ID: 930658446

View in Genome Browser
Species Human (GRCh38)
Location 2:54030157-54030179
Sequence TGGGGGCCCCAGGACCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 7, 3: 26, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930658446 Original CRISPR TGGGGGCCCCAGGACCTTCA AGG Intronic
900182820 1:1319896-1319918 TGGGGTCCCCAGTGCCTTCCTGG - Intronic
900491361 1:2950747-2950769 TCGGGGCCCCAGGAGCTGAAAGG + Intergenic
900591827 1:3463554-3463576 TGGCTTCCCCAGGCCCTTCATGG - Exonic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
902230197 1:15022851-15022873 TGAGGGACCCAGGACCATCCAGG - Intronic
902758790 1:18567221-18567243 GGGGTGGGCCAGGACCTTCATGG + Intergenic
903144407 1:21361448-21361470 TTGAGGCCCCATGGCCTTCAAGG - Intergenic
904001214 1:27339850-27339872 TGGGGGCGCCAGGACCAGGATGG + Intergenic
904197747 1:28798498-28798520 AGGGGACCCAAGGACCTTCCTGG - Intergenic
905171547 1:36112790-36112812 ATGGGGCCCCAGAACCTGCATGG - Intronic
905434817 1:37949029-37949051 TGGTGGCCCCAGGAGCTGCCTGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906375577 1:45294052-45294074 TGAGTGCCCCAGGACTTTTAGGG + Intronic
906514804 1:46432593-46432615 TGGGGTCCCCATGAGCCTCAAGG + Intergenic
907305358 1:53509970-53509992 CGGTGGCCCCAGCCCCTTCAGGG + Exonic
907730418 1:57060534-57060556 CGAGGACCCCAGGACATTCAAGG + Intronic
910238567 1:85061876-85061898 TGGGCGCCCCAGAACCCTAATGG - Intronic
912800774 1:112718730-112718752 TGGGGGCCACAAGACCTTCAGGG + Intergenic
912938212 1:114022094-114022116 TGAGGGCCCTAGTACCTTAAAGG - Intergenic
913517089 1:119613948-119613970 GGGGAGCCCCAGGACTGTCAGGG + Intergenic
915697245 1:157756231-157756253 TAGGGGTCCGAGGACCTTCATGG + Intronic
917220353 1:172722019-172722041 AAAGGGCCCCAGTACCTTCAAGG + Intergenic
921424599 1:214986720-214986742 AAGGAGCCTCAGGACCTTCAGGG + Intergenic
1064187566 10:13175609-13175631 TGGGGACCCCAGGAAGTTCTGGG + Exonic
1065022292 10:21510285-21510307 TGGGGGCCGCAGGGGTTTCAGGG - Intergenic
1066065788 10:31760014-31760036 TGCCGGCCCCAGGACCTGGATGG - Intergenic
1066109079 10:32180467-32180489 AAAGGGCCCCAGGACCTTCAAGG - Intergenic
1069896408 10:71682834-71682856 TGGGGGCCCCAGGACACCCTCGG + Intronic
1069917906 10:71798525-71798547 TGGGGGCACCAGGTCCAGCAGGG - Exonic
1071061022 10:81570911-81570933 TGGGGGCTCCAGGTCCTTGCTGG + Intergenic
1073124727 10:101142102-101142124 TGGCGGCCGCTGGACCTTCTGGG - Intergenic
1075513102 10:123088041-123088063 TGGGGCCCCCACTACCCTCAGGG + Intergenic
1076855522 10:133113874-133113896 TGGGAGGCCCAGGCCCTTCCTGG - Intronic
1076887209 10:133268295-133268317 TGGGGCCCCCAGGACATGGAGGG - Intronic
1076994646 11:292127-292149 TGGGGGCTGCAGGCCCTGCAGGG - Intronic
