ID: 930660158

View in Genome Browser
Species Human (GRCh38)
Location 2:54045246-54045268
Sequence GTTTTTAAGGGGATCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 2, 1: 28, 2: 60, 3: 68, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930660158_930660167 -1 Left 930660158 2:54045246-54045268 CCCTCCACGATCCCCTTAAAAAC 0: 2
1: 28
2: 60
3: 68
4: 172
Right 930660167 2:54045268-54045290 CCCCAGCCTACAATTCCTTGGGG 0: 1
1: 0
2: 1
3: 20
4: 167
930660158_930660172 13 Left 930660158 2:54045246-54045268 CCCTCCACGATCCCCTTAAAAAC 0: 2
1: 28
2: 60
3: 68
4: 172
Right 930660172 2:54045282-54045304 TCCTTGGGGAGATGGATTTGAGG 0: 19
1: 49
2: 99
3: 154
4: 373
930660158_930660164 -3 Left 930660158 2:54045246-54045268 CCCTCCACGATCCCCTTAAAAAC 0: 2
1: 28
2: 60
3: 68
4: 172
Right 930660164 2:54045266-54045288 AACCCCAGCCTACAATTCCTTGG 0: 1
1: 0
2: 1
3: 40
4: 615
930660158_930660174 14 Left 930660158 2:54045246-54045268 CCCTCCACGATCCCCTTAAAAAC 0: 2
1: 28
2: 60
3: 68
4: 172
Right 930660174 2:54045283-54045305 CCTTGGGGAGATGGATTTGAGGG 0: 12
1: 17
2: 44
3: 61
4: 241
930660158_930660171 5 Left 930660158 2:54045246-54045268 CCCTCCACGATCCCCTTAAAAAC 0: 2
1: 28
2: 60
3: 68
4: 172
Right 930660171 2:54045274-54045296 CCTACAATTCCTTGGGGAGATGG 0: 1
1: 0
2: 4
3: 35
4: 178
930660158_930660165 -2 Left 930660158 2:54045246-54045268 CCCTCCACGATCCCCTTAAAAAC 0: 2
1: 28
2: 60
3: 68
4: 172
Right 930660165 2:54045267-54045289 ACCCCAGCCTACAATTCCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930660158 Original CRISPR GTTTTTAAGGGGATCGTGGA GGG (reversed) Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
904452856 1:30627482-30627504 GTTTTTGAGAGGACCATGGAGGG + Intergenic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908893695 1:68875152-68875174 GTTTTTAATGGCATCGAGAATGG - Intergenic
908960405 1:69690809-69690831 CTTTTTAAGGGAATCATAGAGGG + Intronic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG + Intergenic
911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG + Intergenic
913049656 1:115106143-115106165 GTGTTTAATGGGATGCTGGAAGG + Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919165194 1:193883877-193883899 GTTTTTAAGTTTCTCGTGGAAGG + Intergenic
919369930 1:196710188-196710210 GACCTTAAGGGGATCATGGAGGG - Intronic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1064984629 10:21197920-21197942 TTTCTTAAGGGAATCATGGAGGG - Intergenic
1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG + Intergenic
1066129565 10:32379400-32379422 GTTTTTAAGGGGGGCGGGGGAGG - Intergenic
1066224186 10:33366230-33366252 GTTTTTAAGGGAGACATGGAGGG - Intergenic
1067665775 10:48277279-48277301 GTTTTTCATGGGAACATGGATGG - Intergenic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068156074 10:53200137-53200159 GTTTTTAAGCGGTTCTTTGAAGG + Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069175133 10:65280902-65280924 ATTTCTAAGAGGATCATGGAGGG + Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075855215 10:125624228-125624250 GTTCTTAGGGGGATAGTGAATGG - Intronic
1075951166 10:126478984-126479006 GTGTTTAAGGGCATCTTTGAAGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082216616 11:49578144-49578166 GTGTTTACGGGGATCATGGTGGG + Intergenic
1083574901 11:63783370-63783392 CTTTTGAAGGGGAGCCTGGAAGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084800951 11:71543549-71543571 GTTTTTAAGGGCAACTTGGTGGG + Intronic
1086423525 11:86661337-86661359 GTTTTTAAGTGGATCCGGTATGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1088389288 11:109296550-109296572 GTTTTTAATGGTATCTAGGATGG + Intergenic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1092719668 12:11428995-11429017 GTTTTAAAAGAGATCGGGGAGGG + Intronic
1093160917 12:15745349-15745371 GTTTTTTATGGGAACGGGGAGGG - Intronic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1096117547 12:49064120-49064142 GTAATTAAGGGGATCTTGAAAGG + Intergenic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1097927917 12:65150933-65150955 GTTTTTAAGAAGGTCCTGGAAGG - Intergenic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1101405713 12:104426756-104426778 CTTTTGAAGGGGATCGGGGTGGG + Intergenic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111836094 13:93390078-93390100 GTGTTTAAGAGGAACTTGGAGGG + Intronic
1112543965 13:100346253-100346275 GTTCTTAAGGGGATCTAGAATGG - Intronic
