ID: 930653148

View in Genome Browser
Species Human (GRCh38)
Location 2:53982580-53982602
Sequence AATTCTAGGCAGTGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930653148_930653154 15 Left 930653148 2:53982580-53982602 CCTTCCACCCACTGCCTAGAATT 0: 1
1: 0
2: 1
3: 33
4: 326
Right 930653154 2:53982618-53982640 TAAGTTTTATCAATTTTGAAAGG 0: 1
1: 0
2: 2
3: 36
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930653148 Original CRISPR AATTCTAGGCAGTGGGTGGA AGG (reversed) Intronic
901940301 1:12656764-12656786 CATACCAGGCAGTGGATGGATGG - Intronic
902144368 1:14385464-14385486 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
904236176 1:29118766-29118788 AATTATAGGCTGTGGGCAGAGGG + Exonic
904536076 1:31200354-31200376 ATTTCTAGGGAGTGGGGAGATGG + Intronic
904595538 1:31642524-31642546 AAAGCTATGTAGTGGGTGGAGGG + Intronic
904724236 1:32534759-32534781 AGAACTAGACAGTGGGTGGAAGG - Intronic
906565002 1:46793287-46793309 AATTCATGGTACTGGGTGGAAGG + Intronic
906676758 1:47698781-47698803 GATAGTTGGCAGTGGGTGGAGGG - Intergenic
906748661 1:48239579-48239601 AATTCTAGGCTATGGGGGAAGGG - Intronic
908806452 1:67937672-67937694 AGTTCGAGGGAGTGGGTGGATGG + Intergenic
910157128 1:84232072-84232094 CATTCAAAGCAGTGTGTGGAGGG - Intronic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
910540005 1:88344694-88344716 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
911678935 1:100691919-100691941 ATTTCCAGGCTGTGGGTGAACGG + Intergenic
911859637 1:102931244-102931266 CATTCAAAGCAGTGGGTAGAGGG - Intronic
912049883 1:105515270-105515292 AATTCTATGAAGTGGGGGAAGGG + Intergenic
913030847 1:114901465-114901487 AATCCAAGGCAGTGCGTGGAGGG + Intronic
913195743 1:116454708-116454730 GATTCAAGGCAGTGGGTAGGGGG + Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914996828 1:152550944-152550966 CATTCAAAGCAGTGTGTGGAGGG - Intronic
915349891 1:155217735-155217757 AATTCTGGGCAGGGGGTGACAGG + Intergenic
915543620 1:156583626-156583648 AATTCTGGGCAGGTGGTGGCAGG + Intronic
915760498 1:158306920-158306942 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
916038128 1:160938997-160939019 ATTTAAAGGCAGTGTGTGGAGGG - Intergenic
917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG + Intronic
917569170 1:176246512-176246534 AATTTCAGGTAGGGGGTGGAGGG + Intergenic
918108971 1:181439176-181439198 CATGCTAGGCAGGGGGTTGAAGG + Intronic
918120754 1:181537530-181537552 ATTTCTAGGAATTTGGTGGAAGG + Intronic
918248776 1:182683730-182683752 ATTTCTAAGCAGTGAGTTGAGGG - Intronic
920157792 1:203969445-203969467 AATTCAAGACAGTTTGTGGAGGG + Intergenic
920235184 1:204498267-204498289 AATATAAGGCAGTGGGTAGAGGG + Intergenic
920865520 1:209748932-209748954 ATTTCCAGGAAGTGGGTGGGAGG - Intergenic
920898741 1:210085011-210085033 CATTCTAGGCAGTGCCTGCATGG - Intronic
921070459 1:211654131-211654153 GAGTCCAGGCAGTGGGAGGAGGG + Intergenic
921871852 1:220149600-220149622 AATTCTAGGATGTGTGTGGCTGG + Exonic
922759642 1:228119437-228119459 AATTCAAGACAGTTGGTGGAGGG + Intergenic
923299971 1:232631253-232631275 AATTCTACGGTGTGGCTGGAAGG - Intergenic
923413209 1:233730437-233730459 AATTCAAGGCTGTTTGTGGAGGG + Intergenic
923841407 1:237675500-237675522 ATTACTACGCAGTGGCTGGAAGG - Intronic
