ID: 930678603

View in Genome Browser
Species Human (GRCh38)
Location 2:54231482-54231504
Sequence CCTGAGATGAAGAATGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 0, 3: 42, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930678603 Original CRISPR CCTGAGATGAAGAATGAGCA CGG Intronic
900717867 1:4156765-4156787 GCTGAGATGCAGACTGACCAGGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904792535 1:33034588-33034610 CATGAAATGCTGAATGAGCAAGG + Intronic
904919954 1:33999276-33999298 CCTGAGATGAACAAAGAGGCAGG + Intronic
905217258 1:36417591-36417613 CCTCAGAGGAAGAGTAAGCAAGG - Intronic
905601355 1:39254575-39254597 CTTGAGAGGAAGAATGTTCACGG + Intronic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
906224814 1:44112941-44112963 CCTGAGATGTGGAATGAAAAGGG - Intergenic
906838926 1:49114755-49114777 CCTGAGGTGAGGAAGGAGAAGGG + Intronic
906937748 1:50229202-50229224 GCTGAGATGTGGAATGAGCAGGG + Intergenic
907593850 1:55701818-55701840 ACTGTGATGAAGAATTAGCTTGG - Intergenic
908119819 1:60975580-60975602 CCTGAGATGAATAATAAGAAGGG - Intronic
908171830 1:61512629-61512651 CCTGAGATTAAGAATGGCCTGGG - Intergenic
908415431 1:63908871-63908893 ACTCAGATGAAGAATGTGCCAGG + Intronic
912584289 1:110748171-110748193 CCTGAATTTAAGAATGACCAAGG - Intergenic
913236013 1:116784145-116784167 CCTGAGCTGAAGTATGAAAATGG + Intergenic
913599058 1:120405285-120405307 GCCGAGATGAATAATGAGTAAGG - Intergenic
914088321 1:144474335-144474357 GCCGAGATGAATAATGAGTAAGG + Intergenic
914310290 1:146459875-146459897 GCCGAGATGAATAATGAGTAAGG - Intergenic
915317628 1:155038174-155038196 CCAGAGAGGAGGAATGAGCTTGG + Intronic
916888774 1:169096414-169096436 CGTGAGATGGAAAATGAACATGG + Intergenic
917626376 1:176850678-176850700 CCTGGGAGGGAGAATGAGCCAGG + Intergenic
917732358 1:177887882-177887904 CCTGAGATGAATAATCACCCCGG + Intergenic
919160869 1:193828952-193828974 TCTCAGAAGAAGAATGATCAGGG - Intergenic
919810331 1:201405285-201405307 CCTGAGACGAAGGCTGAGCAGGG - Exonic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920985192 1:210882309-210882331 CCTCAAATGGAGATTGAGCAAGG + Intronic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
923138623 1:231140997-231141019 CATGAGATGGAGAGTCAGCAAGG + Intergenic
923607389 1:235456830-235456852 GCTGAGATGAGGAATGGGCATGG - Intronic
924459550 1:244246512-244246534 CCTCAGATGACGAATGGGCTGGG - Intergenic
924531382 1:244896784-244896806 GCTGAGAGGAAACATGAGCAAGG + Intergenic
924674215 1:246159359-246159381 CCAGTGATGAAGAATGGGGAAGG + Intronic
1065044930 10:21738659-21738681 GTTAAGATGAAGAATGAGAAGGG - Intronic
1065479191 10:26175777-26175799 CATGAGATGTAGAATTACCAAGG + Intronic
1065878737 10:30021141-30021163 CATGAGCTGAAGAAAGAGCCAGG - Intronic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1067724284 10:48756530-48756552 CCTAAGATTAAGAACAAGCAAGG - Intronic
1068275599 10:54792004-54792026 CCTGAGAAGTAGAAAGAACAAGG + Intronic
1069797346 10:71061867-71061889 CCGGAGCTGCAGAAAGAGCAGGG - Intergenic
1069849373 10:71395442-71395464 ACTGAGCTGAAGGATGAGCAAGG - Intergenic
1070163497 10:73880684-73880706 CCTGAGATAAAAAATGGTCATGG + Intergenic
1070394709 10:76002184-76002206 CCTCAGAAGAAGAGTGAACAGGG - Intronic
1071336676 10:84606117-84606139 CCGGAGAGGAAAAATAAGCAGGG - Intergenic
