ID: 930672974

View in Genome Browser
Species Human (GRCh38)
Location 2:54170963-54170985
Sequence GGCTCACTTTGTTTATTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930672970_930672974 3 Left 930672970 2:54170937-54170959 CCAAGTCAATCACAGGGAAATGC 0: 1
1: 0
2: 2
3: 10
4: 156
Right 930672974 2:54170963-54170985 GGCTCACTTTGTTTATTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 202
930672966_930672974 23 Left 930672966 2:54170917-54170939 CCTGTGAGGTGCAGCGCCATCCA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 930672974 2:54170963-54170985 GGCTCACTTTGTTTATTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 202
930672969_930672974 7 Left 930672969 2:54170933-54170955 CCATCCAAGTCAATCACAGGGAA 0: 1
1: 0
2: 0
3: 15
4: 152
Right 930672974 2:54170963-54170985 GGCTCACTTTGTTTATTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 202
930672965_930672974 24 Left 930672965 2:54170916-54170938 CCCTGTGAGGTGCAGCGCCATCC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 930672974 2:54170963-54170985 GGCTCACTTTGTTTATTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 202
930672964_930672974 25 Left 930672964 2:54170915-54170937 CCCCTGTGAGGTGCAGCGCCATC 0: 1
1: 0
2: 0
3: 8
4: 78
Right 930672974 2:54170963-54170985 GGCTCACTTTGTTTATTTACTGG 0: 1
1: 0
2: 1
3: 11
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930672974 Original CRISPR GGCTCACTTTGTTTATTTAC TGG Intronic