ID: 930641769

View in Genome Browser
Species Human (GRCh38)
Location 2:53860208-53860230
Sequence CAGAGCAAGGTGGAGTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 287}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930641764_930641769 -8 Left 930641764 2:53860193-53860215 CCAAAACCTGAAACGCAGAGCAA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG 0: 1
1: 0
2: 2
3: 23
4: 287
930641763_930641769 2 Left 930641763 2:53860183-53860205 CCTGAAATAGCCAAAACCTGAAA 0: 1
1: 0
2: 4
3: 30
4: 321
Right 930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG 0: 1
1: 0
2: 2
3: 23
4: 287
930641762_930641769 3 Left 930641762 2:53860182-53860204 CCCTGAAATAGCCAAAACCTGAA 0: 1
1: 1
2: 3
3: 23
4: 224
Right 930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG 0: 1
1: 0
2: 2
3: 23
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930641769 Original CRISPR CAGAGCAAGGTGGAGTGGTA AGG Intergenic
900604990 1:3519893-3519915 CAGAGCCAGGTGGGGAGGCAGGG + Intronic
900619122 1:3578900-3578922 CAGCGCAACGTGGAGTGGGCAGG + Intronic
901233142 1:7652307-7652329 CAGAGCAAGCAGGAGAGGAAGGG - Intronic
902083353 1:13836969-13836991 CAGGGGAAGGTGGGGTGGGAGGG - Intergenic
902228423 1:15011856-15011878 AAGAGGAAGGAGGAGTGGGAAGG + Intronic
903382758 1:22908358-22908380 CAGAGCCATGTGGAGTGACAGGG + Intronic
905261475 1:36722107-36722129 CAGAGGAGGGTGGCGTGGGATGG + Intergenic
906564339 1:46787562-46787584 CAGAAAAAGGTGGTGTGGTGGGG - Intronic
907386326 1:54127934-54127956 CAGAGCAGGGTGAAGAGGAACGG - Intergenic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
907819530 1:57953622-57953644 CAGAGCAAGGTGGAGAAGAATGG - Intronic
908221534 1:62011814-62011836 AAGAGAAAGGTGCAGTTGTATGG + Intronic
908398306 1:63746396-63746418 CAGAACAAGGTGGCGTGGGCTGG + Intergenic
910225420 1:84931171-84931193 CACAGCAGGGTGGATTGGTTTGG - Intronic
910241815 1:85094928-85094950 GAGAGCACTGGGGAGTGGTAGGG + Intronic
912162894 1:107007711-107007733 CCCAGCAAGATGGAGTGGGATGG - Intergenic
912540534 1:110411540-110411562 CAGAGAAAGCGGGGGTGGTAAGG - Intergenic
913117732 1:115712304-115712326 CAGAGAAAGAGGGTGTGGTAAGG - Intronic
913356427 1:117927981-117928003 CAGAGCAACTGTGAGTGGTAAGG - Intronic
916831877 1:168501483-168501505 CAGAGAAAGTTCGAGTGGTCTGG - Intergenic
917594533 1:176515756-176515778 GAAAGGAAGATGGAGTGGTAAGG - Intronic
917609276 1:176669830-176669852 CAGAGCAAGCTAGAGGGGAAGGG + Intronic
918978629 1:191525509-191525531 CAGAACACGGAGGACTGGTAAGG + Intergenic
919734455 1:200937025-200937047 CAGAGCAGAGTGCAGTGGGACGG + Intergenic
920870519 1:209790581-209790603 CAGTGCAAGGTGTACTGGTCTGG - Exonic
921525247 1:216209428-216209450 CAGAGCAAAGTGGAAAAGTAGGG + Intronic
922816144 1:228450773-228450795 CAGAGAAAGGTGGGCTGGAATGG + Intergenic