1077418523 11:2437126-2437148 GGGGATCCCCAGGTCCTTCATGG + Intergenic
1078101970 11:8335227-8335249 CGGGGTCCCCAGGCCCTTTATGG + Intergenic
1078521605 11:12068392-12068414 TAGGGGCCCCTGGATCTTCAGGG + Intergenic
1078867392 11:15310724-15310746 TGAGGGCCCCAGTAACTTTAGGG - Intergenic
1079318802 11:19432661-19432683 TGGGGGCCCCAGCTCCTTCCTGG - Intronic
1084113375 11:67027663-67027685 CGGGGGCCCCATCACCTCCATGG - Intronic
1084933931 11:72576978-72577000 TGGGGTCTCCAGGATCCTCATGG - Exonic
1085869661 11:80334487-80334509 TGGGTGCCCAAGAACCTGCAAGG + Intergenic
1088755213 11:112880048-112880070 TGTGGATCCCAGGAGCTTCAGGG - Intergenic
1089365733 11:117919934-117919956 TGGGGCCCCCTGGCCCTGCAGGG + Intronic
1090238733 11:125167017-125167039 CGGAGGCCCCAGGACCTTGGTGG + Intronic
1090494120 11:127193090-127193112 TCTGGGCCTCAGGTCCTTCATGG + Intergenic
1091372000 11:135068709-135068731 AGGGGGCACCAGGATCTCCAAGG + Intergenic
1091786857 12:3248207-3248229 GGGGGGCCACAGCACCTTGAAGG - Intronic
1091913400 12:4250274-4250296 TGGGGGCACCAGGACCAACTGGG + Intergenic
1093101405 12:15034080-15034102 AAAGGGCCCCAGTACCTTCAAGG + Intergenic
1093631430 12:21413918-21413940 TGAGGGCTCCAGTACTTTCAAGG - Intronic
1093882683 12:24423723-24423745 TGGGTGCCACAGGAGCCTCAAGG + Intergenic
1094682652 12:32679599-32679621 TGGGGGCCCCAGGGCTCTCCGGG + Intronic
1096216760 12:49802057-49802079 TGGAGGCCCCAGGACCCTTCTGG + Intronic
1096460992 12:51821406-51821428 GGGGGAGCCCAGGACCTTGAGGG + Intergenic
1099682419 12:85844877-85844899 TGGAGACTCCAGGACCTGCAGGG - Intergenic
1104060369 12:125262919-125262941 TGGGGGCACCAGGCTCTGCAAGG - Intronic
1105277418 13:18944048-18944070 CAGGGACTCCAGGACCTTCACGG + Intergenic
1111807297 13:93053558-93053580 TGAAGGCCCCAGTACCTTCAAGG + Intergenic
1112145097 13:96690493-96690515 TATGTGCCCCAGGACCTGCATGG + Intronic
1112328831 13:98461946-98461968 TGGGGGCGCTGGGACGTTCAGGG + Intronic
1113662772 13:112118414-112118436 TGCTGGGCCCAGGGCCTTCAGGG + Intergenic
1113897559 13:113775786-113775808 TCAGGGCCACAGGAGCTTCAGGG - Intronic
1113970795 13:114186634-114186656 TGGAGGCTCCAGGAACTGCAGGG - Intergenic
1114205173 14:20564189-20564211 TGAGGGCCCCAGTATCTTCAAGG - Intergenic
1114459458 14:22877382-22877404 TGGGGCCCCCAGGACCAACCCGG + Exonic
1116467661 14:45252697-45252719 TTGGGACCCCAGGACCCACAGGG - Intronic
1117523935 14:56578803-56578825 TGCTGGCCCCATGACCGTCAAGG + Intronic
1117571456 14:57052890-57052912 TGGGTGCCCCAGGTACTACAGGG - Intergenic
1118999825 14:70871936-70871958 TGGGGGCCCAAGGCCCTTCATGG - Intergenic
1119644621 14:76339469-76339491 TTGGGGCCCCATGAGCTTCCGGG + Intronic
1121336010 14:93077852-93077874 TAGGGCCACCAGGACCTGCAGGG + Intronic
