ID: 930673573

View in Genome Browser
Species Human (GRCh38)
Location 2:54176942-54176964
Sequence CTGTGAAAGGAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 5, 3: 79, 4: 637}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930673573_930673578 -8 Left 930673573 2:54176942-54176964 CCAGCTTCCCTCTCCTTTCACAG 0: 1
1: 0
2: 5
3: 79
4: 637
Right 930673578 2:54176957-54176979 TTTCACAGGCACTCTTCCCAAGG 0: 1
1: 0
2: 1
3: 18
4: 194
930673573_930673579 -7 Left 930673573 2:54176942-54176964 CCAGCTTCCCTCTCCTTTCACAG 0: 1
1: 0
2: 5
3: 79
4: 637
Right 930673579 2:54176958-54176980 TTCACAGGCACTCTTCCCAAGGG 0: 1
1: 0
2: 0
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930673573 Original CRISPR CTGTGAAAGGAGAGGGAAGC TGG (reversed) Intronic
900120394 1:1046376-1046398 CTCTGCAAGGAGAGGGAGGTTGG - Exonic
900279857 1:1859706-1859728 GTGGGAAAGAAGAGGGAGGCAGG + Intronic
900485622 1:2921284-2921306 CTGTGAAGGGAGAGGGGATGCGG - Intergenic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902279825 1:15366336-15366358 CTGCGACAGCACAGGGAAGCAGG - Intronic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902929933 1:19723810-19723832 CTGTGAGAGGAGGGTGAAGCGGG + Intronic
903185133 1:21624610-21624632 CTTTGACAGGAGAGGAAACCAGG - Intronic
903801999 1:25975933-25975955 CTGTGATCAGAGAGAGAAGCAGG - Intronic
903984476 1:27215813-27215835 CTGGGAAAGGGGAGAGAAGGAGG - Intergenic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
905532050 1:38687584-38687606 CTGTGTAAGGAGAGGGTAAGGGG - Intergenic
905949602 1:41938106-41938128 CTGAGTAATGAGAGGGAACCAGG - Intronic
906017831 1:42598218-42598240 CCTTCAAAGGTGAGGGAAGCTGG + Intronic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
907843814 1:58185225-58185247 CTAAAAAATGAGAGGGAAGCAGG + Intronic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
908933805 1:69348878-69348900 CAGTGAAAGGAGAGGAAAAATGG + Intergenic
909236901 1:73164365-73164387 ATGTGAAAGGAAGGGGAAGGAGG - Intergenic
910141457 1:84031470-84031492 CTGTGAAAGCAGCCAGAAGCTGG - Intergenic
910549601 1:88461111-88461133 ATGTGAAAGGAGCAGGAAGCAGG + Intergenic
911058637 1:93728985-93729007 CTTTTAAATGATAGGGAAGCCGG - Intronic
911527206 1:99002363-99002385 CTCTGAAAGAAGGTGGAAGCTGG - Intronic
911792304 1:102032926-102032948 CTGTGTGAGGAGATGGATGCAGG + Intergenic
911951008 1:104173169-104173191 GTGTGAAAGGGGACGGGAGCAGG - Intergenic
912739241 1:112178206-112178228 CTGTGAAAGGTGGGGGCAGGGGG - Intergenic
913594587 1:120361043-120361065 TTGTGAAAGGAGGGGAAAGCCGG + Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914092678 1:144517943-144517965 TTGTGAAAGGAGGGGAAAGCCGG - Intergenic
914305853 1:146415932-146415954 TTGTGAAAGGAGGGGAAAGCCGG + Intergenic
914596203 1:149156874-149156896 TTGTGAAAGGAGGGGAAAGCCGG - Intergenic
915735887 1:158084621-158084643 GTGGGAAAGGAGAGGTGAGCTGG - Intronic
916175565 1:162035381-162035403 GTGGGAGAGGAGTGGGAAGCAGG + Intergenic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916462760 1:165044374-165044396 CTGTGGTAGGAGAGGAAAGTAGG - Intergenic
916783767 1:168067022-168067044 CTGGGATGGGAGAGGGAAGGTGG + Intronic
917511769 1:175674742-175674764 CTGAGAAGGCAGAGGGAACCTGG - Intronic
917921854 1:179757302-179757324 GTCTGAAAGGAGAAGAAAGCAGG + Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918524534 1:185451182-185451204 CTGTGAAGGGAGAGGCTAGGGGG + Intergenic
920056534 1:203196919-203196941 CTGTGAAGGCAGAAGCAAGCCGG - Intergenic
920142113 1:203823970-203823992 TTAAAAAAGGAGAGGGAAGCCGG + Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920443977 1:206001858-206001880 GTGAGAAATGAGAGGGAAGGGGG - Intronic
921531311 1:216285689-216285711 CTGTGAAAGGAGCCAGAAGGAGG + Intronic
922741950 1:228019012-228019034 CTGTGAGAGGCCAGGGATGCTGG + Intronic
923204145 1:231741769-231741791 CTGTGAGAGGAGCTGGGAGCAGG - Intronic
923280231 1:232436576-232436598 CTGGGACAGGAGAGGAAAGCAGG + Intronic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
924315567 1:242791892-242791914 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
924715261 1:246566835-246566857 CTGAGAAAGGAGAGGAAAACAGG - Intronic
1062952653 10:1516261-1516283 CTGGGAAAGGAGAGGGCCTCGGG - Intronic
1063344244 10:5296374-5296396 CTGCAACAGGAGAAGGAAGCTGG - Intergenic
1063380635 10:5583385-5583407 GTGGGAAAGGAGAGGGAAAGGGG + Intergenic
1064756928 10:18579904-18579926 CTTTGAAAAGAATGGGAAGCAGG + Intronic
1065187966 10:23187707-23187729 CTTTGAAGTGTGAGGGAAGCAGG + Intergenic
1065212593 10:23418561-23418583 CTTTGAAAAGAAACGGAAGCAGG + Intergenic
1065473989 10:26114114-26114136 TTGAGAAAGGACAGGGAGGCAGG - Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067578271 10:47421170-47421192 CTGTGGGAGGAGGGGGCAGCCGG + Intergenic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1068093915 10:52466646-52466668 CTGTGAAAGGAGTGTGAAGGGGG + Intergenic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1069484425 10:68812455-68812477 CAGTGAAAGGAGAGACAAGTGGG + Intergenic
1069891143 10:71653143-71653165 ATGTGGCAGGAGAGGGAGGCTGG - Intronic
1070043610 10:72807640-72807662 GTGTGAGAGGAGAGGGAGGGTGG - Intronic