923947010 1:238899309-238899331 CATTTGAGTCAGTGGGTGGATGG - Intergenic
924378740 1:243440536-243440558 AATTCTGGGAAATGGCTGGAAGG + Intronic
1063737360 10:8774516-8774538 AATTCTATGCACTGGATGCAGGG + Intergenic
1064372451 10:14764500-14764522 AATTTTAGGCAGTTAGAGGAAGG - Intronic
1064951005 10:20850239-20850261 GATCCCAGGCAGTGGGTGGCTGG + Intronic
1066930490 10:41752185-41752207 AATTCAAAGCAGTGTGTAGAGGG + Intergenic
1067066460 10:43106696-43106718 AGTGCTGGGCAGAGGGTGGAGGG - Intronic
1067301248 10:45012324-45012346 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1069370475 10:67742491-67742513 CATTCAAGGCAGTGTGTGGAGGG + Intergenic
1072417989 10:95264778-95264800 AAGTCTAGGGTGGGGGTGGAGGG - Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1075567532 10:123515476-123515498 AAATGCAGGCAGTGGGTGCATGG - Intergenic
1075669314 10:124253032-124253054 AACTCTGGGCACTGAGTGGATGG - Intergenic
1076387937 10:130071997-130072019 AATTCTAGGAGGTGGGAGGTGGG - Intergenic
1077818736 11:5714572-5714594 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1078663200 11:13303770-13303792 AATTCTGGCCAGTGGGTGGGAGG - Intronic
1078726435 11:13936192-13936214 AATTCAAAGCAGTGTGTAGAGGG - Intergenic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079573705 11:21976669-21976691 AATTCTAGGCAGAGAGGGGTGGG - Intergenic
1079947756 11:26765046-26765068 AATTCCAGACAGTTGGTGGAGGG - Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1081334016 11:41842247-41842269 AACTCTAGGCAGACGGTGGCAGG + Intergenic
1081758070 11:45558841-45558863 ACTTATAGGCAGGGGATGGAGGG - Intergenic
1082314937 11:50706439-50706461 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1084095144 11:66906484-66906506 AGTTCTAGGCCAGGGGTGGAGGG - Intronic
1084878629 11:72153478-72153500 AATTCAAGACAGTTTGTGGAGGG + Intergenic
1086437881 11:86800089-86800111 AGTTCTAGGCTGTTGGGGGAGGG + Intronic
1086687258 11:89747041-89747063 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1087634371 11:100686904-100686926 AATTGTAGGGAGTGGGTGGAGGG + Intergenic
1088269982 11:108024190-108024212 AATTATAGGCAGTAAGTGGCAGG - Intronic
1088722544 11:112607183-112607205 AGATTCAGGCAGTGGGTGGATGG + Intergenic
1089763754 11:120748279-120748301 AGTGCTTGGCAGGGGGTGGAAGG - Intronic
1090409906 11:126501014-126501036 ATGTCTCGGCAGCGGGTGGAGGG - Intronic
1091576061 12:1736764-1736786 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1092058829 12:5531422-5531444 AATTCCAGCCAGAGGGTGGAGGG + Intergenic
1092570870 12:9720006-9720028 AGTGCAAGGCAGTGAGTGGAAGG + Intronic
1093270027 12:17049062-17049084 AATTCAAAGCAGTGTGTAGAGGG + Intergenic
1098096676 12:66964441-66964463 AATTCTAGGGTGTGGGTGAATGG - Intergenic
1101725244 12:107383282-107383304 AACTCAGGGCTGTGGGTGGAAGG - Intronic
1105073010 12:133247913-133247935 CATTCAAAGCAGTGGGTAGAGGG + Intergenic
1106357426 13:28997046-28997068 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1108495177 13:51017967-51017989 AAATGTATGGAGTGGGTGGAAGG - Intergenic
1110097229 13:71543078-71543100 AAACTTAGGCAGTGGGTGAAAGG - Intronic
1111004647 13:82231987-82232009 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1111140244 13:84108157-84108179 CATTCTAAGCAGTCGTTGGAAGG + Intergenic