1114786272 14:25603457-25603479 ATTTTTAAGAGGATCATGGTGGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115486901 14:33919482-33919504 GTTTTTAATGGCATCTTGAATGG - Intergenic
1116141761 14:41005156-41005178 GTTTTTAATGGGATCTAGAATGG - Intergenic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1136046328 16:27618032-27618054 GTTTAAAAGGGGATCTTGGTCGG - Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138372774 16:56540523-56540545 GTTTTTAAGAGGATCATGACAGG - Intergenic
1138594072 16:58020132-58020154 TGTTTTAAGGCAATCGTGGATGG + Exonic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1141293405 16:82742862-82742884 GTTTTTAATGGACTCATGGAGGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1143362904 17:6386138-6386160 GCTTTGAAGGGGATCTAGGAGGG - Intergenic
1147373995 17:40013414-40013436 GTTTTTAACAGGACCATGGAAGG - Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1155329776 18:24703375-24703397 GTCTCTAAGGAGATCATGGAGGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1157737845 18:50066286-50066308 GTTTGTATGGGGATAGTGGTAGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1161763102 19:6188740-6188762 GGTTTTAAGGGGATCTTTGGGGG + Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163045323 19:14637290-14637312 ACTTTTAAAGGGATCATGGAGGG - Intronic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1165122444 19:33569024-33569046 GTTTTTAAGGGTAACTTGGTGGG - Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930833521 2:55770834-55770856 TTTTTTAAGGGGATCCCAGAAGG + Intergenic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941488414 2:166111704-166111726 GTTCTTAATGGGATCTAGGATGG - Intronic
941614700 2:167706046-167706068 CTTTTTAAGGGGGTCGGGGGAGG + Intergenic
941783997 2:169478747-169478769 GTTTTTAAGAGGATCACAGAGGG - Intergenic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
945160695 2:206887388-206887410 TTTTTTCAGGGGCTCATGGATGG - Intergenic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1170066081 20:12312015-12312037 TTTTTTCAGGGAATCTTGGAAGG - Intergenic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1170717940 20:18848086-18848108 GTTTTGAAGGGGATCTTAGCAGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1180172447 21:46066867-46066889 GTTTCTAAAGGGCTCCTGGATGG - Intergenic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182500059 22:30740157-30740179 GTTTTTAAGGATAACTTGGAGGG + Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950511826 3:13433895-13433917 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
952577256 3:34790262-34790284 GTTTTTAAAGGGCCCATGGATGG - Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
955674188 3:61433382-61433404 GTTTTTAAGGTGATAGAGCAAGG + Intergenic
956108541 3:65847307-65847329 ATTGTTAAGGGTATCCTGGATGG + Intronic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957433052 3:80138668-80138690 GTCTTTTATGGGAACGTGGATGG + Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958121552 3:89296203-89296225 GTTTTTAAGGGAATCTAGAATGG + Intronic
959326739 3:104946321-104946343 GTCTTTTAAGGGAACGTGGATGG - Intergenic
961202292 3:125055131-125055153 ATTTTTAAGGGGTTCTAGGACGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
964470977 3:157055388-157055410 GCTTTTAATGGGATATTGGAAGG - Intergenic
966500895 3:180637768-180637790 GTGTTTCATGGGAACGTGGATGG + Intronic
966938745 3:184731817-184731839 GCTTTCAAGGGGGTCTTGGAGGG + Intergenic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
972400329 4:38695966-38695988 GTTTTTAAGTGAATCCTGGGAGG + Intronic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
974475286 4:62371116-62371138 GTTTTCAAGGTCATCATGGAGGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
974991434 4:69095255-69095277 GGTTTTAAGGAGATCATAGATGG + Intronic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977612803 4:99053559-99053581 GTTTTTAATGGCATCGAGAATGG + Intronic
978319339 4:107477167-107477189 GTTTTTAAGGAGAACTTGGTGGG + Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979878340 4:125922625-125922647 GTCTTTTATGGGAACGTGGATGG - Intergenic
982810815 4:159824030-159824052 GTTTTTATGGAGATCTTGAAGGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
986320233 5:6625193-6625215 GTTTTTAAGGCCATCTTGGTAGG - Intronic