1070401005 10:76053602-76053624 CCATGAAAGGACAGGCAAGCAGG + Intronic
1070837293 10:79457478-79457500 CTGTGGAAGGAGGGAGAGGCAGG - Intergenic
1070976331 10:80608834-80608856 CAGTGAACAGAGAGAGAAGCTGG - Intronic
1071334561 10:84590148-84590170 CTGTGCAAGGATGGGGAACCAGG + Intergenic
1071511156 10:86263359-86263381 CTGGGAAATGAGACGGCAGCGGG + Intronic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1071729580 10:88234253-88234275 CTTATAAATGAGAGGGAAGCAGG - Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1072618690 10:97066148-97066170 CTGTGATAAGTCAGGGAAGCAGG + Intronic
1073213941 10:101826376-101826398 CTTAGAAGGGAGAGGGAAGGAGG - Intronic
1073324345 10:102633876-102633898 ATGTGAGAGGAGCTGGAAGCCGG - Intergenic
1073873384 10:107892099-107892121 ATGAGAAAGTAGAAGGAAGCTGG - Intergenic
1074265913 10:111903089-111903111 GGGTGAAAGGCAAGGGAAGCTGG + Intergenic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1075540066 10:123305007-123305029 CTGTGAAGGGAAAGAAAAGCCGG - Intergenic
1075776738 10:124993986-124994008 CTGTGGAAGGAAAGAAAAGCCGG + Intronic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076314058 10:129528476-129528498 CTGTGAAGCGAGAGCGAGGCTGG + Intronic
1076314168 10:129529133-129529155 CTGTGAAGCGAGAGCGAGGCTGG + Intronic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1076494914 10:130890755-130890777 GTGGGAAAGGAGGGGGAAGGGGG + Intergenic
1076735830 10:132458535-132458557 CTGGGACTGGAGACGGAAGCTGG + Intergenic
1076861705 10:133141021-133141043 ATGTGGAAGGAGAGGGACGGTGG - Intergenic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078630361 11:12997618-12997640 ATGCGAAAGGAGAGGGAAAAAGG + Intergenic
1079087836 11:17460028-17460050 CTGTCAGAGGAGAGAGAAGTGGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079290040 11:19179723-19179745 CTCTGAAAGGAGAGAGGAGACGG + Intergenic
1079536430 11:21520643-21520665 TTGGGAGAGGAGAGGTAAGCAGG + Intronic
1080209764 11:29771878-29771900 GTTTGAAAGGAGAGGTAAGGTGG - Intergenic
1080883063 11:36340685-36340707 CTCTAAAAGGAGAGAGAAGCAGG + Intronic
1081249903 11:40816383-40816405 CTGTGACAGGATAGGACAGCTGG - Intronic
1081298264 11:41418915-41418937 AAGTGAAAGTAGAGGAAAGCTGG + Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081774516 11:45668198-45668220 CTGTGAAAGGAAACAGCAGCTGG + Intergenic
1083594824 11:63914174-63914196 CAGTGAAAGGAGAGGCAGGTAGG + Intronic
1083967475 11:66051666-66051688 CTAAGAAAGGAAAGGAAAGCGGG + Intronic
1084511259 11:69605707-69605729 GGGTGGAAGGAGAGGGGAGCAGG - Intergenic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085729495 11:78984086-78984108 CTCTGAAAAATGAGGGAAGCAGG + Intronic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1086453786 11:86942168-86942190 CAATAAAAGGAAAGGGAAGCAGG + Intronic
1086606504 11:88702404-88702426 CTGTGAGAGCTGAGCGAAGCAGG - Intronic
1087013108 11:93531805-93531827 CTTTGAAAAGAAAGGGAGGCAGG - Intronic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1088454808 11:110022469-110022491 CTGTGGAAGGAAAGGGGAGATGG - Intergenic
1088569984 11:111213497-111213519 TTTGGAAAGGAGAGGGAAGGGGG + Intergenic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1089061242 11:115627803-115627825 CTCTGAAAGAGGAGGTAAGCTGG + Intergenic
1089254048 11:117184702-117184724 CTGTGATAGGAGGGGAAAGAAGG + Intronic
1089577865 11:119459544-119459566 ATCTGAAAGGAGAGGGGAGCAGG + Intergenic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1089989544 11:122846133-122846155 CTGTGAATGGAGTGGGTACCCGG - Intronic
1090667340 11:128923496-128923518 CTCTGTAAGGAGAGAGAAGGTGG - Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091109489 11:132952565-132952587 CTGTGATAGAAAAGAGAAGCAGG - Intronic
1091196336 11:133733957-133733979 CTTTGAAAGGAAATGGAATCAGG + Intergenic
1091394018 12:142698-142720 CTGGGGAAGGGAAGGGAAGCCGG - Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1092081567 12:5720735-5720757 CTGTGAAATGAGAGAGCAGTGGG - Intronic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1092529806 12:9334986-9335008 TTGTCAAAGGAGAGGGGAGTTGG + Intergenic
1093990643 12:25586347-25586369 GTGAGAATGGAAAGGGAAGCAGG - Intronic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095335006 12:41013254-41013276 CTGAGAAAGAAAAGGGAAGATGG + Intronic
1095916648 12:47486680-47486702 GTATGAAAGGAGAGGGCAGAGGG - Intergenic
1096507326 12:52102714-52102736 TGGTGAAACGAGAGGGAAGTAGG + Intergenic
1096835706 12:54349829-54349851 CTGAGAAAGGAGTTGGAAGTAGG - Intronic
1096898264 12:54846979-54847001 CTGTGAAAGGGTAGGCAGGCAGG - Intronic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1098748269 12:74266699-74266721 CCCTGAAAGGAGAGGGAAAGGGG + Intergenic
1098857787 12:75672401-75672423 CTGTGCAAGGAGAGAGGAGAAGG + Intergenic
1099440283 12:82690165-82690187 GTGTGAAGGGGGAGGAAAGCTGG + Intronic
1099694458 12:85999864-85999886 CTGGGAGGGGAGATGGAAGCTGG + Intronic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1101766774 12:107708243-107708265 TTTTGAGATGAGAGGGAAGCAGG - Intronic
1101804625 12:108052541-108052563 ATGTGAAAGGAAAGGAAACCTGG - Intergenic