1122182412 14:99965848-99965870 TGTGGGCCCCAGTACCTTCAAGG + Intergenic
1122354002 14:101112664-101112686 TAGGGGCCCCAGGAACTGCCTGG + Intergenic
1122882381 14:104695860-104695882 TGGGGGCCAGGGGTCCTTCATGG - Intronic
1123144608 14:106116566-106116588 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123156814 14:106234993-106235015 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123203720 14:106692156-106692178 TGGGGCCCTCAGGACCTGCAGGG - Intergenic
1123207585 14:106728094-106728116 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123212596 14:106775088-106775110 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123939628 15:25210586-25210608 TGGGGGCCACAGGGCCTCCGGGG + Intergenic
1124383123 15:29184543-29184565 TGGAGGCCCCAGGATGTGCAGGG - Intronic
1124591914 15:31061231-31061253 TGGGTGCTCCTGGACCATCATGG - Intronic
1124626705 15:31311906-31311928 TGGGGGCCCCAGAAGCTTCTTGG + Intergenic
1124662825 15:31563943-31563965 TGCGTGCCCCAGGAGCTTCAGGG + Intronic
1126080472 15:44956588-44956610 TGAGGGCCTCAGGCCCTTCCCGG + Intergenic
1126858227 15:52859343-52859365 TGGGGGCCCTAGGATCTTCTTGG + Intergenic
1127775203 15:62259160-62259182 TGAGGGCCCTGGTACCTTCAAGG - Intergenic
1127973947 15:63983505-63983527 TGGGGTCCCCAGGACCCACAGGG - Intronic
1128392923 15:67195245-67195267 CGGGGGTCCCAGGGACTTCAGGG + Intergenic
1128498501 15:68211366-68211388 TTGGGGCCCCAGCACCTCCCTGG - Intronic
1128617319 15:69120414-69120436 TGGGGCCCATAGGACTTTCAGGG + Intergenic
1128867941 15:71129538-71129560 TGGGGGACCCTTGACCTCCAAGG + Intronic
1128995273 15:72290268-72290290 TGGGGTCCCCAGGTCATTCCTGG - Intronic
1129522953 15:76197232-76197254 TGGGGACCCCAGGAACCCCAGGG + Intronic
1129524614 15:76205870-76205892 GGGGGGCCACAGGAGCTCCAAGG - Intronic
1129625927 15:77199384-77199406 CGGGGGCCATAGGACCTTTAAGG + Intronic
1130649909 15:85756598-85756620 TGGGGGGCCGATCACCTTCATGG + Intergenic
1131177669 15:90220120-90220142 TGGGTGGCACAGGATCTTCATGG - Intronic
1131831181 15:96355542-96355564 AGTGGGCCCCAGGACCCTCTTGG + Intergenic
1132975547 16:2709568-2709590 CCGGGACCCCAGGACCTTCTCGG - Intergenic
1133136587 16:3716888-3716910 TGGCGTCCCCAGAACCTGCACGG + Intronic
1134403248 16:13931954-13931976 TGGGGGCCCCTGGGAGTTCACGG + Intronic
1137468680 16:48734767-48734789 TGGGGGCCACATGCCATTCAAGG - Intergenic
1138476063 16:57271229-57271251 TGGGGGCTGCAGGACCTTGCTGG - Intronic
1138512400 16:57516219-57516241 TGGGGGCCGCAGGGCCATCCTGG - Intronic
1138656120 16:58492423-58492445 TGGGGGCCCCAGGAGATGAAGGG - Intronic
1139478145 16:67213460-67213482 TGGGGCCTGCAGGACTTTCAGGG - Intronic