923519273 1:234723377-234723399 CAGAGCAGGGTGGGGTGGAGGGG + Intergenic
923554581 1:234990692-234990714 CAGAGCAATGGAGAGTGTTATGG - Intergenic
924511615 1:244732700-244732722 CAGAGCAAGGTGGAAGGGCCAGG - Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1063484096 10:6403029-6403051 TAGAGCAAGGTAGAGAGGAAGGG - Intergenic
1064894754 10:20222703-20222725 CAGAGCCAGGTGTGGTGGCATGG + Intronic
1066658454 10:37716987-37717009 CTGGGCCAGGTGGAGTGGCAAGG - Intergenic
1069596661 10:69676355-69676377 GAGAGCAAGGTGGAGTGGGAAGG + Intergenic
1070191166 10:74113083-74113105 CAGAGCACCCTGCAGTGGTATGG + Intronic
1071279423 10:84086785-84086807 CAGAGCAGGGTCAAGTGGAATGG - Intergenic
1071286123 10:84147377-84147399 CTGAGCTGGGTGTAGTGGTATGG - Intronic
1071712574 10:88064104-88064126 CAGGGCAGGGTGGGGTGGGATGG - Intergenic
1072472914 10:95731211-95731233 CAGAGCAGGGTGGAGGAGAATGG - Intronic
1072948896 10:99835467-99835489 GAGGGCAAGGGGGAGTGGAATGG - Intronic
1073463833 10:103682211-103682233 CAGAGCAAGGCGGAGCGGGGAGG - Intronic
1073679851 10:105691034-105691056 GAGGTCAAGGTGGAGTGGGATGG - Intergenic
1074464113 10:113666831-113666853 CAGAGCAATGTGGGGTGGTGTGG - Intergenic
1075651336 10:124129757-124129779 CTGAGCAGGGTGTAGGGGTAAGG - Intergenic
1077645776 11:3922648-3922670 CCGAGCAAGCTGGAATGGAAAGG - Intronic
1078472446 11:11602347-11602369 CAGAGCATGGTTGAGTGGTCTGG - Intronic
1078866031 11:15298105-15298127 CAGAGAGAGGTAGAGTAGTAAGG - Intergenic
1079281537 11:19091086-19091108 AAGAGCTAGGTGGAGTGGAGTGG - Intergenic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1080414634 11:32057916-32057938 CAGAGCAGGGTGGAGAAGTGGGG - Intronic
1080622263 11:33996711-33996733 CAGAGCAAAGTGCAGAGGTGGGG - Intergenic
1081699262 11:45142516-45142538 CATGGAAAGGTGGAGAGGTATGG - Intronic
1081704344 11:45172184-45172206 CAGGGCAAGGTGTAGAGGAAGGG + Intronic
1082774937 11:57237499-57237521 CAGAGGAAAGTGGAGGGATAGGG - Intergenic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1084004463 11:66315691-66315713 GAGAGCACTGAGGAGTGGTAGGG + Exonic
1084009058 11:66337725-66337747 CAGTGCCAGATGGAGTGGGAGGG + Exonic
1085701323 11:78748477-78748499 CAGGGCCAGGTGGGGTGCTAGGG + Intronic
1085830052 11:79890285-79890307 TATAGCAAGGTGGAGTTGTATGG - Intergenic
1085966322 11:81531988-81532010 CAGACAGAGGTGTAGTGGTAGGG + Intergenic
1088621810 11:111692482-111692504 CAGAGCGAATTGGAGTGGTAAGG + Intronic
1089008732 11:115114659-115114681 TGGAGCAGGGTGGAGTGGGAAGG - Intergenic
1089493085 11:118895658-118895680 CGGAGAAAGGTGGACTGGAAGGG + Exonic
1093800651 12:23367733-23367755 CAGAGCAGGGTGGACAGGAATGG + Intergenic
1094557682 12:31518058-31518080 CAGTGCAAAGTGGAGAGGCAGGG + Intronic
1095855810 12:46860019-46860041 CACACGAAGGTGGTGTGGTAGGG - Intergenic