1102547334 12:113666263-113666285 ATGGGGAGGGAGAGGGAAGCCGG + Intergenic
1102678431 12:114674097-114674119 CTGGCAAAGGACAGGGAAACTGG + Intronic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103414748 12:120736739-120736761 CTGTGGACGGAGCGGGGAGCAGG + Intronic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1106865280 13:33957864-33957886 CTGTAAAAAGAAAGAGAAGCAGG - Intronic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107743020 13:43473813-43473835 CTCTGAATGGAGACAGAAGCAGG + Intronic
1108008144 13:45973862-45973884 AAATGTAAGGAGAGGGAAGCAGG + Intronic
1108039339 13:46324729-46324751 TTGTTACTGGAGAGGGAAGCAGG - Intergenic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108992334 13:56675980-56676002 CCCTGAAAGCAGAGGGTAGCAGG - Intergenic
1109189489 13:59307845-59307867 CTGTGAAAGGAGCCAGAAGCGGG - Intergenic
1109208216 13:59505246-59505268 CTGTGAAAGATGATAGAAGCAGG + Intergenic
1110814576 13:79847162-79847184 CTATGAATTGAGAGTGAAGCAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111926946 13:94473754-94473776 CTGTGAAAAGAATGGGAAGTGGG + Intronic
1112044483 13:95582579-95582601 CTGGGGAAGGAGTGGGAAGCAGG - Intronic
1112157453 13:96833199-96833221 CTGAGAGAGGAGAGGGCAGGAGG - Exonic
1112825003 13:103382086-103382108 CTGTGAAAGGAGCTGGGAGGGGG - Intergenic
1112922821 13:104636439-104636461 CTATGGAGGGTGAGGGAAGCAGG + Intergenic
1113167492 13:107458561-107458583 ATGGGAAACGAGAGAGAAGCAGG + Intronic
1114426441 14:22627808-22627830 ATGTGTAAGGAAAGGGAAGAGGG - Intergenic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1117212863 14:53519475-53519497 TGGTGGAAGGGGAGGGAAGCTGG + Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1119532154 14:75369916-75369938 CTGTGAAAAGAAGGGGAAGGAGG - Intergenic
1120431327 14:84419369-84419391 CTGTGCAAGGAGAAAGTAGCAGG - Intergenic
1121847088 14:97181134-97181156 CTGAGACAGGACATGGAAGCAGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122557650 14:102590341-102590363 AGGTGTAAGGAGAGGGGAGCAGG + Intergenic
1125332009 15:38591644-38591666 CTGTGATGGGAAGGGGAAGCTGG + Intergenic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1126210398 15:46094798-46094820 CTGTGAAAGAAAAGTGAAGGAGG + Intergenic
1126257862 15:46649191-46649213 CTGTGAAAGAAGAGAGAAAGCGG - Intergenic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127134933 15:55910387-55910409 GGGTGAAAGGTGAGGGAAGGAGG - Intronic
1127788648 15:62378748-62378770 GTGGGAAAGGAGAGGAAAGAAGG + Intergenic
1127903517 15:63358988-63359010 CTGAGAAAGGGCAGGGAAACGGG - Intronic
1128539751 15:68518393-68518415 AGAAGAAAGGAGAGGGAAGCAGG - Intergenic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128778261 15:70340538-70340560 ATGTGGAAGGAGAGGGAAAGTGG - Intergenic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1132590181 16:723162-723184 CTGTGAGGGGAGAGGAAAGGAGG + Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133690261 16:8207595-8207617 CTGTTAAGGGAGAGGGGAGAGGG - Intergenic
1134076242 16:11293560-11293582 CTGTGAAAGGCCAGGGCAGGAGG + Intronic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135478054 16:22795236-22795258 TGGTGAGAGGAGAGGGTAGCAGG - Intergenic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1135711999 16:24725542-24725564 CTGAGAATGGAGAGAGGAGCTGG - Intergenic
1136170377 16:28485924-28485946 CTGTGAAGGGAGGCGGAATCTGG - Intronic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138187057 16:54984976-54984998 CTGTGAAAGCTGAGGAAATCAGG - Intergenic
1138423456 16:56914877-56914899 AGGTGAAAGGAGAGGGGAGGAGG + Exonic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1140088395 16:71816782-71816804 CCGAGAAAGGAGAGTGAAGAGGG + Intergenic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1140818227 16:78639928-78639950 CTGTGGAGGGAGTGGGAGGCAGG + Intronic
1140858145 16:78996027-78996049 CACTGAAAGAAGAGGGAAACTGG + Intronic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142549667 17:731164-731186 CCGTGAAATGAGAGGGAGGCTGG - Intergenic
1142732994 17:1875000-1875022 CTGGGAAAGAACAGGGAATCAGG - Intronic
1143182230 17:4990432-4990454 CTTTGAAAGGAAATTGAAGCTGG + Intronic
1143410588 17:6706148-6706170 CTGGAAATGGAGAGAGAAGCTGG + Intronic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1144163333 17:12582602-12582624 CTGGGCAAGGACAGGGAAGAAGG - Intergenic
1144248704 17:13394336-13394358 CTTGGAAAGGAGAGTGATGCTGG + Intergenic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1144969199 17:19096656-19096678 TTTTGAAGGGAGAGGGAAACAGG - Intronic
1144978717 17:19155410-19155432 TTTTGAAGGGAGAGGGAAACAGG + Intronic
1144989505 17:19222822-19222844 TTTTGAAGGGAGAGGGAAACAGG - Intronic
1145357184 17:22169553-22169575 CTGTCAAAGGAGAGACAAGGTGG - Intergenic
1145822552 17:27850722-27850744 CTGTGGAAGGAGAGTGATGCTGG + Intronic
1146338354 17:31995677-31995699 TTGTGGACGGAGAGGTAAGCAGG - Exonic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1146730867 17:35193299-35193321 CTGTGAGAGGACAGGGAGGGTGG - Exonic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1147606006 17:41774031-41774053 CAGCTAAGGGAGAGGGAAGCGGG + Intronic
