ID: 930643793

View in Genome Browser
Species Human (GRCh38)
Location 2:53881931-53881953
Sequence CTTTGTAAGCTATTCTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930643786_930643793 26 Left 930643786 2:53881882-53881904 CCTAAAGGCAGGATTTTAAACTA 0: 1
1: 0
2: 1
3: 26
4: 325
Right 930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG 0: 1
1: 0
2: 0
3: 19
4: 172
930643789_930643793 -9 Left 930643789 2:53881917-53881939 CCCGAAAGCCAGGACTTTGTAAG 0: 1
1: 0
2: 2
3: 18
4: 333
Right 930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG 0: 1
1: 0
2: 0
3: 19
4: 172
930643785_930643793 30 Left 930643785 2:53881878-53881900 CCAACCTAAAGGCAGGATTTTAA 0: 1
1: 0
2: 0
3: 25
4: 278
Right 930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG 0: 1
1: 0
2: 0
3: 19
4: 172
930643790_930643793 -10 Left 930643790 2:53881918-53881940 CCGAAAGCCAGGACTTTGTAAGC 0: 1
1: 0
2: 2
3: 16
4: 204
Right 930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG 0: 1
1: 0
2: 0
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930643793 Original CRISPR CTTTGTAAGCTATTCTTGGT TGG Intronic
900921484 1:5674216-5674238 CTTTGAAAGATATTTTTGCTGGG + Intergenic
900924164 1:5692563-5692585 CAATGTCAGCTGTTCTTGGTGGG - Intergenic
903574928 1:24333421-24333443 CTTTGGAGGCTATGCTGGGTTGG + Intronic
904703658 1:32374623-32374645 CTTTGCTAGCTAGTCTTTGTAGG + Intronic
906010444 1:42519488-42519510 CTTTGTGATTTAGTCTTGGTAGG + Intronic
908057929 1:60312154-60312176 CTTTGTAATACAGTCTTGGTAGG - Intergenic
908097050 1:60750125-60750147 CTTTGGAACTTATTATTGGTGGG - Intergenic
909068789 1:70967382-70967404 CATTGTAAGCTATTGTGGGCAGG - Intronic
909411279 1:75354685-75354707 TTTTGTAAGCTTTTCTGTGTCGG - Intronic
910295336 1:85638681-85638703 CTTTGCTAAGTATTCTTGGTTGG - Intergenic
910491824 1:87780915-87780937 CTTTATAAACTACACTTGGTAGG + Intergenic
910558262 1:88561346-88561368 ATTTGTAAGCTATTATTCCTGGG - Intergenic
911090882 1:94015975-94015997 CTTTTTAAACAGTTCTTGGTTGG + Intronic
916317729 1:163469188-163469210 CTTTATATACTATTCTGGGTTGG + Intergenic
916549599 1:165837387-165837409 ATTTGTAAGCTTTCTTTGGTGGG + Intronic
918213835 1:182375697-182375719 CTTTATAAGCTAATCTTGGAAGG - Intergenic
918658934 1:187065178-187065200 CATTGGAAGCTATTCTTGAGTGG + Intergenic
921267417 1:213434304-213434326 TTTTGAAAGATATTCTTGTTGGG + Intergenic
923086862 1:230708866-230708888 CTTTGAACGCCATGCTTGGTAGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1064836567 10:19538395-19538417 CTTTGTAAGTTCTTCTGGTTTGG - Intronic
1065842990 10:29720372-29720394 TTTTGGAAGCTATTTTTGCTGGG - Intronic
1065868767 10:29937390-29937412 CTTTGTTAGCAATTTTTTGTTGG + Intergenic
1066037278 10:31505486-31505508 CTTTCTAATTTAATCTTGGTAGG + Intronic
1066116172 10:32242448-32242470 CTTTATAAACTAGTTTTGGTGGG + Intergenic
1066138772 10:32481779-32481801 CTGGGTAAGGTATTCTTGGTTGG + Intronic