1071807866 10:89143826-89143848 AGTGAGATGAAGACTGAGAAAGG - Intergenic
1071830063 10:89362721-89362743 CCTGAGATGAACTGTGAGGAAGG + Intronic
1073588624 10:104734906-104734928 AATGAGATGAAGTATGTGCAGGG + Intronic
1073736615 10:106355007-106355029 CCTGGGATGAAGATTAAACAAGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1076367985 10:129934506-129934528 CCTGAGATGAGGAAGCAGGAGGG - Intronic
1076728924 10:132428801-132428823 CCGGGGATGAGGAGTGAGCAGGG - Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1080061808 11:27964383-27964405 ACTAAGAGGAAAAATGAGCAGGG - Intergenic
1081434527 11:43012406-43012428 GATGAGATGAAGAATGAGAACGG + Intergenic
1081599671 11:44484344-44484366 CCTGAGGGGAAGAAAGAGCAGGG + Intergenic
1082215838 11:49567989-49568011 CGTGAGATCAAGAATGAAAAAGG + Intergenic
1083879527 11:65541125-65541147 CCTGAGCTGTAGACTGGGCAGGG + Exonic
1084629901 11:70341215-70341237 CCTGAGTTGTGGAGTGAGCAGGG + Intronic
1084630505 11:70345312-70345334 CCTGAGTTGTGGAGTGAGCAGGG + Intronic
1084750586 11:71202261-71202283 CCTGAGGGGAGGAATGAGGAGGG - Intronic
1085205013 11:74726475-74726497 CCTGAGTACAAGAATGAGGATGG + Intronic
1088372839 11:109110478-109110500 GCTGAGATGAAAAGTGAGCAGGG + Intergenic
1088429205 11:109739680-109739702 CATGAGATGAAAAATGAATAGGG - Intergenic
1088755313 11:112880801-112880823 CCTTAGATGAAGAAGTAGTATGG - Intergenic
1088789096 11:113208463-113208485 CCTGAGATGAAGAACAAGCTTGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090412815 11:126520705-126520727 CATAAGATGAAGAAAGATCAAGG + Intronic
1091326090 11:134689242-134689264 CCTGTGAAGCAGACTGAGCAGGG + Intergenic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1095744953 12:45647679-45647701 ACTGAGCTGTAGAATGAGAATGG + Intergenic
1095779967 12:46048655-46048677 CCTGAGATAGAGATGGAGCAGGG + Intergenic
1096001795 12:48136189-48136211 CCAGAGGTTAAGAATGAGGAGGG - Intronic
1096215714 12:49796572-49796594 CCTGAGATGAGGAATGGGGGTGG + Exonic
1096850775 12:54434531-54434553 GCTGAGATTTAGAATGAGCTGGG - Intergenic
1099652521 12:85446220-85446242 CCTGAGATAAACGCTGAGCATGG - Intergenic
1100085060 12:90900662-90900684 CCTTAGAACAAGAATGAGCTTGG + Intergenic
1103834624 12:123808976-123808998 CCTGAGATGCCGTCTGAGCAAGG - Intronic
1103848074 12:123913381-123913403 CGTGAGATAAAGAATCAACATGG - Intronic
1104041627 12:125134620-125134642 CCTGAGAGGGAGAAAGAGCCGGG + Intronic
1104914940 12:132259822-132259844 CCTGAGTTGAAAAATGAGTCAGG + Intronic
1107097531 13:36552645-36552667 CCTGAGAAGAAGGATGGGAAAGG + Intergenic
1107789594 13:43988443-43988465 CCTGAGATGACAAATTAGCTTGG - Intergenic
1108494366 13:51009201-51009223 CCTGAGCTGAATCTTGAGCAAGG - Intergenic
1111876687 13:93905852-93905874 CCTGAGATAAAGTATGAAGAAGG + Intronic
1112684199 13:101804060-101804082 CCAGAGAATAAGAAGGAGCATGG + Intronic
1113565587 13:111317822-111317844 ACAGAGGTGAAGAAGGAGCAAGG - Intronic
1113592356 13:111510122-111510144 GCTGAGATGAACAATGAGCGGGG - Intergenic
1115920814 14:38371381-38371403 ACTAAGATGAAGAATGAGAATGG + Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116684610 14:48021784-48021806 CCTAAGACAAAGAAAGAGCAGGG + Intergenic
1116978995 14:51147835-51147857 CCTGAGAGGACTCATGAGCAAGG - Intergenic
1118501387 14:66365620-66365642 CCTGAGTTGTAGCATGAGAAAGG + Intergenic