986401893 5:7390198-7390220 GTTTTTAAAGATATAGTGGAGGG + Intergenic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
989304014 5:39930538-39930560 ATTTTTAAGGAGATCCTTGAAGG - Intergenic
989532904 5:42528267-42528289 GTTTTTAATGGTATCTAGGATGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
990085269 5:51968851-51968873 GTTTCTAAGGGAACCATGGAGGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
993086953 5:83374908-83374930 GTTTTGGAGGTCATCGTGGATGG - Intergenic
994073495 5:95626664-95626686 GTTTTTTAGGGAATCTAGGAAGG + Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
995494743 5:112729382-112729404 GTTGATAAGGTGATCATGGAAGG + Intronic
995798409 5:115964411-115964433 GTTTTTAAGGGCAGCGTGCTTGG + Intronic
995820192 5:116221276-116221298 GATTTTAAGGAGATAGTAGAGGG - Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996794658 5:127331955-127331977 GATTGGAAGGGGATCTTGGAAGG + Intronic
997198687 5:131996579-131996601 GTTTTAAAGGGAACCCTGGAAGG + Intronic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1005433942 6:25787841-25787863 ATTTTTAAGGGAGTCTTGGAGGG - Intronic
1007865570 6:44965772-44965794 GTATTTAAGATGATAGTGGAAGG - Intronic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1016620414 6:146103048-146103070 GTTTTTAGGGGTCTCTTGGATGG + Intronic
1017248929 6:152259150-152259172 GATTTTAAGGGGATGCTGGGTGG - Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021525113 7:21578185-21578207 ATTTTACAGGGGATCATGGAGGG - Intronic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026597852 7:71749399-71749421 GATTTTAAGGGAATCATGAAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028078044 7:86538951-86538973 GTCTTTAGGGGGAACATGGATGG + Intergenic
1029175867 7:98664117-98664139 GTTTTTAAGGGAATCATAAAGGG - Intergenic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030319830 7:108154040-108154062 GTTTTTATGTGGATCTTGGCAGG + Intronic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031906499 7:127465806-127465828 GGTTTTCAGGGGATGGTGGCTGG - Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033244881 7:139709510-139709532 GTTGATCAGGGGATCATGGAGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1037885593 8:22594572-22594594 GCTTTGGAGGGGATGGTGGAGGG + Intronic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042255963 8:66804048-66804070 GTTTTAAAGGAGATCATGTATGG - Intronic
1043191917 8:77235422-77235444 GTTTTTAAAGGGGGTGTGGAGGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045803960 8:106135041-106135063 GGTTTTAAGAGAATCATGGAGGG + Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049053822 8:140219574-140219596 GGTTATAAGGGGGTCGTGGAAGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050974956 9:11926310-11926332 GTTTTTGGGGGGAACATGGATGG + Intergenic
1051759288 9:20443182-20443204 GTTTTTTATGGGATGGTGGTAGG - Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1052316084 9:27117731-27117753 GGTTTGAAGGGCATCGTGGGCGG + Intronic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056495681 9:87152806-87152828 GATTTTAGTGGGATCTTGGAAGG + Intronic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1060803412 9:126558736-126558758 GGATTTAAAGGGATCCTGGAGGG + Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1062228747 9:135469126-135469148 GTTTTTAAGGACAGCGTGGTGGG - Intergenic
1185809149 X:3088895-3088917 TTTTTTAGGGGAATCATGGAGGG + Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186281915 X:8002387-8002409 GTTCTTAAGGGCAGCGTGGCCGG + Intergenic
1186316397 X:8375154-8375176 AGTTTTAAGGGGCTCTTGGAGGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190477519 X:50842594-50842616 GTTTTTAAGGGCAACTTGGTGGG + Intergenic
1190722091 X:53157833-53157855 GTTTTCAAGGGGATGGGGGTGGG - Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1193456420 X:81736985-81737007 GTTTTCTAGGGGATCTTGGGTGG - Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195258604 X:103112159-103112181 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1196279961 X:113812492-113812514 ATTTTTGAAGGGATCATGGAGGG - Intergenic
1198605472 X:138332503-138332525 GTTTTTAAGGGAATGATGGCAGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1199699853 X:150366990-150367012 ATTTTTAAGGAGATCTTGTAAGG - Intronic
1200987548 Y:9319769-9319791 GTTTTTTAGGGGCACGTGTAAGG - Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG + Intergenic