1148190156 17:45672622-45672644 CTGCGAAAGAAGAGACAAGCAGG + Intergenic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1148647813 17:49229456-49229478 GTGTGAAAGGCGGGAGAAGCAGG - Intronic
1148748041 17:49929319-49929341 CTCAGAAAGGAGAGGGCAGAAGG + Intergenic
1148856714 17:50582971-50582993 CTGTTCAAGGCGAGAGAAGCTGG + Intronic
1149109293 17:53007795-53007817 CTATGAAAGGACAAGGATGCAGG + Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1150352299 17:64455050-64455072 TTGTGAAAGGAAAAGGAAGAAGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150709073 17:67514526-67514548 CTGTGAAAGTCAAGGGAAGCCGG + Intronic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1150969777 17:70014534-70014556 TTGTGAAAGGAGAGGGATTCAGG - Intergenic
1151102024 17:71566894-71566916 CTGGAAAGGGAGAGGAAAGCAGG + Intergenic
1151106520 17:71622399-71622421 CTGTGACAGGAGATGGAAACTGG - Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152368857 17:79872546-79872568 ATGGGAAAGGAGGGGAAAGCAGG - Intergenic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153668483 18:7387643-7387665 CTGTGAGAGGTGAGGCCAGCTGG + Intergenic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1155191801 18:23437127-23437149 TTTTGCAAGGAGAGGGAAGCTGG - Intronic
1155246114 18:23910979-23911001 CTGAGAAGGGAGAGGGGAACGGG + Intronic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156471068 18:37377554-37377576 CTTAGAAATGAGAGGGAAGCTGG + Intronic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1158728058 18:59992921-59992943 CTGTAAAATGAGAGGGAAATGGG - Intergenic
1159749770 18:72285807-72285829 CTGCGAAGGTTGAGGGAAGCAGG + Intergenic
1160047470 18:75400317-75400339 CTTTGAAAGGGGAGAGATGCAGG + Intergenic
1160134375 18:76260059-76260081 CTTTGAAAGAAGGGGGAAACTGG + Exonic
1160388246 18:78511019-78511041 ATGGGAAAGGAGGGGAAAGCTGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161152756 19:2718201-2718223 CTGGGAAGAGAGGGGGAAGCTGG - Intronic
1161160106 19:2757089-2757111 ATGGGAAAGGAGTGGGGAGCAGG + Intronic
1161821587 19:6533667-6533689 CTCTGGAGGGAGAGGGAAGGGGG - Intronic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1163334246 19:16660913-16660935 CCGTGCAAGGCGAGGGAGGCTGG - Intergenic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1166100788 19:40570411-40570433 GTGTGAAGGGAGGGGGAAGAGGG - Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1166773300 19:45297698-45297720 CTGTGACTGGAGGGGGAGGCAGG - Exonic
1167017404 19:46850136-46850158 CTGTAAAAGGAGAGAGGACCTGG - Intronic
1168336349 19:55599624-55599646 CTGGGAAAGGAAAGGGAAAGAGG - Intronic
1168641996 19:58037012-58037034 CTCTGAAAAGAGAGGGAAAGTGG - Intronic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
924998555 2:385934-385956 CTGTGGGAGGAAAGGGGAGCAGG - Intergenic
925036498 2:691031-691053 TTGCGCCAGGAGAGGGAAGCTGG + Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
926127989 2:10283579-10283601 AGGTGAAAGGAGAGAGAAGGTGG - Intergenic
926395287 2:12435025-12435047 CACTGATGGGAGAGGGAAGCAGG - Intergenic
926756279 2:16238685-16238707 GAATGAAAGGAGAGGGAAGAAGG - Intergenic
927067612 2:19489641-19489663 CTGAGAAATGACAGGGAATCAGG + Intergenic
927408339 2:22797400-22797422 GAGTGAAAGAAGAGGCAAGCAGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
928061513 2:28117819-28117841 CTGAGAGAGGAGAGGGTATCAGG + Intronic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
930271601 2:49263675-49263697 TTTTAAAAGGAAAGGGAAGCAGG + Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931586616 2:63836811-63836833 CTTTGAAAGTTGAAGGAAGCAGG - Intergenic
931755975 2:65374928-65374950 CTGGGAGAGGGGAGAGAAGCGGG + Intronic
931922637 2:67037723-67037745 CTGAGAAAGGGGTGGGAAACAGG + Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
933353989 2:81192587-81192609 CTGTGAATGGGTAGGGAATCTGG + Intergenic
933946010 2:87286702-87286724 CAGTGAGGGGAGAGGAAAGCAGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934637773 2:96006769-96006791 CTAAGAAAGGTGAGGGAAGTAGG + Intergenic
935094959 2:99935415-99935437 CTTTTAAGGGAGAGGGGAGCAGG + Intronic
935146269 2:100397660-100397682 CTGTGACAGGTGAGGAGAGCTGG + Intronic
935635830 2:105248979-105249001 CTGTGGAAGAAGATGGGAGCTGG + Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936334201 2:111574884-111574906 CAGTGAGGGGAGAGGAAAGCAGG - Intergenic
936572149 2:113626278-113626300 CTGTGAAAGGAAAATGAATCTGG + Intergenic
936629504 2:114186519-114186541 CAGGAAAAGGAGAGAGAAGCAGG - Intergenic
936948489 2:117953374-117953396 GTGATAAAGGAGAGAGAAGCAGG + Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937347193 2:121133375-121133397 CTGAGAAAGGAGAGGCAGGTGGG - Intergenic
937384146 2:121411210-121411232 TTCTGATATGAGAGGGAAGCGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939221114 2:139302410-139302432 TTGTGAAGGGTGAGGAAAGCAGG + Intergenic
939501840 2:142996537-142996559 CAGTGAAAGAAGAGGGATGTTGG + Intronic
940093835 2:149951677-149951699 ATGTGACAGTATAGGGAAGCGGG - Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
941664036 2:168226000-168226022 CAGGGAAAGAAGAGAGAAGCTGG + Intronic
942117355 2:172741253-172741275 ATGTGAAAAGAGAAGTAAGCAGG - Intronic