1096192793 12:49631285-49631307 CAGAGCAGGGTGGAGGGTTGGGG + Intronic
1096618144 12:52846252-52846274 CTGAGCAAGATGGAGTTGGAGGG - Exonic
1096973802 12:55686986-55687008 CAGAGGAAGGTGGGGTAGTAGGG - Intronic
1097036495 12:56128139-56128161 CAGACCAAGGTGGAGTTAAAAGG - Intronic
1100151680 12:91745296-91745318 CAGCTCAAGCTGGAATGGTATGG - Intergenic
1100660476 12:96692873-96692895 CAAAGGAAGATGGAGTGGAAGGG - Intronic
1102012690 12:109628448-109628470 CAGAGCAAGGGAGAGTGGCTGGG + Intergenic
1102506126 12:113385488-113385510 CAGAGCAGGGTGGTGTGGGGTGG + Intronic
1104647645 12:130508621-130508643 CAAAGCATGGTGGTGTGGGAGGG - Intronic
1105433698 13:20359753-20359775 CTGACCAAGGTGGGGTGGTGGGG - Intergenic
1106400569 13:29426078-29426100 CAGAGCCAGGTGGGGTGGGAAGG - Intronic
1109468915 13:62779042-62779064 CAGAGCAAGCTGGGGGGGAAGGG + Intergenic
1109825114 13:67708967-67708989 CAGAGAAAGGTGGAAGGCTATGG + Intergenic
1110620137 13:77585777-77585799 CTCAGCAAGGTGGAGTGGAAGGG - Intronic
1111378962 13:87420535-87420557 CAGAACAAGGTGTATTGGGATGG + Intergenic
1112009148 13:95279601-95279623 GAGAGGAAGATGGAGTGGAAAGG + Intronic
1113436582 13:110296936-110296958 CAGAGCAAGGTGTAGGGGAAGGG + Intronic
1113564139 13:111308486-111308508 TAGAGCAGCGTGGAGTGGAAGGG - Intergenic
1115697742 14:35918945-35918967 CAGAGCAAGGTGGAGAGGATTGG - Intronic
1116318996 14:43435635-43435657 GAGAGAAAGGGGAAGTGGTAGGG + Intergenic
1118510516 14:66466638-66466660 CACAAAAAGGTGGTGTGGTAGGG + Intergenic
1119174240 14:72557504-72557526 AAGAGCCAGGTGGAAAGGTAGGG - Intronic
1119424066 14:74524573-74524595 CAGAGCAAGGTGGATTTGCCAGG + Intronic
1120977389 14:90261111-90261133 ATGAGCAAGGGGGAGTGGCAGGG - Intronic
1121676197 14:95754912-95754934 CAGGGCATGGTGGGGTGGGATGG + Intergenic
1122782895 14:104151045-104151067 CAGAGCCTGGTGGGGTGGTGAGG + Intronic
1123951948 15:25287815-25287837 ATCAGCAAGGTGGAGTGGTTGGG + Intergenic
1124393624 15:29281829-29281851 CAGAGACAGGTGGAGTGGGTTGG - Intronic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1125281355 15:38045223-38045245 CAGAGCAGGGTGGAGAAGGATGG - Intergenic
1125464278 15:39934871-39934893 TAGAGGAAGGTGCAGAGGTATGG - Intronic
1125798226 15:42420252-42420274 CTGGGCAAGATGGAGTGGGATGG - Intronic
1126097699 15:45100902-45100924 CAGAGCATGGGGTAGAGGTAGGG + Intronic
1126379681 15:48033462-48033484 CAGAGCACAGAGGAGTTGTAGGG + Intergenic
1126580191 15:50235842-50235864 CAGAGCAAGGGGTAGGGGTGGGG - Intronic
1127442704 15:59026905-59026927 GAGAGCAAGGGGGGGTGGTTTGG - Intronic
1128322694 15:66704045-66704067 CAGAGCCGGCTGAAGTGGTAGGG - Exonic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1129847314 15:78773929-78773951 CAGTGCCAGGAGGCGTGGTAGGG + Intronic
1130254568 15:82319922-82319944 CAGTGCCAGGAGGCGTGGTAGGG - Intergenic