1066161837 10:32741568-32741590 ATTTGTAATCTATATTTGGTTGG + Intronic
1068143849 10:53040474-53040496 CTTTGCAGGCTTTTCTTTGTGGG + Intergenic
1068511774 10:57975253-57975275 CTTTATAATTTAATCTTGGTAGG - Intergenic
1068974648 10:62995309-62995331 TTTTGGAATCTATTCTTGGATGG + Intergenic
1069202177 10:65634010-65634032 CTTGGTACAATATTCTTGGTTGG - Intergenic
1069204364 10:65662759-65662781 CTTTGTAAGCTATTGGTGTTGGG + Intergenic
1069415132 10:68192725-68192747 CTTTGTAGTTTAGTCTTGGTAGG + Intronic
1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG + Intergenic
1071022557 10:81075378-81075400 CTTTGTTATTTAGTCTTGGTAGG + Intergenic
1071891832 10:90016706-90016728 CTTTATAAGTTAATATTGGTAGG + Intergenic
1072049112 10:91686136-91686158 CTTTGCAAGTTTTGCTTGGTTGG - Intergenic
1072824811 10:98596604-98596626 CTGGGTAAAGTATTCTTGGTTGG + Intronic
1074647384 10:115474222-115474244 CCAGGTAAGGTATTCTTGGTTGG + Intronic
1074929777 10:118112532-118112554 CTTGGTAAACTATTATTGTTTGG + Intergenic
1075987613 10:126801000-126801022 CTTTAAAAACTATTGTTGGTTGG + Intergenic
1076592813 10:131599524-131599546 CTTTGTGGGTTAGTCTTGGTAGG + Intergenic
1077647792 11:3941450-3941472 ATTTGAAAGTAATTCTTGGTAGG + Intronic
1080279803 11:30543986-30544008 CTTTGTTAGCTATAATTAGTTGG - Intronic
1080941151 11:36920029-36920051 TTTTGTAAACTATATTTGGTTGG - Intergenic
1084458200 11:69281042-69281064 CTTTGTCAGCTATCCTTGAGGGG + Intergenic
1086358837 11:86036052-86036074 CTTTGTAATTTTTCCTTGGTGGG + Intronic
1087456305 11:98390963-98390985 ATTTGAAAGTTATTCTTGATTGG + Intergenic
1091859976 12:3772357-3772379 TTTTGGTAGGTATTCTTGGTAGG - Intergenic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1095299204 12:40562627-40562649 CTTGGTAGGTTTTTCTTGGTAGG - Intronic
1095660551 12:44728854-44728876 CTATGTATAGTATTCTTGGTTGG - Intronic
1097286965 12:57885470-57885492 TTTTGAAAGCTACTCTTGTTGGG - Intergenic
1098634228 12:72761333-72761355 CTTTCTAAGTCAATCTTGGTAGG - Intergenic
1103031615 12:117618958-117618980 CTTTTCCAGTTATTCTTGGTAGG + Intronic
1105993466 13:25647362-25647384 CTATGTAAAATATTTTTGGTTGG + Intronic
1106170017 13:27280725-27280747 CTTTGAAAGCCATTCTAGGATGG + Intergenic
1106994837 13:35469815-35469837 CTTTGTAAACTATTTTTATTTGG + Intronic
1107210356 13:37846052-37846074 TTTGGTAAAGTATTCTTGGTTGG - Intronic
1109092869 13:58070796-58070818 CTTTATTGGCTATTTTTGGTGGG + Intergenic
1109656080 13:65391834-65391856 CTTTGTAAGCTATGATTTCTTGG - Intergenic
1112702690 13:102030235-102030257 CTTTGTAAAGTCTTCTTGGGTGG + Intronic
1114677652 14:24454851-24454873 GTTGGTAAGCAATTCTAGGTTGG - Intergenic
1117567584 14:57010922-57010944 CTTTGTAAGTTATTTTAGTTGGG + Intergenic
1118716570 14:68564196-68564218 CTTTCTCAACCATTCTTGGTAGG - Intronic
1120333724 14:83126905-83126927 TTTTGTCAGCTCTTCTTGGTGGG + Intergenic
1120428487 14:84381908-84381930 CTTTGTGACTTATTCTTGGTAGG - Intergenic