942713470 2:178864582-178864604 CTGTTAAACAGGAGGGAAGCAGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
945266368 2:207895217-207895239 CTGTAAAATGAGAGTGAACCAGG + Intronic
945362950 2:208913695-208913717 CTGTGAAATGAGTTGGGAGCAGG - Intergenic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947448875 2:230186653-230186675 CTCAGAAAGGAGAGGGACGGAGG - Intronic
947506959 2:230714291-230714313 TTGTGAAAGGAGAGAGGAGGAGG + Intronic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
947971926 2:234331995-234332017 AAATGAAAGGAGAGGGAACCCGG - Intergenic
948231134 2:236350539-236350561 CTGTGAAAGGGGAGAGCCGCTGG - Intronic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
949066165 2:241991547-241991569 CTGGCGAAGGTGAGGGAAGCAGG - Intergenic
1169661351 20:7981894-7981916 CTGTGAAATGAAAGCCAAGCAGG - Exonic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171121366 20:22571830-22571852 CTGGGAAGGGAGAGGCAAGAGGG + Intergenic
1171278574 20:23878643-23878665 CTGTGCAGGGAGAGGGCTGCAGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172258601 20:33541455-33541477 CTGAGTAAGGACAGAGAAGCCGG + Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1172913110 20:38424817-38424839 CTGTCAAAGGACAGTGAAGCAGG - Intergenic
1173628963 20:44495661-44495683 CTGTGTAAGGAGGGGGCAGGGGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174753439 20:53135280-53135302 GTGTGACTGGAGAGGGAAGCAGG - Intronic
1174883652 20:54307810-54307832 CTGTGAAGAGGGAGGGATGCAGG - Intergenic
1176274282 20:64255201-64255223 CTTTGAATGGAATGGGAAGCAGG + Intergenic
1178296385 21:31413800-31413822 CTGTGGAAGGAGATGGCATCTGG - Intronic
1178936342 21:36865362-36865384 CCGAGAAAGGAGATGCAAGCAGG + Intronic
1179709865 21:43207105-43207127 CGCTGAAAGGTGAGGGAAGAAGG - Intergenic
1180018573 21:45104143-45104165 AAGTGGAAGGAGAGGGTAGCAGG - Intronic
1180036905 21:45254767-45254789 TTGTGAAAGCAGAGGGAGCCTGG + Intergenic
1180068839 21:45426026-45426048 CTGTGAAAAGGTGGGGAAGCAGG - Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181050139 22:20234490-20234512 CGGTGAACGGAGAGGCATGCAGG + Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181539591 22:23566268-23566290 CTGGGAGAGGAGAGGGCAGGGGG + Intergenic
1181807870 22:25385923-25385945 ATTTCAAAGGTGAGGGAAGCAGG + Intronic
1182246868 22:28965064-28965086 CTGTCAAAAGAGAAGGGAGCAGG + Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182772293 22:32804287-32804309 CTGTGCAAGGCGAGGGAGGTCGG - Intronic
1183086569 22:35490678-35490700 CTGGGAAAGGAGGGGACAGCAGG - Intergenic
1183250247 22:36725293-36725315 CTGTGAAATGGAAGGGATGCTGG + Intergenic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1183924275 22:41194873-41194895 CTGTGAAAGGGAAGAGAAGCCGG - Intergenic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1185428043 22:50784602-50784624 CTGTGAAAGGAAAATGAATCTGG - Intergenic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949548089 3:5089763-5089785 ATGGGAAATGAGAGGGAAGGGGG + Intergenic
949570357 3:5286136-5286158 CTGTGAAAGGCTGGAGAAGCTGG + Intergenic
950025809 3:9819248-9819270 CTGTGGAAGGATAGGTAGGCAGG - Intronic
950339932 3:12234204-12234226 CTGTGCAAAGAAAGGGCAGCTGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
950851194 3:16063763-16063785 GTGTGAAAGGAAAGGCCAGCTGG + Intergenic
951505247 3:23437600-23437622 CTCAGAAAGGAGAGGAATGCCGG + Intronic
951752953 3:26057412-26057434 CTGGGACAGGAGAGGGAGCCAGG - Intergenic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
953398088 3:42588962-42588984 CTGTGAAATGGGATGAAAGCAGG + Intronic
953469438 3:43154592-43154614 CTGTGGAAGGAAAGGGATGCAGG - Intergenic
953550513 3:43898834-43898856 ATGAGGTAGGAGAGGGAAGCAGG + Intergenic
953858348 3:46519532-46519554 CTGTGAAGGGAGAGAGAAGAGGG - Intronic
955379304 3:58423916-58423938 GTGGGCAAGGAGAGGGAAACTGG - Intronic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956529465 3:70201764-70201786 GAGGGAATGGAGAGGGAAGCAGG - Intergenic
956685447 3:71823100-71823122 TTGTGAAAGCAGAGAAAAGCAGG - Intergenic
956731838 3:72203730-72203752 GGGTGAAAGTAGAGAGAAGCGGG - Intergenic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
957939908 3:86991192-86991214 CTGTGCGAGGACAGGGAGGCGGG + Intergenic
958735755 3:98007628-98007650 CTGTAAAAGGAGAGGAATGATGG + Intronic
960487975 3:118276514-118276536 TTATGAGAGGGGAGGGAAGCAGG + Intergenic
960813991 3:121654819-121654841 CTTGGAAAGGAGAGGGAAATTGG - Intronic
961204188 3:125067818-125067840 CGGAGAAAGGAGGGGGAAACAGG + Intergenic
961382634 3:126505692-126505714 GTGTGATAGCAGAGGTAAGCTGG - Exonic
961466618 3:127085620-127085642 CTGTGCAGGGAGAGGGAGTCTGG + Intergenic
961489111 3:127240236-127240258 CTGTGAAATAAGAGGTAAGGTGG - Intergenic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961959673 3:130841705-130841727 CTCTGCAGGGAGAAGGAAGCAGG + Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962725987 3:138227390-138227412 CTGGCAAAGGATAGTGAAGCAGG - Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963237324 3:142968470-142968492 CTGGGAGAGGGGATGGAAGCAGG - Intronic