1130600397 15:85270048-85270070 CAGTGCCAGGAGGCGTGGTAGGG + Intergenic
1130766855 15:86879503-86879525 GAGGGCAAGGAGGAGTGGGAGGG - Intronic
1130844880 15:87735140-87735162 CAGAGGAAGGTGGGGAGGGAAGG + Intergenic
1130966092 15:88699125-88699147 CAGAGTAAAGTGGAGTGTTCTGG - Intergenic
1131855679 15:96591036-96591058 CAGAGAGAGGTGGAGTGGGGAGG + Intergenic
1132281207 15:100617476-100617498 CAGAGCAAGGTGATGGGGCAGGG - Intronic
1132508718 16:325740-325762 CAGAGCAAGGTGCCGTGTTGGGG - Intronic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1133557965 16:6923595-6923617 GAGAGCAGGGTGGAATGGGATGG + Intronic
1133741689 16:8656618-8656640 CAGATGAAGGTGGAGTGACAGGG - Intergenic
1136451666 16:30357308-30357330 CAGAGCAAGGTGGGTTTGGAGGG + Exonic
1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG + Intergenic
1137665982 16:50249398-50249420 CAGAGCAAGCTGGAGTGCAGTGG - Intronic
1138889222 16:61121918-61121940 CAGAAAAAGGTGCAGTGCTACGG + Intergenic
1139064189 16:63291927-63291949 CAGAAGAAGATGGAGTGGGAAGG - Intergenic
1139975376 16:70805935-70805957 CTGAGCAGGATGGAGTGGGATGG - Intergenic
1140211160 16:72971672-72971694 CAGTGCAAGCAGGAGTGGAAAGG - Intronic
1143521046 17:7444633-7444655 CAGAAAAACGTGGAGTGCTAGGG + Exonic
1143554103 17:7650327-7650349 CAGAGCCAGGTGGTGTGGACAGG + Intronic
1143576065 17:7794090-7794112 GAGAGGAACATGGAGTGGTAGGG - Intronic
1143633863 17:8153280-8153302 CAGAGAAATGTGGGGTGGCAAGG + Intronic
1144243379 17:13336174-13336196 TAGAGCAAGGTGCAGGGGTAGGG - Intergenic
1145819155 17:27818034-27818056 CAGAGCAAGGTGGGGGGGTCAGG - Intronic
1147935465 17:44008099-44008121 CAGAGCAGGGTGTAGGGGTGAGG - Intronic
1148675347 17:49441663-49441685 GAGAGGAAGGTGGAGGGGGAGGG + Intronic
1148768461 17:50053248-50053270 CAGAGCAGGGGCGACTGGTAGGG - Intergenic
1149252284 17:54784135-54784157 CAGACCATGGTGTGGTGGTAAGG + Intergenic
1150887965 17:69109672-69109694 CTGAGCAAGATGGAGTGTGATGG - Intronic
1152103896 17:78317972-78317994 CAGGGGAAGGTGGACAGGTAGGG + Intergenic
1154531976 18:15356000-15356022 CAGAGCAGGCTGGAGTGGAGTGG + Intergenic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1156409318 18:36812541-36812563 CAGAGCAAGGTGTGGTGGGAGGG - Intronic
1159556344 18:69949341-69949363 CAGAACAAACTGGAGTGGCAAGG + Intronic
1160575283 18:79849517-79849539 CAGAGCAAGGCGGGGAGGGAAGG - Intergenic
1162723613 19:12676646-12676668 GAGGGGAAGGTGGAGTGGTGAGG - Intronic
1164488304 19:28681467-28681489 GAGAGCACCCTGGAGTGGTATGG - Intergenic
1164717937 19:30407127-30407149 AGGAGCAAAGTGGAGTTGTAGGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165984109 19:39752300-39752322 AAGAGCAAGGAAGAGTGGGAAGG + Intergenic
926349885 2:11984869-11984891 GAGAGTAAGCTGGAGAGGTAAGG + Intergenic
928284878 2:29981308-29981330 CAGGGCAAGATGGTGTGGTCAGG - Intergenic