1139955361 16:70690566-70690588 TGAGGTCCCCAGGGCCTTGATGG + Intronic
1141025327 16:80541199-80541221 TGGTGGCTCCAGGATCTTCCTGG + Intronic
1141177782 16:81732085-81732107 CTGTGGCCCCAGGACCTACAAGG + Intergenic
1141639808 16:85334527-85334549 TCGGGACACCAGGTCCTTCAAGG - Intergenic
1142195462 16:88737415-88737437 TCGGGGGCCCAGGACATCCACGG - Intronic
1142199807 16:88755745-88755767 TGGGGGCCCCCGGCCTCTCATGG - Intronic
1142225162 16:88873615-88873637 AGGGGGCCCCAGAGCCTTCCTGG + Intergenic
1142252023 16:88996404-88996426 TGGGGTCCCAGGGACCTCCAAGG - Intergenic
1142362830 16:89635424-89635446 TGGGGGTCCCAGGCCCCCCAAGG + Intronic
1142601328 17:1054451-1054473 TGGGGGCACAAGGAACCTCAGGG + Intronic
1142601378 17:1054602-1054624 TGGGGGCACAAGGAACCTCAGGG + Intronic
1142601403 17:1054677-1054699 TGGGGGCACAAGGAACCTCAGGG + Intronic
1145127454 17:20314066-20314088 TGGCTGCCCCAGGCCCTCCAGGG - Exonic
1145787376 17:27603071-27603093 TGGTGGCCCCAGGGCCGCCATGG - Intronic
1146627503 17:34445496-34445518 TGCCAGCCCCAGGACCTCCATGG - Intergenic
1148715192 17:49710966-49710988 TGGGGGACTCAAGACCTTCTGGG + Exonic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1151280948 17:73073599-73073621 GGGGAGCCCCAGGGCCTCCAAGG - Intronic
1151568959 17:74916490-74916512 TGGGGGCCCCAGGAGATGCTGGG + Exonic
1152113013 17:78367487-78367509 TGGGGGCTGCAGGACCTGCCTGG + Intergenic
1152195952 17:78918453-78918475 TGGTGTCCCCAGGACCTCCCAGG - Intronic
1152363403 17:79842541-79842563 TTGGGCCCCCAGGGCCCTCAGGG + Intergenic
1152537884 17:80960942-80960964 TGGAGGCACAAGGACCTTCTGGG - Intronic
1154148192 18:11884108-11884130 TGGGGCCACCAGGCCCTTCCTGG + Exonic
1154325993 18:13390763-13390785 TGGGTGCGCCAGCACCTGCAGGG + Intronic
1154437960 18:14361069-14361091 TGGGGGCACCAGTGCCTGCACGG + Intergenic
1157006343 18:43589169-43589191 TGGAGGCTCCAGGAACTGCAGGG + Intergenic
1160620105 18:80164522-80164544 TGGGGGGTCCTGGGCCTTCAAGG + Intronic
1161575409 19:5051977-5051999 TGGGGGCTCCGTGCCCTTCACGG - Intronic
1161580837 19:5079997-5080019 TGGGGACCCCATGTCCTGCACGG + Intronic
1161584510 19:5097908-5097930 TGGGGGCCCCAGGTCCACGACGG - Intronic
1161713642 19:5863734-5863756 TGGGGGCTCCAGGGGCGTCAGGG + Intergenic
1162300374 19:9841678-9841700 TGGAAGGCCCAGAACCTTCAGGG + Intronic
1162582378 19:11539145-11539167 TGGGGGCTCCGGGATGTTCAGGG - Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1164399552 19:27893242-27893264 TGGGGGGCTCAGGGCCTGCAAGG - Intergenic
1165404206 19:35619926-35619948 CTGGGGGCCCAGGAACTTCAAGG - Intronic
1165797860 19:38529088-38529110 GGGTGGCCCCAGGACCTTGGGGG - Intronic
1167748392 19:51366255-51366277 GGGGGGCCCGATCACCTTCACGG + Intronic