963278721 3:143359562-143359584 CTGAGGAAGGACAGGGTAGCTGG + Intronic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
964132367 3:153303699-153303721 CAGTGAAAGGAAAGGTTAGCAGG - Intergenic
964207441 3:154190058-154190080 CCATGAAGGGAGAAGGAAGCAGG - Intronic
965179476 3:165383574-165383596 AAGTGAAAGCAGGGGGAAGCAGG + Intergenic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
966448076 3:180025934-180025956 CTGTCACAGGTGAGGAAAGCGGG + Intronic
966509777 3:180748897-180748919 CTGGGCAGGGAGAGGGAAGGAGG + Intronic
967404578 3:189101144-189101166 CTGTGAAAAGAGTTGGAAGGGGG - Intronic
967945114 3:194797974-194797996 GCGAGGAAGGAGAGGGAAGCAGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968557095 4:1251016-1251038 CTGAGAACGGAGAGGGATGCAGG + Intergenic
968909927 4:3472564-3472586 CTGTGAATGGCGGGGGCAGCAGG - Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969239408 4:5888922-5888944 CTATGGAAGGAGAGGCAAGAGGG - Intronic
970435064 4:16025433-16025455 ATGTGGGAGGAGAGGGCAGCGGG - Intronic
970903179 4:21183908-21183930 CTGAGAAGGGAGAGGAAAGGAGG - Intronic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971513933 4:27463536-27463558 CTGAGAAAGGAGAGTCATGCAGG + Intergenic
971831510 4:31701623-31701645 CTGGGAAGGGAGTGGGAAGGTGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
973716949 4:53686200-53686222 CTAAGACAGGAGAGAGAAGCAGG + Intronic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974247088 4:59333813-59333835 CTGTGAAAGAAAAGGGCACCAGG - Intergenic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974489880 4:62551062-62551084 CTGAGATGGGAGAGGGTAGCTGG + Intergenic
974994674 4:69140093-69140115 TGGTGAAAGGAGAGGCCAGCTGG + Intronic
975285063 4:72607413-72607435 CTGTGAAAGCAGCCAGAAGCGGG + Intergenic
975298636 4:72764121-72764143 CTGAGAAAGGAGAGCTAATCTGG - Intergenic
975622844 4:76310974-76310996 GTATGAAAGGAGAGGGAAGAGGG - Exonic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977027293 4:91834991-91835013 CAGTGATGGGAGAGGTAAGCTGG + Intergenic
977565918 4:98580477-98580499 CTGTGAAGGAAGATTGAAGCTGG - Intronic
977922385 4:102659906-102659928 CTGGGGATGGAGAGGGTAGCTGG - Intronic
977942514 4:102874322-102874344 CTGCTAAAGGGGAGGGAGGCAGG + Intronic
978505271 4:109449916-109449938 CTTTGAAAAGAAAGAGAAGCTGG + Intronic
978744192 4:112173533-112173555 GTGTGAAAGGATAGTGAAGAAGG + Intronic
979362855 4:119784637-119784659 TGGTGACAGGAGAGGGAAGCAGG + Intergenic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
980170096 4:129278790-129278812 GGGAGAAAGGAGAGGCAAGCTGG + Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
982116238 4:152100523-152100545 GTGTGAAGGGTGAGGGACGCAGG + Intergenic
983231982 4:165138098-165138120 TTGTAGAAGGAGAGGGAAACAGG + Intronic
983657438 4:170097863-170097885 CTGTGAAAGCAGCCAGAAGCGGG - Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
986035593 5:3933955-3933977 CTGAGAAAGGAGGGGTAAGAGGG + Intergenic
986260565 5:6142384-6142406 CTGTGAGGGGTAAGGGAAGCAGG + Intergenic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
987283456 5:16434699-16434721 CTGGGAGGGGTGAGGGAAGCAGG + Intergenic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
990502204 5:56407833-56407855 CTCTGAAAGGAGAGGGTTGCAGG + Intergenic
991183887 5:63785595-63785617 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
991466445 5:66917824-66917846 GTGTAAAAGGAGAGTGAAGGAGG - Intronic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
992992105 5:82294318-82294340 AGGTGAAAGGAGAGGCCAGCAGG + Intronic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
995040083 5:107577700-107577722 CTGTGAAAGGAGAGATTAGTTGG + Intronic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
996743802 5:126827822-126827844 CTGTGAAAGGAGTGGTCAGCGGG + Intronic
996937625 5:128966275-128966297 GTATGAAAAGAGAGGGGAGCTGG + Exonic
997098326 5:130939171-130939193 CTGTGCAATGAGCGTGAAGCAGG + Intergenic
997434628 5:133865440-133865462 CTGTGAGAGGTGGGGGAAGGTGG + Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998364551 5:141620815-141620837 TTATGAAAGGAGAGGGAAATGGG - Intergenic
998495549 5:142585535-142585557 TAGTGATAGAAGAGGGAAGCTGG - Intergenic
998562121 5:143181424-143181446 AGGTGTAAGGAGGGGGAAGCAGG - Intronic
998583809 5:143405031-143405053 CTGAGAAAGGAGAGGGCCGTGGG + Intronic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
999701806 5:154235095-154235117 CTGTGGAAGGACAAGGAACCTGG + Intronic
999701821 5:154235192-154235214 GTGATAAAGGAGAGAGAAGCAGG - Intronic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
999950860 5:156648917-156648939 CTGTGAAAAGAATGGGAACCAGG - Intronic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001380617 5:171304255-171304277 AGGTTAGAGGAGAGGGAAGCAGG - Intergenic
1002999747 6:2319815-2319837 CTCTCAGAGGAGAGGGGAGCTGG + Intergenic
1003084766 6:3052709-3052731 CTGGGAAAGCCCAGGGAAGCAGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003438690 6:6120161-6120183 CTGGTAAAGGTGAGGGGAGCTGG - Intergenic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004124721 6:12862136-12862158 GTGTGAAAGGAGAGAGCAGATGG + Intronic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1005236210 6:23764996-23765018 CTGTGGAAGAAAAGGCAAGCTGG - Intergenic