929866823 2:45724688-45724710 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931799767 2:65747434-65747456 CAAAGCAAGGGGGAGTGGGACGG - Intergenic
932594252 2:73084318-73084340 CTGGGCCAGGTGGAGTGGGAGGG - Intronic
933806195 2:85999599-85999621 CAGGGCAAGGTGGAGAAGAAAGG - Intergenic
934677241 2:96258288-96258310 CAGAGGAAGGTGGACTGATGGGG + Intronic
934727019 2:96628860-96628882 CTGAACAAGGTGGCCTGGTATGG - Intronic
935197442 2:100826047-100826069 CTGAGAAAGGTGGAGAGTTATGG - Intronic
936002822 2:108851168-108851190 CAGAGCAAGGTATAGGGGAAGGG + Intronic
936518416 2:113197066-113197088 AAGACCAGGGTGGAGAGGTAGGG + Intronic
937129133 2:119494212-119494234 CAGAGAAAGGAAGAGTGGTGAGG + Intronic
937786963 2:125911695-125911717 CAGAGACGGGTGGAGTGGTGGGG - Intergenic
937836064 2:126471374-126471396 CAGAGGAATGAGGAGTGGAAAGG + Intergenic
938664642 2:133521991-133522013 CAGGGCAAGGTGAGGTGGAAAGG - Intronic
938671249 2:133588719-133588741 GAGAGCAAGGTAGAGAGGTAGGG + Intergenic
940049346 2:149445757-149445779 CAGAGAAAGTTTGAGTGGTCTGG - Intronic
941513342 2:166440940-166440962 CAGAGCAGGACAGAGTGGTATGG + Intronic
944892542 2:204132568-204132590 CAGACCAAGGTGGAGTGTGGAGG - Intergenic
946353269 2:219169279-219169301 CAGAGCAAGGGCAAGGGGTAAGG - Exonic
947247080 2:228060805-228060827 CAGAGAAAGGGGGAGAGGTGAGG + Intronic
947772586 2:232682354-232682376 CGGAGCAAGGTGAAGAGGGAGGG - Exonic
948383085 2:237564417-237564439 CAGAGCAAGATGGAGCTGTCGGG + Intergenic
1169354399 20:4895324-4895346 GGGAGCAAGGTGGAGAGGAAAGG - Intronic
1170383935 20:15795447-15795469 CAGAGCCAAGGGGAGTGGGAGGG + Intronic
1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG + Intergenic
1172312638 20:33930191-33930213 CAGAGGAAGCTGGCGTGGGAGGG + Intergenic
1173573736 20:44096440-44096462 GAGAGGGAGGTGGAGTGGGAGGG + Intergenic
1173882651 20:46428719-46428741 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
1175558875 20:59899673-59899695 CACAGCAAGGTATGGTGGTAGGG + Intronic
1176128727 20:63487345-63487367 CAGAGCAGGGAGGGGTGGAAAGG + Intergenic
1177478549 21:21655729-21655751 CAGAGCAAGGTGCTTTGGGAAGG - Intergenic
1178594962 21:33945025-33945047 CAGAGCACGGAGGATTTGTAGGG + Intergenic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1180175191 21:46083846-46083868 CAGAGCAGGCAGGAGTGGGAGGG + Intergenic
1180928063 22:19570098-19570120 TGGAGCAAGGTGGAGTAGGATGG + Intergenic
1181050462 22:20235905-20235927 CAGAAGAAGATGGAGTGGGACGG - Intergenic
1181462651 22:23094649-23094671 CAGAGCAAGGTGGAGGCTTCAGG - Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1203305753 22_KI270736v1_random:107912-107934 GAGAAGAAGGTGGAGTGGAATGG + Intergenic
949809826 3:7994699-7994721 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