1168171504 19:54592936-54592958 AGAGGGTCCCAGGACCTTCAAGG - Intronic
925259841 2:2519853-2519875 TGGAGGCCCCAGGAGCTCCCCGG + Intergenic
925459685 2:4049728-4049750 AAAGGGCCCCAGTACCTTCAAGG - Intergenic
926013293 2:9425134-9425156 TGGGGGGCCCAGGATGTTCTAGG + Intronic
928174930 2:29027062-29027084 TGTGTGCCCCAGGCCCCTCAGGG - Intronic
929946870 2:46378292-46378314 TGGGGGCTCAAAGCCCTTCAAGG - Intronic
930177493 2:48315166-48315188 GGGGGCCCCAAGGACCCTCAGGG + Intronic
930658446 2:54030157-54030179 TGGGGGCCCCAGGACCTTCAAGG + Intronic
931287963 2:60848564-60848586 AAAGGGCCCCAGTACCTTCAAGG - Intergenic
932508094 2:72256156-72256178 TGGTGGCCCCAGGAGCTCCCTGG - Intronic
936399826 2:112156622-112156644 TGAGTGCCCCAGGACCTGCGTGG + Intronic
936983665 2:118287898-118287920 TGGGCCACCCAGGACCTTCTTGG + Intergenic
937056016 2:118937510-118937532 AAAGGGCCCCAGTACCTTCAAGG + Intergenic
937223044 2:120353120-120353142 TGGGGTCCCCAGGCCCTTCCTGG - Intergenic
937882827 2:126881343-126881365 TGGGGGCCCCAGGGACTGGAGGG + Intergenic
940774341 2:157871315-157871337 TGGGGGACCCAGATTCTTCAAGG - Intronic
942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG + Intergenic
942074418 2:172343587-172343609 GGTGGGACCCAGGAGCTTCAAGG - Intergenic
943471340 2:188297565-188297587 TGGTTCCCCCAGGAACTTCAAGG - Intronic
948601301 2:239108886-239108908 TGGGGGCCCCAGAACCAACTGGG + Intronic
948605440 2:239131900-239131922 TGGGGGCCTCCAGGCCTTCAAGG + Intronic
948628401 2:239284676-239284698 TGGGGCCTCCAGGATCTGCAGGG + Intronic
948922702 2:241073198-241073220 GGGTGGCCCCAGGACCATCCCGG + Intronic
1169345374 20:4824147-4824169 TGGGGGCGCCAGGAGGTCCAGGG - Intergenic
1172225070 20:33299986-33300008 TGAGTGTCCCAGGACCTTGAGGG + Intronic
1173461915 20:43249689-43249711 ATGTGGCCCCAGGACCTCCACGG + Intergenic
1173872451 20:46350498-46350520 TGGTGGCCCCAAGGCCTTGAAGG - Exonic
1174179237 20:48664642-48664664 GGGATCCCCCAGGACCTTCAAGG + Intronic
1175364477 20:58442833-58442855 TGTGGTCCCCAGGACCTACTAGG + Intronic
1175890460 20:62313648-62313670 GGGGTACCCCAGTACCTTCACGG - Exonic
1176034480 20:63029517-63029539 GGGGGGTCCCCGCACCTTCACGG - Intergenic
1178845345 21:36169871-36169893 TTGAGGCCTCCGGACCTTCAAGG - Intronic
1179780215 21:43694756-43694778 AGAGGGCCCCAGGATCTCCAAGG + Exonic
1180180904 21:46118287-46118309 TGGCGGCCCCAGGATCCCCAAGG + Intronic
1181043701 22:20204771-20204793 AGGGGGCCCTAGGACCTGCCAGG + Intergenic
1181523013 22:23460103-23460125 TGGGGGTCCCAGGCACTGCAGGG - Intergenic
1181593253 22:23897186-23897208 TGACTGCCCCAGGACCTGCAGGG + Intronic
1182293323 22:29298743-29298765 TGGGTCCCCCAGGACCTCCTGGG - Exonic
1183050561 22:35257665-35257687 GGGGTGCCCCAGGCCCTTCGCGG + Intronic