1119757700 14:77130569-77130591 CCTGAGCAGACGAATGAGCAAGG - Intronic
1119797495 14:77412311-77412333 CCTGAGATGAAAACAGAGAAAGG + Intronic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1120838625 14:89063320-89063342 ACTGGGAGGAAGAATGAGCTGGG + Intergenic
1121184758 14:91956841-91956863 CTTGAGAAGAAAAATGTGCAGGG + Intergenic
1121563049 14:94888227-94888249 CCTGACCTGTACAATGAGCATGG + Intergenic
1121748082 14:96318567-96318589 CATGAGATGAAGAATGCATATGG + Intronic
1122007770 14:98719333-98719355 CCAGAGATGGAGAATAAGCCTGG + Intergenic
1122365123 14:101190504-101190526 GTTGTGATGAAGACTGAGCAAGG - Intergenic
1122605613 14:102945648-102945670 CCCGAGATGGTGAGTGAGCAGGG - Exonic
1125395097 15:39238539-39238561 TCTGAGATTAAGACTGAGAAAGG + Intergenic
1126819007 15:52482936-52482958 ACTCAGGTGAAGGATGAGCAGGG + Intronic
1126892018 15:53216602-53216624 TTTGAGATGAGGAATGACCAAGG - Intergenic
1128184670 15:65634471-65634493 ACTGGGCTGAAGAAAGAGCAGGG + Intronic
1128706031 15:69837953-69837975 CCTGAGATGACGCAGGAGCTGGG - Intergenic
1129522479 15:76194590-76194612 CCTGAGATCAAGGTTGGGCACGG + Intronic
1129712632 15:77828345-77828367 ACTGAGATGAAAAAGGGGCAAGG - Intergenic
1130050506 15:80480100-80480122 TCTGAGAAGAAGATGGAGCATGG + Intronic
1130322294 15:82851364-82851386 CCTGAGATGAAGTATTCGCATGG - Intronic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1133527392 16:6618887-6618909 CCTTAGATGAGGAAGGAGCAGGG + Intronic
1133650726 16:7811663-7811685 CCTGAGATAGAGAATGGGAATGG + Intergenic
1134247100 16:12548139-12548161 GCCAAGATGAAGAATGAACAGGG - Intronic
1136062522 16:27736517-27736539 CCTGAACAGAAGAAGGAGCAAGG + Intronic
1139470488 16:67175467-67175489 CCTGAGCTGAACATGGAGCAAGG + Exonic
1142168635 16:88607788-88607810 CCTGACATGAAGCATGTGAATGG - Intronic
1144851899 17:18248033-18248055 CCTGGCAGGAAGGATGAGCATGG + Exonic
1146529146 17:33593143-33593165 CCTGAGATGAGGACGGAGAAAGG + Intronic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1149139046 17:53407872-53407894 GCTGAGATGGAGAATAAGCAGGG - Intergenic
1149407340 17:56367373-56367395 CCCGAGATAAACAATGATCAGGG - Intronic
1150480918 17:65509667-65509689 CCTGAGATCTGAAATGAGCAAGG + Intergenic
1150497271 17:65617536-65617558 CCTGAGTTGGTGAATGAGAAAGG + Intronic
1150930433 17:69578986-69579008 ACAGACATGAAGAATGGGCAAGG - Intergenic
1151174272 17:72274271-72274293 GCTGAGATTAAGAACTAGCAGGG + Intergenic
1152629160 17:81402056-81402078 CCTGGGATCAAGAAGAAGCAGGG - Intronic
1152906691 17:82974329-82974351 CCTGAGGTGAAGGACGAGCTTGG + Intronic
1156679805 18:39574616-39574638 CCTGAAATAAAGAATTAGAAGGG - Intergenic
1156744277 18:40370214-40370236 GCTGAGATCAAGAAAGACCAAGG - Intergenic
1158411807 18:57212197-57212219 CCTGGCATGATGAAGGAGCATGG - Intergenic
1159030274 18:63223609-63223631 GCTGAGATGAGGAATGAGACTGG - Intronic
1160093275 18:75846800-75846822 ACTGCCATCAAGAATGAGCAGGG + Intergenic
1161401862 19:4069411-4069433 CCAGAGATGGACAAGGAGCAAGG + Intergenic
1162725013 19:12684991-12685013 GCTGAGATGCAGAAAGATCAGGG - Intergenic
1167794985 19:51703211-51703233 CCTGAACTGAAGACGGAGCAGGG - Intergenic
926275009 2:11396917-11396939 CCTGGGATGAAGCCTGAGCTGGG - Intergenic
927991890 2:27453887-27453909 CCTGGTATGAAGAAAGATCAGGG - Intronic
928148376 2:28804052-28804074 CCTGAGAAGGAGGATGTGCAGGG + Intronic