1122656538 14:103265094-103265116 CTTTCAAAGCTATTATTGATGGG + Intergenic
1122674157 14:103396680-103396702 CTTTGTTACCTCTTCTTGGGTGG + Intronic
1124714043 15:32042060-32042082 CTTTGTAATTTTTTCTTGATTGG + Intronic
1126989756 15:54360732-54360754 CTTAGTACAGTATTCTTGGTTGG + Intronic
1127857803 15:62967153-62967175 CAGTGTAAGCTATTCTGGGTGGG - Intergenic
1129123061 15:73414699-73414721 CTTTGTAAGTCATTGATGGTTGG + Intergenic
1130260898 15:82353487-82353509 TTTTTTAAGCCATTCTGGGTTGG + Intergenic
1130280335 15:82515529-82515551 TTTTTTAAGCTATTCTGGGTTGG - Intergenic
1130342171 15:83008911-83008933 CTCTGTAAGCCCATCTTGGTCGG - Intronic
1130471708 15:84231713-84231735 TTTTTTAAGCTATTCTGGGTTGG - Intergenic
1130479202 15:84346283-84346305 TTTTTTAAGCTATTCTGGGTTGG - Intergenic
1130492568 15:84441846-84441868 TTTTTTAAGCTATTCTGGGTTGG + Intergenic
1133724959 16:8528858-8528880 ATTTGCAAGGCATTCTTGGTAGG + Intergenic
1133821507 16:9241262-9241284 CCTTCTCAGCTATTATTGGTGGG - Intergenic
1134781387 16:16899816-16899838 CTTTATAATTTAATCTTGGTAGG + Intergenic
1137528339 16:49258237-49258259 CTTTGTAAGCTATTCCAAATGGG - Intergenic
1140780551 16:78292829-78292851 CTTTGTAAGGTATTCAAGGATGG + Intronic
1146108511 17:30064939-30064961 CTGGGTATACTATTCTTGGTTGG - Intronic
1147480713 17:40760183-40760205 CTGGGTATGATATTCTTGGTTGG + Intergenic
1151748555 17:76024268-76024290 CTCTGTGAGCTAGTCCTGGTTGG + Intronic
1151881510 17:76898159-76898181 CTATGTAACCTAATCTTGGTAGG - Intronic
1163259023 19:16175612-16175634 TTTTGAAAGTTATTCTTGGATGG - Intergenic
925616169 2:5746398-5746420 CTCTTTAAGCTATTCTTGGAAGG + Intergenic
925943748 2:8842269-8842291 ATTTGACAGCTTTTCTTGGTGGG + Intergenic
926954729 2:18281978-18282000 ATTTGTGAGCTAATTTTGGTAGG + Intronic
929522695 2:42668871-42668893 TTTTCTAAGTTATTCTTGATGGG - Intronic
930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG + Intronic
931703573 2:64927938-64927960 CTTTGCATAATATTCTTGGTTGG + Intergenic
933360281 2:81273669-81273691 CTTCATAATTTATTCTTGGTAGG - Intergenic
933491799 2:82993964-82993986 CTTTGTAAGCCATTTTCTGTGGG - Intergenic
938006629 2:127792363-127792385 CAATTTAAGCTATTCTTGGCAGG + Intronic
944604617 2:201340869-201340891 TTTGCTAAGGTATTCTTGGTAGG + Intronic
1175441089 20:58992305-58992327 CTATGTAAGCAATACTTTGTGGG - Intronic
1175761947 20:61567228-61567250 CTTTGTAAGCTCTTCTAGCTGGG + Intronic
1177379740 21:20324351-20324373 CTTCATAACTTATTCTTGGTAGG + Intergenic
1177465834 21:21479285-21479307 CTTTGTAAGAAATTGTTGGCCGG + Intronic
1179526808 21:41983768-41983790 CCTTGAAAGCTATTTTTGATGGG - Intergenic
1182672988 22:32013369-32013391 CTGGGTATGGTATTCTTGGTTGG + Intergenic
949433328 3:4002129-4002151 CTCTGAATGCCATTCTTGGTAGG + Intronic
950458762 3:13108582-13108604 CATTGTGAGCTAGACTTGGTGGG + Intergenic
951314782 3:21176984-21177006 CTGGGTATACTATTCTTGGTTGG + Intergenic
952213228 3:31250443-31250465 CTCTGTAGGATATTTTTGGTGGG - Intergenic