1112619592 13:101041041-101041063 AATCCTAGACAATGGGTTGACGG - Intergenic
1116727317 14:48576575-48576597 ATTTATAGACAGTGGGTGGAAGG - Intergenic
1117465677 14:55991338-55991360 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1117468342 14:56017166-56017188 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1119600378 14:75971972-75971994 ATGTCAAGGCAGTGGGAGGAGGG - Intronic
1121151904 14:91643361-91643383 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1122120566 14:99551298-99551320 GATTGGAGGCAGTGGGGGGAAGG + Intronic
1122930282 14:104930035-104930057 AATTCTGGGTTGTGGATGGACGG + Exonic
1202846374 14_GL000009v2_random:180985-181007 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1202915838 14_GL000194v1_random:171587-171609 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1124796061 15:32781113-32781135 AATTCTAGGTAGTGGGAATATGG + Intronic
1127189282 15:56512676-56512698 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1130051322 15:80486310-80486332 AATTTTGGGCAGGGGGTGGTTGG + Intronic
1130067276 15:80615196-80615218 TAGTGTGGGCAGTGGGTGGAGGG + Intergenic
1131189416 15:90301645-90301667 CATTCTTGGCAGGGGGTGGGAGG + Intronic
1131396047 15:92087161-92087183 AACTATAGGCGGTGGGCGGAGGG - Intronic
1132425326 15:101710970-101710992 AATTCAGGGCAGGAGGTGGACGG + Intronic
1133361172 16:5174943-5174965 ATTTCAAGGCAGTGTTTGGAGGG + Intergenic
1134396255 16:13866537-13866559 AATTCTACCCAGTGGTTGCATGG + Intergenic
1134396265 16:13866709-13866731 AATTCTACCCAGTGGTTGCATGG + Intergenic
1136559874 16:31033089-31033111 CTTTCGAGGCAGTGGGTGGTAGG - Intronic
1136992502 16:35162999-35163021 CATTCTAAGCAGTGTGTAGAGGG + Intergenic
1137224778 16:46492830-46492852 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1137228508 16:46538335-46538357 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1138720655 16:59075227-59075249 AATTCAAAGCAGTGTGTAGAGGG + Intergenic
1139106533 16:63833705-63833727 ACTTCTAAGCAGTGGGTGTATGG - Intergenic
1140445690 16:75025863-75025885 AACACCAGGCAGTGGGGGGACGG + Intronic
1141047598 16:80729941-80729963 CATTCAAAGCAGTGGGTAGAGGG + Intronic
1141305102 16:82855461-82855483 AATTGTAGGCACTGGGTGTATGG + Intronic
1142102604 16:88283584-88283606 AATTCTAGGTGGTGGGTTGGGGG + Intergenic
1142150558 16:88510786-88510808 AAGGGTAGGCAGTGGGTGGGTGG - Intronic
1145718123 17:27042813-27042835 AATTCAAAGCAGTGTGTAGAGGG - Intergenic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1148135133 17:45287125-45287147 GGGTCTGGGCAGTGGGTGGAGGG + Intronic
1148686068 17:49501958-49501980 AATAGAAGGCAGTGGGAGGAGGG + Intronic
1148713070 17:49695950-49695972 AATTCTAGGTAGTGTGTAGTGGG + Intergenic
1153304932 18:3622751-3622773 AACTCCAGGCTGTGGCTGGAAGG - Intronic
1153382003 18:4450813-4450835 AATCCTAGGGAGAGGGAGGAAGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1155799923 18:30089108-30089130 AATTCTAGGCAGACAGGGGAAGG + Intergenic
1156873034 18:41970073-41970095 AATTCTACACAGAGAGTGGAAGG - Intronic
1158168744 18:54572662-54572684 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1159349517 18:67253619-67253641 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1160960984 19:1720735-1720757 ATTTCCAGGCAGTTGGAGGAAGG - Intergenic