950226592 3:11240472-11240494 TGGAGCAAGAGGGAGTGGTAGGG - Intronic
951547084 3:23837530-23837552 CATAGCAAGTTGGACTGGGATGG - Intronic
952093817 3:29924142-29924164 CAGAGCAGAGTGGAATGGTTTGG - Intronic
953473573 3:43186871-43186893 CAGAGCATGGTGGAGAGGTTAGG - Intergenic
953830541 3:46294107-46294129 CAGAGCAAGGGGGAGTCCCAGGG + Intergenic
955350188 3:58187936-58187958 CAGAGCCAGGTGGAGAGCTCAGG - Intergenic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
959118445 3:102205804-102205826 AAGAGGAAGGAGGAGTGGGAAGG - Intronic
959579357 3:107968193-107968215 CAGAGCAAGGTAGAGGAGTGTGG - Intergenic
959653347 3:108773022-108773044 CAGAGAAAGGGGGAGAGGAAAGG - Intergenic
960101162 3:113745568-113745590 CAGCTCCAGGTGGAGTGGTTTGG - Intronic
960820189 3:121722256-121722278 CAGAGCAAGCTGCACAGGTAGGG - Exonic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
963773219 3:149410849-149410871 TGGAGAAAGTTGGAGTGGTATGG - Intergenic
966441168 3:179946076-179946098 CAGAGCAATGAAGAGAGGTAAGG - Intronic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967217561 3:187223309-187223331 CAGAGAAAGGTGGTGTGGTGGGG + Intronic
967473176 3:189886666-189886688 CAGATCAAAGTGGAGTGGCTTGG + Intronic
968041949 3:195596194-195596216 CAGATGCAGATGGAGTGGTAGGG + Intergenic
970328568 4:14954985-14955007 GAGAGCAAGGTAGTGTGGCATGG - Intergenic
972615813 4:40696943-40696965 CAGAGCACTGGGGGGTGGTAGGG + Intergenic
973717060 4:53687414-53687436 CAGACCAAGGTGGTGTGTTGGGG + Intronic
976675069 4:87694075-87694097 GGAAGCAAGGGGGAGTGGTAGGG + Intergenic
977325835 4:95573348-95573370 GAAAGCAGGGTGGAGTGATATGG - Intergenic
981091919 4:140741046-140741068 TAGAGCAGGGTGGGGTGGTGAGG + Intronic
982045910 4:151445449-151445471 CCCAGCAAGGTGGAGTGGGGGGG + Intronic
983409542 4:167379390-167379412 CTGGGCAAGGTGGAGTGGGGTGG + Intergenic
986159962 5:5218734-5218756 AAGAGCAGGATGGAGTGGGAAGG + Intronic
986748974 5:10768448-10768470 CAGAGAAATGGGAAGTGGTAAGG + Intergenic
987088920 5:14493869-14493891 CAGAGAAAGTTTGAGTGGTCTGG + Intronic
988615775 5:32773468-32773490 CACACCAAGATGGAGAGGTAAGG - Intronic
989323594 5:40165144-40165166 CAGAGCAAGGTGGAGAGCCCTGG - Intergenic
990002095 5:50906232-50906254 GAGAGCAAGATGGAGTGGATAGG + Intergenic
990786525 5:59426592-59426614 CGGGGCAGGGTGGGGTGGTAGGG - Intronic
991620930 5:68544893-68544915 GGGAGCAAGGTGGAGGGGGAAGG + Intergenic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
992186585 5:74250357-74250379 CAGTGCAAGGTGGGGTTGTAAGG - Intergenic
992549288 5:77845957-77845979 AAGAGCAAGGTGGAGGTGCAGGG + Intronic
993761168 5:91799391-91799413 CAGAGCAAAGGGGCGTGGGAGGG + Intergenic
994661522 5:102660122-102660144 GAGAGGAAGTTGGAGTGGAAAGG - Intergenic
995209577 5:109521916-109521938 TAGAGCAAGGGGGTGGGGTAGGG - Intergenic