952628688 3:35439093-35439115 CTTGCAAAGCTATTTTTGGTGGG - Intergenic
958647964 3:96897344-96897366 ATTTGCAAGCAAATCTTGGTAGG + Intronic
959295016 3:104523885-104523907 CTCTGGAAGCTATCCTTTGTGGG - Intergenic
959305087 3:104653009-104653031 CTGGGTAAAGTATTCTTGGTTGG + Intergenic
959773575 3:110129634-110129656 TTTTGTAAATTATTCTTGCTAGG + Intergenic
961421453 3:126808286-126808308 TTTTGAAAGCTAATCTTGGAAGG + Intronic
962599837 3:136983386-136983408 CTTTGTAAGATAGACCTGGTCGG - Intronic
964729601 3:159850975-159850997 CTTTAAAAGCTATGCTTGGATGG + Intronic
964731408 3:159870392-159870414 CTTTGTAAGTTATACCTGGGAGG - Intronic
964897731 3:161618238-161618260 CTCTGTAAACTATTATTGCTCGG - Intergenic
966322672 3:178718327-178718349 CTTGGTAAGATTTTCTTGTTTGG - Intronic
970191909 4:13525366-13525388 CTTTGAAAGCTTTTCTGGGATGG + Intergenic
971786382 4:31108917-31108939 CATAGTGAGCTGTTCTTGGTGGG + Intronic
972876544 4:43368227-43368249 GTTTGTAACCTATTCTTCCTGGG + Intergenic
973333439 4:48932890-48932912 CTTTGAAGGCTATGATTGGTAGG + Intergenic
973861290 4:55067746-55067768 CTTTGTCACTTATTTTTGGTTGG + Intergenic
974673645 4:65063005-65063027 GGTTGTAGTCTATTCTTGGTAGG + Intergenic
977187072 4:93952468-93952490 CTTTGTGATTTAGTCTTGGTAGG - Intergenic
977351315 4:95891587-95891609 TTTTGAAAGCTATTATTGCTGGG + Intergenic
977781787 4:100989094-100989116 CTTTGTAAATCATTCTTGGCAGG - Intergenic
979040747 4:115789921-115789943 CTTTGCAATGTATTCTTCGTAGG + Intergenic
981455940 4:144953485-144953507 TTAGGTAAGATATTCTTGGTTGG - Intergenic
981718205 4:147772837-147772859 TCCTGAAAGCTATTCTTGGTGGG + Intronic
982863733 4:160485062-160485084 CTCTGTAAGCTTTTCTTCCTTGG - Intergenic
983309189 4:166035591-166035613 ATCTGGAAGCTATTCTTGATTGG - Intronic
983669496 4:170218997-170219019 CTGTGTAAAGTATTCTTGCTTGG - Intergenic
984728576 4:183044816-183044838 CTTTGTAACGCATTGTTGGTGGG + Intergenic
984988722 4:185356705-185356727 CATTGTTAGCTTTTCTTAGTGGG + Intronic
985428345 4:189853552-189853574 CTGAGTAAAATATTCTTGGTTGG + Intergenic
988519776 5:31935158-31935180 CTTTGTTAGCTATACTTGTAAGG - Intronic
988862169 5:35293690-35293712 TTTTGTAATTTAGTCTTGGTAGG + Intergenic
990787217 5:59435194-59435216 CATTTTAAGATAATCTTGGTAGG - Intronic
991506693 5:67332168-67332190 CTTTGTAATTCAGTCTTGGTAGG + Intergenic
992238652 5:74740625-74740647 GTTTGCAAGCTATTATTGGTGGG + Intronic
992777149 5:80098396-80098418 ATTTCTAGGCTATTCTTGGAAGG - Intergenic
993079917 5:83283194-83283216 CTTTATAACCTATACTTAGTAGG - Intronic
994879926 5:105477108-105477130 CCAAGTAAACTATTCTTGGTTGG - Intergenic
999285088 5:150389921-150389943 CTTTGGGGGCTATTCTTGGGTGG - Exonic
999599975 5:153252077-153252099 CTTTGCCAGATATTCTTGGTTGG + Intergenic
1001802960 5:174559375-174559397 TTTTGAAAGCTAAGCTTGGTAGG - Intergenic
1002511455 5:179721384-179721406 CTATGAAAGTTATTCTTGGCTGG - Intronic
1002680843 5:180962288-180962310 CCTTGTACATTATTCTTGGTAGG + Intergenic