1163444069 19:17336676-17336698 AATTCCAGGCACTGGCTGGGCGG - Intronic
1163445008 19:17340979-17341001 AATTGAAGGCACTGGGTGGAGGG - Intronic
1164630420 19:29758171-29758193 AATTCTGGGTAGTGTGTGGAAGG + Intergenic
1164919492 19:32078177-32078199 AATGCTTGGCAGGGAGTGGAAGG - Intergenic
1165600476 19:37051871-37051893 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1165901152 19:39169922-39169944 ACTTGGAGCCAGTGGGTGGAGGG - Intronic
1166440328 19:42808604-42808626 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1168640715 19:58029537-58029559 AGTTCCAGGCGGAGGGTGGAGGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925658112 2:6171678-6171700 AATTCTAGGAAATGGGGGGTGGG + Intergenic
927335188 2:21913857-21913879 AATTCTTGGCAACGGGAGGAAGG - Intergenic
927917374 2:26945771-26945793 AACTCCAGGCTGTGGGTGGAAGG - Intronic
928151249 2:28831411-28831433 AATTCTAGGCAGTAGGGATATGG + Intronic
929239135 2:39635817-39635839 AAATCTAGGGGATGGGTGGATGG - Intergenic
930525472 2:52524475-52524497 AATTCTAGGCAGACAGGGGAGGG + Intergenic
930653148 2:53982580-53982602 AATTCTAGGCAGTGGGTGGAAGG - Intronic
931967449 2:67549274-67549296 AAATGTAGGCATTGGGTGCAAGG + Intergenic
932495192 2:72142725-72142747 AGTTCTGGGGAGTGGCTGGAAGG - Intronic
933732164 2:85465208-85465230 ACTCCTAGCCACTGGGTGGAAGG - Intergenic
935373366 2:102370501-102370523 AGTTATAGGCAGTGGGTCCATGG - Intronic
936903914 2:117514810-117514832 CATCCCAGGCAGTGGGTGGTTGG + Intergenic
937211183 2:120272511-120272533 AAGTCCAGGCAGTGAGTGTATGG + Intronic
937530266 2:122819500-122819522 AATACTAGGCTGTGAGTGGTTGG + Intergenic
937682042 2:124654483-124654505 AATTCGGGGCTGTGTGTGGAAGG + Intronic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
939991463 2:148879940-148879962 ATTTCTTGGCAGTAGATGGATGG + Intronic
943914509 2:193612138-193612160 AAATCTAGGCTATGGGTGGTTGG + Intergenic
943942060 2:194011022-194011044 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1169710864 20:8561899-8561921 AATTTTAGGTGATGGGTGGAGGG - Intronic
1170978764 20:21191404-21191426 AATTGAATGCACTGGGTGGAAGG + Intronic
1171098993 20:22364671-22364693 GATTCAATGCAGTGGGAGGATGG - Intergenic
1171108129 20:22455639-22455661 TATTCTTGACAATGGGTGGATGG - Intergenic
1171404798 20:24903447-24903469 CATTCAATGCAGTGGGTAGAGGG + Intergenic
1171912200 20:30973604-30973626 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1172155778 20:32823282-32823304 AACTCTAGTCACTAGGTGGAGGG + Intronic
1174516780 20:51098673-51098695 AATAAAAGGCAGGGGGTGGAGGG - Intergenic
1176635191 21:9186234-9186256 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1176967179 21:15224475-15224497 AATTCTTGGCAGAGAGTAGAGGG + Intergenic
1177554351 21:22670702-22670724 AATTTTAGGGAGGGGATGGAAGG + Intergenic
1179956472 21:44742194-44742216 AATCCAAGGCAGTTTGTGGAGGG - Intergenic
1180414957 22:12700562-12700584 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1182259213 22:29060950-29060972 ATTTCTAAGAACTGGGTGGAAGG - Intronic
1182798194 22:33006656-33006678 AATTCATGGCTGTGGATGGATGG + Exonic
1183915519 22:41115340-41115362 AATTCTTTGTTGTGGGTGGAGGG - Intronic
1185287185 22:50007251-50007273 AAACCTACGCATTGGGTGGAGGG - Intronic
950117876 3:10463193-10463215 ACCCCAAGGCAGTGGGTGGAGGG - Intronic