1184654473 22:45934236-45934258 TGGGGGCAGAAGGACCTTCCAGG - Intronic
1184783244 22:46659432-46659454 TGTGGCCCCCATGACCTGCATGG + Intronic
1185106321 22:48871840-48871862 TGGGGGCCTCAGGCTCTTCCTGG + Intergenic
950169807 3:10830673-10830695 TGGAGGTCCCAGGAGCTACAGGG + Intronic
954269718 3:49498168-49498190 AGGGAGCCCCAGGACCATCAGGG - Intronic
954682101 3:52351383-52351405 TGGGGGAGTCAGGACCATCAGGG + Intronic
956395141 3:68817880-68817902 TGAGGGCCCTAGGATTTTCAGGG + Intronic
961369021 3:126418522-126418544 TGGGGGCCACGGGACCTACCTGG - Exonic
961773639 3:129268412-129268434 TCGGGACCCCAGGGCCTCCATGG + Intronic
962362699 3:134755265-134755287 TGGGAGCTCCAGGGCCTCCAGGG - Intronic
962977127 3:140455623-140455645 TGGGGCCCCAGGGACCTTCACGG + Intronic
963253184 3:143120421-143120443 TGGGGGTCCCCGCACCTTCGAGG - Exonic
966880394 3:184346655-184346677 TGGGGGCCCCACTCCCGTCATGG - Exonic
966900838 3:184482968-184482990 TGGGGGCCACGGGCCTTTCAAGG + Intronic
968725562 4:2246343-2246365 TGTGGGCCCCAGGGCCCTCGAGG - Intergenic
969336893 4:6516271-6516293 TGGGGGCTCCAGGACCATCCTGG + Intronic
969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG + Intergenic
969888701 4:10239892-10239914 TGAGGGCCCCAGTACCTTCAAGG + Intergenic
972986761 4:44774375-44774397 TGGGGGCCCTTTGGCCTTCAGGG - Intergenic
973872499 4:55180337-55180359 TGGAGAACCCAGGACCTTCCAGG + Intergenic
976750558 4:88447954-88447976 AAAGGGCCCCAGAACCTTCAAGG - Intergenic
978342459 4:107733200-107733222 AAAGGGCCCCAGTACCTTCAAGG - Intergenic
981561418 4:146052625-146052647 TGGTGATCCCAGGAACTTCACGG + Intergenic
985097667 4:186428902-186428924 GTGAGGCCCCAGTACCTTCAAGG - Intronic
985490060 5:174108-174130 TGGGGGCCGCAGGGCCTGCCAGG + Intronic
985574318 5:666466-666488 TGGGGGTCCTAGGACCTGCTGGG + Intronic
985794166 5:1949625-1949647 TTGGGGTCCCAGGGTCTTCAGGG + Intergenic
985858576 5:2450654-2450676 TGGGGACCCCAAGACCTCCCTGG + Intergenic
987005514 5:13705877-13705899 TGGTGGCCCCAGGAGCTCCTTGG - Intronic
987854589 5:23403438-23403460 TGGGGTCACAAGGACCTTTAAGG - Intergenic
990977749 5:61574110-61574132 TGGGGGTGACAGGATCTTCAGGG - Intergenic
994132845 5:96250329-96250351 TCAGGGCCCCAGGACCTTCTAGG + Intergenic
997261206 5:132466687-132466709 AGGCGGCCCCAGGACCTTCAAGG - Intronic
999243547 5:150140946-150140968 TGGGAGCCTCAGGACCCTGAGGG - Intronic
999439982 5:151593480-151593502 TGCTGGCCCCAGGACCTTTCTGG + Intergenic
1001889410 5:175326769-175326791 AGGGGCCCCCAGAACCCTCATGG + Intergenic
1002468884 5:179422890-179422912 TGGGGGCCCACGGATCTTCCAGG - Intergenic
1003099779 6:3168358-3168380 CGGGAGCCCCCGGACCATCACGG + Intergenic
1006174714 6:32114993-32115015 ATGGGGCCCCACGCCCTTCAGGG - Intronic