1002851724 6:1002758-1002780 CTTTGTAGGTTAGTCTTGGCTGG - Intergenic
1003184871 6:3821919-3821941 CTTTGTATGCAATTCTCGGGAGG + Intergenic
1004811718 6:19270264-19270286 CTGTGTATACTATTCTTGGATGG - Intergenic
1005300962 6:24469919-24469941 CTTTTTAAGCTATTTTTATTGGG - Intronic
1007411916 6:41668933-41668955 CTTTTTAAGAAATTGTTGGTCGG - Intergenic
1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG + Intronic
1010134894 6:72540127-72540149 CTTGGTATGGTATTCTTTGTTGG + Intergenic
1010174363 6:73009806-73009828 CTTTGTGATTTAGTCTTGGTAGG - Intronic
1012131804 6:95503769-95503791 CTAGGTAAAGTATTCTTGGTGGG - Intergenic
1015558320 6:134485675-134485697 GTTTGTTGGCTATTCTTGCTTGG + Intergenic
1017982707 6:159415727-159415749 CTGGGTAAAGTATTCTTGGTTGG - Intergenic
1023003237 7:35834309-35834331 CTTTTTAAACTATACTTAGTAGG + Intronic
1023622713 7:42089041-42089063 CTTCATAAACTATACTTGGTAGG + Intronic
1027704853 7:81517128-81517150 TTTTTTAAGCTATACTTGGAAGG - Intergenic
1030400157 7:109039547-109039569 CTTTGGAAACTGCTCTTGGTTGG + Intergenic
1030424030 7:109349186-109349208 CTTTGGAAGCTATTCATCTTAGG - Intergenic
1030471508 7:109969252-109969274 CCTTGTAATTTAATCTTGGTAGG - Intergenic
1032145663 7:129377760-129377782 ACTTGTAAGCTATACTTGTTTGG - Intronic
1032923110 7:136572871-136572893 CTAGGTAAACTATTCTTGGTTGG + Intergenic
1034712943 7:153211654-153211676 CTTTGCAATTTAGTCTTGGTAGG + Intergenic
1038587084 8:28799730-28799752 CTTTGTAAGGTATTTTAAGTTGG - Intronic
1043020267 8:74991430-74991452 CTTTATAAGCTAATCATGGTGGG - Intronic
1043697211 8:83235219-83235241 CTGTGTAAAGTATTCTTGTTTGG + Intergenic
1050906141 9:11009061-11009083 CTTTGTGAGTCAATCTTGGTAGG + Intergenic
1051500749 9:17774991-17775013 CTTTGTGAGTTAGTCTTGGTAGG + Intronic
1052223106 9:26051729-26051751 TTTTCTAATATATTCTTGGTAGG - Intergenic
1052403452 9:28029851-28029873 CTTTGAAAGCATTTGTTGGTTGG + Intronic
1053493681 9:38532638-38532660 CTTTGCAAGATATTATTGTTGGG + Intergenic
1055112016 9:72569317-72569339 CTTTTTAACCTATGGTTGGTTGG + Intronic
1057674417 9:97127461-97127483 CTTTGCAAGATATTATTGTTGGG + Intergenic
1062231654 9:135485307-135485329 CTTTGTAGGCGGCTCTTGGTGGG - Exonic
1188393214 X:29646833-29646855 CTTGGTACGGTATTTTTGGTGGG - Intronic
1188826226 X:34838742-34838764 CTGGGTACGGTATTCTTGGTTGG + Intergenic
1191725468 X:64275894-64275916 CTTTGTGATTTAGTCTTGGTAGG - Intronic
1191758861 X:64625224-64625246 CTTTGCTAGATATTCTTGGTTGG - Intergenic
1192084005 X:68077226-68077248 CTTTATAAGCTGTTATTGGGAGG + Intronic
1192332915 X:70192973-70192995 CTTCATAATTTATTCTTGGTAGG - Intronic
1193160659 X:78225546-78225568 CTTTGTAGGCTGTTCTTTTTAGG - Intergenic
1195276961 X:103290931-103290953 CTTTATGATTTATTCTTGGTAGG + Intergenic
1199548775 X:149035525-149035547 CTTGGTAAGCTGTTCCTGTTGGG - Intergenic
1202092307 Y:21206489-21206511 ATTTATAAGTTAATCTTGGTAGG - Intergenic