950697624 3:14715474-14715496 AATGCTAGGCAGTGCATGGCAGG - Intronic
951769723 3:26242214-26242236 CATTCTAAGCAGTGTGTAGAGGG - Intergenic
951912762 3:27768651-27768673 AGTTCTAAGCAGTTGGAGGAGGG - Intergenic
952866374 3:37857876-37857898 AAATCTAGGCTGTGCGTGGTGGG + Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
954933308 3:54303174-54303196 GATTCTAAGCTCTGGGTGGATGG + Intronic
955219440 3:57011569-57011591 AATTCTTTGCTGTGGGTGGCGGG - Intronic
955769937 3:62376590-62376612 AGTTTTAGGGAGTCGGTGGAAGG + Intergenic
959158042 3:102690481-102690503 AATTCTAGGTTCTGGGTGCAGGG - Intergenic
959778881 3:110204172-110204194 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
960154057 3:114279736-114279758 CATTCAAAGCAGTGTGTGGAGGG + Intronic
960339573 3:116458166-116458188 CATTCAAAGCAGTGGGTAGAGGG + Intronic
962008679 3:131372418-131372440 AATTCCAGGCTGTGGATGTAGGG + Intergenic
962036268 3:131654883-131654905 AATTCTATGCAGTGGGGGACTGG - Intronic
964435116 3:156643367-156643389 AAGTCCAGGGAGTGGTTGGAGGG - Intergenic
965645951 3:170881713-170881735 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
966269753 3:178090668-178090690 CATTCCAGCCTGTGGGTGGAAGG + Intergenic
966909047 3:184548024-184548046 AATTCAGGACAGTGGTTGGAGGG - Intronic
967162576 3:186751812-186751834 AATTCTAGGCTCTTGGAGGAAGG - Intergenic
967441191 3:189511074-189511096 AATTGGAGGCACTGGGTAGAAGG - Intergenic
967623024 3:191657531-191657553 AATTTTGGTCAGTGTGTGGATGG + Intergenic
968388583 4:169004-169026 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
968847318 4:3052213-3052235 AATTCAAGACAGTTTGTGGAGGG - Intergenic
970120886 4:12751121-12751143 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
970204553 4:13643108-13643130 GGTTCTAGGCAGTAAGTGGATGG - Intergenic
971240068 4:24880461-24880483 AACTCTAGGAAGTGGGGAGAAGG + Intronic
972750438 4:41982560-41982582 AAATCGAGGCAAGGGGTGGAGGG + Exonic
972946915 4:44267384-44267406 CATTCAAGGCAGTGTGTAGAGGG + Intronic
977084055 4:92571873-92571895 CATTCAAGGCAGTGTGTGGAAGG + Intronic
977391191 4:96412349-96412371 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
977497650 4:97798334-97798356 CATTTAAGGCAGTGGGTAGAGGG - Intronic
977703451 4:100046677-100046699 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
979047005 4:115879796-115879818 AATTCTAGTCATTCAGTGGAGGG - Intergenic
979315095 4:119252885-119252907 CATTTAAGGCAGTGTGTGGAAGG - Intronic
980422378 4:132580378-132580400 AATGCTGGACAGGGGGTGGAAGG - Intergenic
980507021 4:133737086-133737108 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
980715581 4:136624480-136624502 AGTTCTAGGAAGTTGGAGGAAGG - Intergenic
981161742 4:141507041-141507063 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
982200571 4:152956594-152956616 GATTCAAGGCAGTGCCTGGATGG - Intronic
983333641 4:166363715-166363737 AAATCAGTGCAGTGGGTGGAGGG + Intergenic
984227340 4:177050948-177050970 CATTCTAGGAACTGGGTGAAAGG + Intergenic
984905024 4:184618523-184618545 AGTTCTAGGCTGTGAGGGGATGG - Intergenic
986069156 5:4265337-4265359 AATTCCAGGCAGCAGGTGGGAGG + Intergenic
986624788 5:9713470-9713492 AATTCAAAGCAGTGGGGGGTGGG - Intergenic
988449035 5:31321166-31321188 AGTTCTAGGCACTGAGTGGGTGG - Intronic