1006072501 6:31507632-31507654 CTGGGACAGGGGATGGAAGCTGG + Intronic
1006146626 6:31963389-31963411 TGAAGAAAGGAGAGGGAAGCAGG - Intronic
1006421814 6:33939215-33939237 CTGTGAGAGGAGCGAGAGGCAGG + Intergenic
1006457287 6:34139132-34139154 CGGGGGAAGGAAAGGGAAGCCGG - Intronic
1006734586 6:36263962-36263984 GTGGGAAAGGGAAGGGAAGCGGG - Intronic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1007593200 6:43035915-43035937 CTATGGAAGGAGGGGGAAGGGGG - Intergenic
1008826326 6:55698312-55698334 TGAAGAAAGGAGAGGGAAGCAGG + Intergenic
1009822438 6:68820630-68820652 CGGTGGAGGGAGAGAGAAGCGGG - Intronic
1011292990 6:85795798-85795820 GAGGGAATGGAGAGGGAAGCAGG + Intergenic
1011379741 6:86730313-86730335 CTGTGAAAGGAAGGAGAAGAGGG + Intergenic
1012265910 6:97142769-97142791 CTGTGAAAGTACACAGAAGCAGG + Exonic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013677963 6:112488205-112488227 CTGTGATAGGAAAGGGAGGAAGG - Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014547107 6:122746851-122746873 CTCTGAAAGGAGAGGGAAAGGGG - Intergenic
1014572801 6:123031352-123031374 CTGTTAAAGGAGGGGGAAATGGG + Intronic
1015058055 6:128928549-128928571 CCGTTCAAGGAGAGGGAAGGAGG + Intronic
1015874155 6:137805862-137805884 CTGCCAAAGGAAAGGAAAGCAGG - Intergenic
1015891429 6:137973516-137973538 TTGAGAAAGGAGAGTGATGCAGG - Intergenic
1016689062 6:146914756-146914778 CTGTGAGAGGGCTGGGAAGCAGG - Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1016926399 6:149353410-149353432 CTGAGGAAGAAGAGGGAATCTGG - Intronic
1016932254 6:149422910-149422932 TTCTGAAATGAGAGGGAGGCAGG + Intergenic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1019115139 6:169754176-169754198 ATGTGAAAAGAGAGGGAATGAGG + Intronic
1019533577 7:1515937-1515959 CTAGGAAGGGAGAGGGAAGGAGG - Intergenic
1019608083 7:1920113-1920135 CTGGGGAAGGACAGGGATGCTGG - Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021149960 7:17138193-17138215 CTGTGAAAGGATTGGGAATCAGG - Intergenic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021776378 7:24059038-24059060 CAGCGAAAGGAGAGAGAAGGAGG + Intergenic
1022322856 7:29303475-29303497 CTGGGAAATAAGAGGGAAGGGGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1023040169 7:36165993-36166015 CTGTAAACGGAGAGGGATTCAGG + Intronic
1023525804 7:41101584-41101606 CTGTGAAAGGATAGGGGAGCAGG + Intergenic
1024270138 7:47635767-47635789 GAGAGAGAGGAGAGGGAAGCAGG + Intergenic
1024683876 7:51723705-51723727 CAATGAAAGGAAAGGGAAGGGGG - Intergenic
1025797932 7:64757388-64757410 CTGTGGAAGGGGACGGCAGCAGG + Intergenic
1026230247 7:68476571-68476593 CTGGAAAAGGAGAGGGAGACTGG + Intergenic
1026230304 7:68477428-68477450 CTGGGCAAGGAGAGCGAAACTGG - Intergenic
1027249290 7:76389111-76389133 ATGTGAAAGGAGAGAGGAGTTGG + Intergenic
1027551532 7:79603036-79603058 TTGTGAAAGGAGATGGAAATTGG - Intergenic
1028148800 7:87347982-87348004 CTGTTAAAGCAGAGGAAAACAGG + Intronic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1028733410 7:94179256-94179278 CCCAGAAAGGAGAGGGAAGTGGG - Intergenic
1029248707 7:99220855-99220877 GGGGGAAAGGAGAGGGAAGAAGG + Intergenic
1030347328 7:108449358-108449380 CAGTGAAGGGAGGGGGGAGCTGG - Intronic
1030422231 7:109321998-109322020 ATGTGAGAGTAGAGTGAAGCAGG + Intergenic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1032397436 7:131600857-131600879 CGGTTAAAGGGGAGTGAAGCTGG - Intergenic
1032634697 7:133693782-133693804 CTGTAAGAGGAAGGGGAAGCAGG + Intronic
1033137642 7:138798217-138798239 CTGGGAAGGGGGAGGGAAGGAGG + Intronic
1033286586 7:140046617-140046639 GTCTGAAAGGAGAGGGAGGTGGG + Intronic
1033801600 7:144908484-144908506 CTTTGAAATGAGAGGTAACCAGG + Intergenic
1033918653 7:146360174-146360196 CTGTCAAAGGAGAGAGACACTGG - Intronic
1034676325 7:152895072-152895094 GTGTGCAAGGAGAGAGACGCTGG - Intergenic
1034803522 7:154068113-154068135 TTGGGAAAGGAGAGGTTAGCAGG + Intronic
1035390804 7:158503332-158503354 CTGTGAGGGTAGAGAGAAGCTGG - Intronic
1035694241 8:1582883-1582905 CTCTGAAAGAAGAGGGCAGCAGG + Intronic
1036073894 8:5473419-5473441 CTGGGAAAGGAGACACAAGCAGG - Intergenic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036199683 8:6758327-6758349 CTGTGAAATCAAAGAGAAGCAGG - Exonic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1037670664 8:21012687-21012709 ATGTCACAGAAGAGGGAAGCAGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038389924 8:27187269-27187291 GAGTGAAAGGGGAGAGAAGCAGG + Intergenic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1038687713 8:29733793-29733815 GGGTGAAGGGAGAGGGAAGTGGG - Intergenic
1039076388 8:33693829-33693851 CTCTTAATGGAGAGGGGAGCTGG - Intergenic
1039164169 8:34658255-34658277 ATGAGAAAGGAGAGATAAGCAGG + Intergenic
1039300713 8:36205736-36205758 CTGTGAAGGTAGAGGCAAGATGG + Intergenic
1039501403 8:38020568-38020590 CTATGAAGGGAAAGGGGAGCTGG - Intergenic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040002158 8:42586655-42586677 CTGTGAAAGAATTGGTAAGCTGG - Intergenic
1040106292 8:43544186-43544208 CTGAGAGAGGAGAGGAAAGGAGG - Intergenic