1006178734 6:32140485-32140507 TGAGGGCCCCAGTACCTTCAAGG + Intergenic
1006426283 6:33965074-33965096 TGGAGGCTCCAGGTCCTTCCAGG - Intergenic
1007133180 6:39495919-39495941 TGGGGTCCCCAGGCCCCTGAAGG - Intronic
1007349321 6:41257223-41257245 TGAGAGCCCCAGTACCTTCAAGG - Intergenic
1008937554 6:57008107-57008129 AAAGGGCCCCAGTACCTTCAAGG + Intronic
1011359782 6:86511130-86511152 TGGGGGCCTCAGGACTTGCCTGG + Intergenic
1011493652 6:87917504-87917526 TGGCTTCCCCAGGACCTTCCTGG - Intergenic
1012145973 6:95682140-95682162 AATGGGCCCCAGGACCTTCAAGG + Intergenic
1012429578 6:99150558-99150580 TTGGGACCCCAGGACCGCCATGG + Intergenic
1016521799 6:144954536-144954558 TGGGGGCCCCATGCCATTCGGGG + Intergenic
1017782543 6:157727431-157727453 TGAGGGCCCCAGTACCTTCAAGG + Intronic
1019287329 7:230252-230274 TGGGGGCTCCAGGAGCTCCTGGG - Intronic
1019320862 7:414647-414669 TGGGTGGCCCAGGTGCTTCATGG - Intergenic
1019428369 7:987745-987767 AGGGGACCCCAGGACATGCAGGG - Intronic
1020105375 7:5420224-5420246 TGGAGGCCGCGGGACCTTCTCGG + Intronic
1020446090 7:8269393-8269415 TGTGGGTCCCAGGACCATGAGGG + Intergenic
1020515909 7:9118868-9118890 TGGGGTCCCCCTGACATTCAAGG - Intergenic
1023841556 7:44101286-44101308 TGTGGCCCCCAGGACCCCCATGG - Intergenic
1023873337 7:44274333-44274355 CAGGGCCCCCAGGACCTTCCAGG + Intronic
1024007661 7:45239166-45239188 TGAGGGCCCTAGTACCTTCAAGG - Intergenic
1024477052 7:49823570-49823592 CGGGGGCCCCAGGATATTTACGG - Intronic
1025034812 7:55587503-55587525 TGGGGAGCCCAGGGCCTCCAGGG - Intergenic
1025932881 7:66010529-66010551 TGGAGGCACCAGGCCCTTGAAGG - Intergenic
1026474314 7:70721169-70721191 TAGTGGGCCCAGGACCTGCAAGG + Intronic
1026747523 7:73024641-73024663 TAGAGGGCCCAGGAGCTTCAGGG + Intergenic
1026751173 7:73052780-73052802 TAGAGGGCCCAGGAGCTTCAGGG + Intergenic
1026754822 7:73080894-73080916 TAGAGGGCCCAGGAGCTTCAGGG + Intergenic
1026758474 7:73108928-73108950 TAGAGGGCCCAGGAGCTTCAGGG + Intergenic
1026969161 7:74457548-74457570 AGGGGGCCCCAGGAAGTTCAGGG - Intronic
1027033729 7:74909933-74909955 TAGAGGGCCCAGGAGCTTCAGGG + Intergenic
1027088931 7:75284557-75284579 TAGAGGGCCCAGGAGCTTCAGGG - Intergenic
1027092574 7:75312485-75312507 TAGAGGGCCCAGGAGCTTCAGGG - Intergenic
1027096217 7:75340452-75340474 TAGAGGGCCCAGGAGCTTCAGGG - Intergenic
1027323125 7:77027240-77027262 TAGAGGGCCCAGGAGCTTCAGGG + Intergenic
1032364603 7:131287411-131287433 TGGGGGCCCCAGGCCTTCCTTGG + Intronic
1032900335 7:136300172-136300194 TGGGGGTTCCAGGACCCCCATGG - Intergenic
1034948096 7:155277054-155277076 TGCAGGCACCAGGTCCTTCAAGG - Intergenic
1034978463 7:155461164-155461186 TGGGGGCCCCCCACCCTTCAGGG - Intronic