989655584 5:43744368-43744390 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
991398920 5:66233888-66233910 AAGTCTGGGCAGTGAGTGGGAGG + Intergenic
993142641 5:84053298-84053320 CATTCAAAGCAGTGGGTAGAGGG + Intronic
993372713 5:87112425-87112447 AACTGTATGCAGTGGGTTGAGGG - Intergenic
993611299 5:90057704-90057726 TACTTTAGGGAGTGGGTGGAAGG - Intergenic
994712472 5:103282456-103282478 ACTTCTAGGGAGTGGGGGGAAGG - Intergenic
995433023 5:112103532-112103554 AATTGTGGGCAGTGGTTGGTGGG + Intergenic
995609433 5:113893295-113893317 AATTCTCTGCAGTGTGTGTATGG + Intergenic
996027463 5:118664008-118664030 AATTCTATACAGTTGGTTGATGG + Intergenic
996057871 5:119000537-119000559 AATTCAAGACAGTTAGTGGAGGG + Intergenic
997076892 5:130689565-130689587 AATTCTTGGAGGTGAGTGGACGG - Intergenic
997376526 5:133401468-133401490 TATTGCAGGCAGGGGGTGGAGGG - Intronic
998803450 5:145894123-145894145 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
998918584 5:147042736-147042758 AAATCTAGGCAGTGAGATGAAGG + Intronic
999218804 5:149958252-149958274 AATCAAAGGCAGCGGGTGGAGGG - Intergenic
1001898338 5:175400624-175400646 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004270127 6:14187620-14187642 AAGTCCAGGCAGTGAGAGGAAGG + Intergenic
1005448726 6:25952677-25952699 AACTCAAGACAGTGTGTGGAGGG + Intergenic
1006079170 6:31555181-31555203 AATTCTAGCCTATGGGTGGTGGG - Intronic
1006410236 6:33869339-33869361 CAATCCAGGTAGTGGGTGGATGG + Intergenic
1006921451 6:37630265-37630287 ATTTCTAGGCAGTTTGTGGGTGG - Intergenic
1007682517 6:43644460-43644482 AAATCTAGGCAATGGGGGCAAGG - Intergenic
1009875357 6:69498208-69498230 AATTCAAAGCAGTGTGTGGAGGG + Intergenic
1010247423 6:73674624-73674646 AATTTGGGGTAGTGGGTGGAAGG - Intergenic
1010939126 6:81895253-81895275 AATTCTAGGGACTGTGTGGATGG - Intergenic
1011246244 6:85324089-85324111 AATTCTATGCTGTGTGTGGATGG - Intergenic
1011376460 6:86692533-86692555 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1012111048 6:95234108-95234130 ACTTCAAGGCTGTGGGTGGCCGG - Intergenic
1012594655 6:101025140-101025162 AATTCAAGGCAGTTCATGGAGGG - Intergenic
1015420414 6:133001703-133001725 ATTTCAAGGCAGTGTGTTGAAGG - Intergenic
1016093018 6:140001863-140001885 AATTCTAGGGTGTGGGGAGAGGG + Intergenic
1016979022 6:149837297-149837319 ATTGCTAGGCAGTGGCTGGAAGG - Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019501242 7:1365757-1365779 TGTTCTAGGCACTGGGGGGATGG + Intergenic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1020531136 7:9337124-9337146 ATTTCTAGCAAGTTGGTGGAAGG - Intergenic
1022696479 7:32710988-32711010 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1022924999 7:35047964-35047986 GATTCATGGCAATGGGTGGACGG - Intergenic
1022953960 7:35364410-35364432 GAGTCCAGGCAGAGGGTGGAAGG - Intergenic
1024437021 7:49369199-49369221 ATTTCTAGGCACTGGGGAGAGGG - Intergenic
1025776772 7:64567941-64567963 GATTCTAGGGAGGGGGTGGGAGG - Intergenic
1026994305 7:74605910-74605932 CATTCTGGGCCCTGGGTGGACGG - Intergenic
1027351925 7:77320970-77320992 AATTCTAGGCATTAGGCCGATGG - Intronic
1027357237 7:77369953-77369975 CCTTCTCGGCAGTGTGTGGAAGG - Intronic
1027510021 7:79068740-79068762 AATTTAAAGCAGTGTGTGGAGGG - Intronic
1028275962 7:88857101-88857123 CATTCAAAGCAGTGCGTGGAGGG + Intronic