996388234 5:122932353-122932375 CAGAGCCAGGCGCAGTGGCATGG + Intronic
998205499 5:140154335-140154357 CAGAGCAAGCAGGAGTGGGGAGG - Intergenic
999594231 5:153184480-153184502 CAGAGCCAGGTAGAGAGATATGG + Intergenic
1000171656 5:158708247-158708269 CAGAGCAAGGTGGCTGGGTGAGG - Intronic
1001816916 5:174677148-174677170 CAGAGCAGGGTGGGGTGGGTAGG - Intergenic
1001884141 5:175273549-175273571 CAGAGCCAAGTGGTGTGTTATGG + Intergenic
1002520942 5:179793052-179793074 CAGGGCCAGGTGGAGAGGAAAGG - Intronic
1003062875 6:2876194-2876216 CAGAGCGAGTTGGGGGGGTAAGG - Intergenic
1003513997 6:6803579-6803601 CAGAGGAAGGTGGAAAGGTGAGG + Intergenic
1006752988 6:36390997-36391019 TCGAGCAGGGTCGAGTGGTATGG + Exonic
1006790201 6:36695487-36695509 AAGATCCAGGTGGAGTGATATGG - Intergenic
1010656582 6:78518525-78518547 CAGAGGGAGGTGGGGTGGAAGGG - Intergenic
1014297394 6:119636987-119637009 CAGAGCAAGATGAAGTGATTTGG - Intergenic
1017031063 6:150222577-150222599 CAGAGCACGGAGGATTGTTAGGG - Intronic
1018449978 6:163898661-163898683 CAGAGCCAGGGGGAGTGTCAGGG + Intergenic
1020632518 7:10656650-10656672 CAGAGAAGGAGGGAGTGGTAGGG + Intergenic
1021927362 7:25546250-25546272 CAGGGCAAGGAGGAGGGGTTGGG + Intergenic
1024089880 7:45927139-45927161 CAGAACAGGGTGGAATGGAATGG - Intergenic
1026105535 7:67417917-67417939 CAGAGCAGGGTGGAGCTGCATGG - Intergenic
1029150525 7:98477304-98477326 CAGAGGAGGGTGGAGTTGCACGG - Intergenic
1033022145 7:137736470-137736492 CACAGCAACGTGAAGAGGTAAGG - Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033437114 7:141343202-141343224 CAATGCAAGGGCGAGTGGTACGG - Intronic
1033684371 7:143624956-143624978 CAGACCAAGTTGGATTGGTCAGG + Intronic
1033687547 7:143704175-143704197 CAGACCAAGTTGGATTGGTCAGG + Intronic
1033700240 7:143832667-143832689 CAGACCAAGTTGGATTGGTCAGG - Intergenic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1034425066 7:151009834-151009856 CAGAGCAAGCTAGATTGCTAGGG - Intronic
1034568868 7:151938521-151938543 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1035688864 8:1547008-1547030 CACAGCAAGGCCGAGTGGTGTGG + Intronic
1035854897 8:2964301-2964323 CAGTAGAAGGTGGAGTGGTGAGG - Intronic
1035886452 8:3296352-3296374 CAGAGGAAGGGGGACTGGGAAGG + Intronic
1037984822 8:23283557-23283579 CACCTCAAGGTGGAGTGGGAAGG + Intronic
1039454818 8:37699414-37699436 CAGAGCAAGGTAGAGGAGCAAGG - Exonic
1039815197 8:41087576-41087598 CAGAGAAAGTTTGAGTGGTCTGG + Intergenic
1039820145 8:41127679-41127701 CAGGGCAAGGTGTAGGGGAAGGG - Intergenic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1041926628 8:63243605-63243627 CATAGAAAGCTGGAGTGGCATGG - Intergenic
1042416977 8:68531802-68531824 CATAGGAAGGTGGAATGGTTAGG + Intronic
1044426950 8:92062870-92062892 CAGAGAGAGGTGGAGTGCTAAGG - Intronic