1035399691 7:158556880-158556902 CGGGAGCCCCCTGACCTTCACGG - Intronic
1035456547 7:159013150-159013172 TGGGGGCCCCAGGCTCTGCTGGG + Intergenic
1035657195 8:1319154-1319176 TGGGGGCCCCAGGCACTGCAGGG - Intergenic
1035685972 8:1523604-1523626 TGGGGGCCTCTGGATCTGCAGGG + Intronic
1035897216 8:3416604-3416626 TGGGTGTCCCAGGAGCTACATGG + Intronic
1036741373 8:11364831-11364853 TGGGGCCTCCATGACCTCCAGGG - Intergenic
1038380606 8:27089656-27089678 TGGGGCCACCAGGACATTCAGGG - Intergenic
1041143557 8:54847361-54847383 CGGAGGCCCCAGGGCCCTCAGGG + Intergenic
1046745241 8:117868978-117869000 TGGGGCCCCCAGGACCTCCCCGG + Intronic
1047906630 8:129479716-129479738 TGGCCTCCCCAGGACCTTCTTGG + Intergenic
1048301600 8:133255299-133255321 TGGGAGTGCCAGGAACTTCAAGG + Intronic
1049210640 8:141384986-141385008 TTTGGGCCCCACGACCTCCAGGG + Intergenic
1049494722 8:142924344-142924366 TGGGGGCTCCTGGACCACCAGGG - Intergenic
1049782502 8:144435343-144435365 TGGGGGCCACAGGATCCTCCTGG + Intronic
1051857561 9:21586366-21586388 TGGGAGCCCCAGAAGCTCCAAGG - Intergenic
1055874400 9:80924696-80924718 TGTGGGCCCCAGGGTCATCAGGG + Intergenic
1057125667 9:92614150-92614172 TGGGCTCCCTAGGTCCTTCAGGG - Exonic
1060854244 9:126902191-126902213 AAGGGGCCTCAGTACCTTCAAGG + Intergenic
1061070832 9:128309596-128309618 TGGGAGTCCCAGGACCATCCCGG + Exonic
1061243709 9:129390150-129390172 TGGGGGCTTCAGGACCAACATGG + Intergenic
1061781650 9:132999781-132999803 CTGGAGCCCCAGGACCTTCCAGG - Intergenic
1061810764 9:133161818-133161840 GGGCAGCCCCAGGAGCTTCATGG + Intronic
1062541178 9:137042193-137042215 TTGGGGCCCCTGGACCTTGTGGG - Intronic
1062569344 9:137177889-137177911 TGGGGGCTCCAGGAGCTCCGGGG - Intronic
1203747959 Un_GL000218v1:54014-54036 TGGGGGCTCCAGGTCCTTGCTGG + Intergenic
1186179582 X:6959763-6959785 TTGGGCCCCTAGGGCCTTCAAGG + Intergenic
1186801160 X:13093438-13093460 TGGGGGCCCCAGGAGTCTCAGGG - Intergenic
1187475304 X:19605487-19605509 TTTGGGCGCCAAGACCTTCATGG - Intronic
1188108047 X:26165930-26165952 AGGGGGTCCCAGGCCCTACACGG + Intergenic
1189900905 X:45705391-45705413 TGGGGGCACAAGGCCCTTTAAGG + Intergenic
1190877245 X:54468743-54468765 CGAGGGCCCCAGGACCTTGTAGG - Intronic
1192872290 X:75195578-75195600 AGGAGACCCCACGACCTTCATGG - Intergenic
1195296029 X:103478428-103478450 AAAGGGCCCCAGTACCTTCAAGG + Intergenic
1196855978 X:119984722-119984744 TGAGGGGCCCAGTGCCTTCAAGG + Intergenic
1200109561 X:153733453-153733475 TGAGGGCTCCAGGTGCTTCAAGG + Intronic
1201854590 Y:18527612-18527634 TGGGGGCCCCTGGGCCCTGAAGG + Intergenic
1201878731 Y:18792773-18792795 TGGGGGCCCCTGGGCCCTGAAGG - Intronic
1202062130 Y:20899064-20899086 TGGAAGCCCCCGGACCATCACGG + Intergenic