1029811082 7:103049848-103049870 AATTCAAGACAGTTGGTGGAGGG + Intronic
1029940971 7:104480331-104480353 AAATCTGGGCGGTGGGGGGACGG - Intronic
1030213570 7:107020556-107020578 AATTCAAGGCAGTGAGAGCAAGG + Intergenic
1030458047 7:109797959-109797981 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1030851562 7:114492563-114492585 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1030894658 7:115042885-115042907 AATACTAGAAAGTGGGTGGGTGG + Intergenic
1031453741 7:121954340-121954362 AATGCAAGGCAGTGAGTGGAGGG - Intronic
1033408560 7:141094504-141094526 TATTCTAAGCACTGGGTGGCTGG + Intronic
1033578475 7:142709759-142709781 CATTCTGGGCGGTGGGGGGAAGG - Intergenic
1035946338 8:3967638-3967660 AATTGTAGGCAGGGAATGGAGGG - Intronic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037638746 8:20723413-20723435 CAGTCCAGGCAGTGAGTGGATGG - Intergenic
1037757963 8:21723624-21723646 GATTCTCTCCAGTGGGTGGAAGG + Intronic
1038116512 8:24561679-24561701 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1038225952 8:25658092-25658114 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1038486069 8:27936047-27936069 AATTCTGGGCAGGGGCTGGCGGG - Intronic
1038854797 8:31319780-31319802 ATGTCAAGGCAGTGAGTGGAGGG - Intergenic
1039576985 8:38631583-38631605 AACTCTGGGCAGTGGGGGTAAGG - Intergenic
1040086414 8:43347589-43347611 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1040584085 8:48723780-48723802 AACTCCAGGCAGTGGGGGGATGG + Exonic
1040633386 8:49242147-49242169 GATTCTAGGGACTGGGAGGAGGG - Intergenic
1041286087 8:56263536-56263558 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1044080133 8:87873182-87873204 AAATCAAGGCAGCGGGTGGAAGG - Exonic
1044423769 8:92028027-92028049 AATAGTAGGCATTGGATGGACGG + Intronic
1045020887 8:98043526-98043548 AATTCTGGGCACTGAGGGGATGG - Intronic
1045129664 8:99135758-99135780 AATTCTAGGCTGTGTTTGGGTGG + Intronic
1045428261 8:102088311-102088333 AATTCAAGACAGTTTGTGGAGGG - Intronic
1046475881 8:114742332-114742354 AGTTCTGGGCAGTGTGTGAATGG - Intergenic
1046694523 8:117324533-117324555 ATTTCTAGGGAGTGGTAGGAGGG + Intergenic
1047837498 8:128710222-128710244 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1050808721 9:9717729-9717751 ATTTCTGTGCAGTGGATGGAAGG + Intronic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1051584665 9:18714089-18714111 CATTCAAGGCAGTGTGTAGAGGG + Intronic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1052239350 9:26252623-26252645 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1052645366 9:31227662-31227684 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1053590230 9:39506330-39506352 AATTCATGGCATTGGGTGGGTGG + Intergenic
1053847988 9:42260499-42260521 AATTCATGGCATTGGGTGGGTGG + Intergenic
1054576071 9:66858959-66858981 AATTCATGGCATTGGGTGGGTGG - Intronic
1054796307 9:69305660-69305682 AATTCCAGACAGTTTGTGGATGG + Intergenic
1055333224 9:75205783-75205805 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1057246366 9:93458450-93458472 TATTCTAGGGACTGGGAGGATGG - Intronic
1057965776 9:99501593-99501615 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1059456494 9:114403229-114403251 AATCCTAGGCAGGGGCTGGCGGG + Exonic