1047037394 8:120955035-120955057 CAGAGCAGGGTGGAGACGAATGG - Intergenic
1048375525 8:133819296-133819318 CAGAGCAGGATGGAGTGCAATGG + Intergenic
1049218101 8:141416974-141416996 CAGAGCAGGGTGGAGCGGCAAGG - Intronic
1053618649 9:39794394-39794416 CAGGGTAAGGTGGGGTGGGAAGG - Intergenic
1054265506 9:62913035-62913057 CAGGGTAAGGTGGGGTGGGAAGG + Intergenic
1055923334 9:81484915-81484937 CAAAGCAATGTGGAGAGGTAGGG + Intergenic
1056286652 9:85093916-85093938 CAGCACAAGGTGGCGTGGAATGG + Intergenic
1056338045 9:85596384-85596406 CAGACCATGGTGGATTCGTATGG - Exonic
1056487476 9:87073276-87073298 CAGATCAAGAGGGAGTGGAATGG + Intergenic
1058918000 9:109586122-109586144 CAGAAAAAAGTGGAATGGTAGGG - Intergenic
1059635810 9:116169649-116169671 AAGAGCTAGGTGGAATTGTAAGG + Intronic
1060059822 9:120449114-120449136 AAGAGCAGGGTGAAGTGGAAGGG - Intronic
1060185607 9:121562270-121562292 CAGAGCTCAGTGGAGTGGTGGGG - Intergenic
1060976631 9:127768782-127768804 CAGAGCAAGGTGGGGAGGACAGG - Intronic
1061432471 9:130539975-130539997 CAGAGCAGGGCAGAGAGGTAGGG - Intergenic
1203347602 Un_KI270442v1:46156-46178 CAGAGAGGAGTGGAGTGGTAGGG + Intergenic
1188612327 X:32115830-32115852 CAGACTAGGGTGGAGTGGTGGGG - Intronic
1189567717 X:42260749-42260771 CAAAGGAAGGTGGAGAGGTGGGG - Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190429786 X:50367967-50367989 TAGAGTAAGGGGGAGTGGGAAGG + Exonic
1192062262 X:67839457-67839479 CAGAGCAAGTCCTAGTGGTAGGG + Intergenic
1192550433 X:72049165-72049187 CAGGGCAAAGTGGACTGGCAGGG + Intergenic
1192624150 X:72710784-72710806 CAGAGGAAGGGGGAATAGTAGGG - Intronic
1192847206 X:74918618-74918640 CAGAGCCTGGTAGAGTGGCAGGG - Intronic
1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG + Intronic
1195904567 X:109830679-109830701 CAGAGCATAGAGGAGTGGAAAGG + Intergenic
1196646785 X:118126639-118126661 CAGAGCAAGGTGGAAGGTGAGGG - Intergenic
1197447545 X:126569021-126569043 CAGGGCAAGATGTAGTGGGAAGG + Intergenic
1198610895 X:138399222-138399244 CATAGCAAGGTGGAATGTTAGGG - Intergenic
1199034496 X:143033882-143033904 AAGAGCAAGGTGGAATCATAGGG - Intronic
1199837656 X:151608067-151608089 GAGGGTAGGGTGGAGTGGTAGGG + Intronic
1200091911 X:153640010-153640032 CCGGGCAAGGTGGAGGGGCACGG - Intergenic
1201098709 Y:10655043-10655065 TAGAGAAAAGTGGAGTGGAATGG - Intergenic
1201101941 Y:10684711-10684733 CAGAACAAAGTGGAGTGGAGTGG - Intergenic
1201103434 Y:10745847-10745869 CAGAACAAAGTGGAGTGGAGTGG - Intergenic
1201104128 Y:10750908-10750930 CAGAGCTGGGTGGAGTGGAATGG - Intergenic
1201116862 Y:10841596-10841618 CAGAGTGAAGTGGAGTGGAATGG - Intergenic
1201121000 Y:10873462-10873484 CAGAGCAATGTGGAGTTGAGTGG - Intergenic
1201127683 Y:10929431-10929453 CAGAACAGGGTGGAGTGGAGTGG - Intergenic
1201173518 Y:11293486-11293508 TAGAGTAAAGTGGAGTGGAACGG - Intergenic