1040879949 8:52193547-52193569 CTGTCAGATGTGAGGGAAGCGGG - Intronic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041131957 8:54710653-54710675 CTGTCAGCGGAGAGGGGAGCTGG + Intergenic
1041199419 8:55436684-55436706 CTGTGAAAGGAGAGCCTCGCTGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1041893487 8:62897849-62897871 GTCAGAAAGCAGAGGGAAGCTGG - Intronic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1043400888 8:79883128-79883150 GTGTGGAAGGAGAGGCAAGGAGG - Intergenic
1044343455 8:91074209-91074231 CTCTCATAGGAGAGCGAAGCTGG + Intronic
1044359002 8:91259501-91259523 CTGTGCAATGAGAGGAAAGTTGG - Intronic
1044725416 8:95190824-95190846 CTATAAAGGGAGAGGGCAGCTGG + Intergenic
1044787502 8:95809996-95810018 CTGTGAAAGAAGAGAGAAAAGGG - Intergenic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1047801921 8:128318923-128318945 CTGGGAAGGGAGAGGGAACCAGG + Intergenic
1048593729 8:135845111-135845133 CAGGGACAGGATAGGGAAGCTGG + Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1049667544 8:143853127-143853149 GAGAGAAAGGAGAGGGAAGTGGG - Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051322611 9:15924659-15924681 CAATGAAAGGAGAGGAAAACAGG - Intronic
1052243936 9:26310636-26310658 CTGTGAAAGGAACTGGAAGCTGG - Intergenic
1052998869 9:34566306-34566328 CTGTCAGAGAAGAAGGAAGCAGG + Intronic
1053350806 9:37412164-37412186 CCAGGAAAGGAGTGGGAAGCAGG - Intergenic
1053415969 9:37946931-37946953 CTGTGAGAGGTAAAGGAAGCAGG - Intronic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1056813134 9:89779893-89779915 GTCTGAAAGGAGAGGTAACCAGG + Intergenic
1056970478 9:91196703-91196725 CTGTGGAAAGACAGGGGAGCCGG - Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1059720907 9:116959361-116959383 ATGTGACTGGAGAGAGAAGCAGG + Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060701135 9:125748908-125748930 AGGCGAAAGGAGAGGGAAGAGGG - Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061391744 9:130320686-130320708 CTGGGGAGGGAGAGGGGAGCAGG + Intronic
1061976521 9:134070675-134070697 CTGTGACAGGGGAGGAAACCTGG - Intergenic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062514677 9:136926682-136926704 CTGTGAGAGGAGAGGCCAGGAGG - Intronic
1062598541 9:137309960-137309982 CTGGGATTGGAGAGGGCAGCTGG - Intronic
1203782453 EBV:108185-108207 CTGGGAATGGAGAGGGGAGTGGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187361951 X:18636860-18636882 CTGGGAAAGGGGATGGAAGGTGG - Intronic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1189197126 X:39162157-39162179 ATGGGAAAGGAGAGGAAAGAAGG - Intergenic
1190722136 X:53158284-53158306 CTTTGAAAGGACAGGGCAGTGGG - Intergenic
1191058143 X:56265354-56265376 TTGTGAAAGGAGAGGTCAACTGG - Exonic
1191663838 X:63677660-63677682 GGGTGAGAGGAGAGGGAATCAGG + Intronic
1191851592 X:65589583-65589605 CTGGGAAGGGAGAGGAAGGCAGG + Intronic
1191975161 X:66863583-66863605 GAGTGAATGGCGAGGGAAGCAGG - Intergenic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1193160829 X:78227372-78227394 CTGTGCAAGAAGAAGAAAGCTGG - Intergenic
1194141013 X:90209571-90209593 GGGAGAAAGGAGAGGGAATCAGG + Intergenic
1194182789 X:90734651-90734673 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
1194980870 X:100438997-100439019 CTGTGAAAGGAAGGAGAAGGAGG - Intergenic
1195520361 X:105822476-105822498 CGGTGCAAGGAGAGGGGACCCGG - Intergenic
1195706115 X:107739036-107739058 CTGGGAAAGGAGAGGAAATAAGG + Intronic
1195940623 X:110164716-110164738 CTGTGAAAGGGAAGGATAGCGGG + Intronic
1196031509 X:111098638-111098660 CTGGGTAAGGAGAGGGCAGTGGG + Intronic
1196036924 X:111155596-111155618 CTGGGGAGGGAAAGGGAAGCAGG + Intronic
1196818685 X:119685889-119685911 CAGTCAAAAGAGAGGGAAACAGG - Intronic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197678885 X:129361125-129361147 CTTTGGAAGGATAGGGCAGCAGG - Intergenic
1197784367 X:130185967-130185989 TTGGTAAAGGAGAGGGAAGCGGG + Intergenic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1197971370 X:132118707-132118729 CTGAGACAGGAGAGACAAGCAGG - Intronic
1198088868 X:133307969-133307991 CTGGGAATGGAGGGGGAAGCTGG + Intronic
1198549218 X:137727015-137727037 CTGTGAAAGAAATGGGAAGGGGG + Intergenic
1199418563 X:147615976-147615998 CTGTGAAAGGAGAGTGATAATGG + Intergenic
1199546019 X:149007986-149008008 GTGGGAAGGGAGAGGAAAGCAGG + Intergenic
1199651346 X:149947923-149947945 CTGGGAAGGGAGAAGGAAGGAGG - Intergenic
1200394442 X:155975285-155975307 CCCTGAAAGGAGAGGGAAAGGGG - Intergenic
1200486777 Y:3778692-3778714 GGGAGAAAGGAGAGGGAATCAGG + Intergenic
1200529408 Y:4316606-4316628 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
1200885507 Y:8264455-8264477 CTGAAAAAGGAGACCGAAGCAGG - Intergenic
1200943068 Y:8805383-8805405 CCCTGAAAGGAGAGGGAAAGGGG + Intergenic
1201219194 Y:11750251-11750273 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
1202274878 Y:23106820-23106842 TTGAGAAAGAAGAGCGAAGCTGG + Intergenic
1202291150 Y:23313869-23313891 TTGAGAAAGAAGAGCGAAGCTGG - Intergenic
1202427870 Y:24740542-24740564 TTGAGAAAGAAGAGCGAAGCTGG + Intergenic
1202442921 Y:24929549-24929571 TTGAGAAAGAAGAGCGAAGCTGG - Intergenic