1059635153 9:116163157-116163179 TATTCTGGGCAGTGGGTGTTGGG + Intronic
1060432768 9:123564576-123564598 AATTCTAGGCAGGGGGGCAATGG - Intronic
1060437147 9:123603655-123603677 AGTTCAAGGCAGTAGGTGCAGGG - Intronic
1060448663 9:123716146-123716168 AATTCTAGGGAGTGGTAGAAAGG + Intronic
1060812448 9:126617451-126617473 AATTATGGGGAGTGGGGGGAGGG - Intronic
1060860885 9:126954019-126954041 AAGTGTGGGCAGTGTGTGGAGGG - Intronic
1061403476 9:130381268-130381290 AATTCTAGGCTGGGGCTGGCCGG - Intronic
1062685136 9:137808660-137808682 AATTCTGGGCGGGGGGTGGGGGG + Intronic
1203757970 Un_GL000218v1:153541-153563 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1186540964 X:10399280-10399302 CAGGCCAGGCAGTGGGTGGAAGG + Intergenic
1186942792 X:14529257-14529279 AATGCTAGGCTGTCGGTGGGTGG - Intergenic
1187362413 X:18640976-18640998 ATTGCAAGGCAGAGGGTGGAGGG + Exonic
1188494656 X:30770916-30770938 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1189188006 X:39070510-39070532 AACTCGAAGCAGGGGGTGGAGGG + Intergenic
1189238185 X:39505094-39505116 AATTCTCAGCACGGGGTGGAGGG + Intergenic
1189391951 X:40583824-40583846 GATTCCAGCCACTGGGTGGAAGG + Intronic
1190601106 X:52093777-52093799 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1190734043 X:53243506-53243528 AATTATGGGCACTGGGTGGTAGG + Intronic
1190804508 X:53822094-53822116 AATTCTAAGCAGAGTGTTGAAGG - Intergenic
1191118081 X:56871963-56871985 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191134781 X:57051894-57051916 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191681186 X:63841620-63841642 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1191811314 X:65191952-65191974 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1191890847 X:65938766-65938788 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1192361303 X:70442017-70442039 AATCCTAGGCAGTGGGTAATTGG + Intergenic
1192712090 X:73601550-73601572 CATTCAAAGCAGTGTGTGGAGGG + Intronic
1192842913 X:74876142-74876164 CATTCAAAGCAGTGTGTGGAGGG - Intronic
1193002397 X:76577603-76577625 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1193164056 X:78261795-78261817 CATTCAAAGCAGTGTGTGGAGGG - Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1193387700 X:80890762-80890784 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1193766255 X:85532056-85532078 CATTCAAAGCAGTGGGTAGAGGG + Intergenic
1194164957 X:90504666-90504688 AATTCTATGCATTGGTTGCAGGG + Intergenic
1194628774 X:96257358-96257380 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1195441821 X:104907454-104907476 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1196409683 X:115402403-115402425 AATACCAGGCAGTGGGTAGAAGG - Intergenic
1196563125 X:117174187-117174209 AATTCAAGGCGGTTCGTGGAGGG - Intergenic
1198181998 X:134219426-134219448 AATTCAAGACAGTTTGTGGAGGG + Intergenic
1198241135 X:134787000-134787022 GATTATAGGCAGTGGGTATATGG + Intronic
1200511218 Y:4082469-4082491 AATTCTATGCATTGGTTGCAGGG + Intergenic
1200784962 Y:7252711-7252733 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1200871111 Y:8099611-8099633 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1201570550 Y:15409094-15409116 CATTCAAAGCAGTGTGTGGAGGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic