG + Intergenic
1187212297 X:17243475-17243497 GGATTCTGATTCTATAGATTTGG + Intergenic
1187402652 X:18975296-18975318 GGGATCTGATGGTATAAAAAGGG + Intronic
1187565426 X:20444823-20444845 AGATTCTGATTTTATTGAACTGG - Intergenic
1188481054 X:30637378-30637400 GGATTCTGACTCTAAAAGACTGG + Intergenic
1190545711 X:51524226-51524248 GGATTCTGATTTTATTAATTGGG - Intergenic
1194856594 X:98937040-98937062 AGTTTCTAATTGTATTAAACAGG + Intergenic
1196071034 X:111522303-111522325 AGATTCATATTGTATAAAAATGG + Intergenic
1196881565 X:120203085-120203107 GCGTTCTTATTATATAAAACAGG + Intergenic
1199112357 X:143949735-143949757 GGATTCTGATAGTATATATCTGG + Intergenic
1201190738 Y:11440452-11440474 GGATTCTGGTTATAAAACACTGG + Intergenic