928449795 2:31368005-31368027 CCTGAGCTGAAGATCGAGAAAGG - Exonic
928947574 2:36785538-36785560 CTTGAGATGAAGAATGAAAGAGG - Intronic
930296479 2:49560965-49560987 CCTGTGATGACAGATGAGCAAGG + Intergenic
930341213 2:50117354-50117376 CCAGAGATGAATAAGGAGAATGG + Intronic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
932742395 2:74301678-74301700 CCTGAGATGTGGCAAGAGCAAGG + Intronic
933253995 2:80060062-80060084 ACTGAGTCCAAGAATGAGCATGG + Intronic
939121426 2:138122304-138122326 TCAGAGATGAAGCATGAGTAGGG + Intergenic
940038995 2:149339755-149339777 CCAGAGAATAAGGATGAGCAGGG - Intronic
941936698 2:170987391-170987413 CCTGATCCAAAGAATGAGCATGG - Intergenic
942569743 2:177301990-177302012 TCTGAGATGGAGACTGAGTAGGG - Intronic
945338904 2:208627794-208627816 TCTTAGATGAAGACTGAACAGGG + Intronic
945372369 2:209035086-209035108 CCTGAGATGCAGAAATACCAGGG + Intergenic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946557648 2:220876311-220876333 CCTGAGATGAGCAATGAGTGGGG - Intergenic
946612447 2:221473766-221473788 GCTGAGATGAGAAATGGGCAGGG - Intronic
947249423 2:228084779-228084801 GCTTAGGTGAAGAATGAGAAAGG + Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948244703 2:236470325-236470347 CCAAAGGTGAAGAAGGAGCAGGG + Intronic
948731449 2:239966317-239966339 CCAGACATGGAGGATGAGCAGGG + Intronic
1168913492 20:1468200-1468222 TGAGAGCTGAAGAATGAGCAGGG - Intronic
1170842081 20:19932210-19932232 CCTGACAAAAAGAATGAGCTTGG + Intronic
1172356155 20:34281412-34281434 CTTGAGTTGAAGAATGAGGAAGG - Intronic
1172414921 20:34757522-34757544 CCTCAGATGAAGAGTTTGCAGGG - Exonic
1173773640 20:45684960-45684982 CCTGAAATGATGCAGGAGCAGGG + Exonic
1174665177 20:52251427-52251449 CCAGATATGAAGGATGAGAAAGG - Intergenic
1176690149 21:9897176-9897198 TCTGTTCTGAAGAATGAGCATGG + Intergenic
1176708139 21:10130064-10130086 CATGGGTTGAAGAATGAGCCTGG - Intergenic
1177808512 21:25899929-25899951 CCAGAGTTAAAGAATGAGAAAGG - Intronic
1178896429 21:36562415-36562437 ACTTAGCTGAAGAATGAGCTGGG - Intronic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1180909079 22:19435994-19436016 CCTGAGAGTAGGAATGACCAGGG + Exonic
1181666266 22:24399935-24399957 ACTCAGATGATGCATGAGCATGG - Intronic
1181744512 22:24946527-24946549 CCTGAGGTGAGGAGTGAGGAGGG - Intronic
1181911732 22:26243814-26243836 CCAGAGAAGAAAAATGAGCAGGG + Intronic
1182413003 22:30202931-30202953 CCTGAGGTGGAGAAGGAGCTTGG + Intergenic
1184408973 22:44315791-44315813 ACTGAGATGAAGAACACGCAGGG + Intergenic
1185374776 22:50477350-50477372 CCTGAGATGAGGAGTGGGCAGGG - Intergenic
949900658 3:8812362-8812384 TCTGTGGTGAAGAATGGGCAAGG + Intronic
950491310 3:13306876-13306898 TCTAAGATGAAGAATGACCCAGG + Intergenic
951796809 3:26548336-26548358 CCAGAATTGAAAAATGAGCAGGG + Intergenic
952351325 3:32541669-32541691 CCAGAGTTACAGAATGAGCATGG - Intronic
953617014 3:44500156-44500178 TCTGAGATGAACAATGAGCTGGG + Exonic
953625850 3:44570381-44570403 TCTGAGATGAACAATGAGCTGGG - Exonic
954301406 3:49702566-49702588 CCTTGGATGAGGAATGGGCAAGG + Intronic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
955116341 3:56008330-56008352 CCTGATGTGAAGAATGAGAATGG - Intronic
955341440 3:58128514-58128536 ACTGCTATGAAGAATGAGAATGG + Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
956254584 3:67270536-67270558 CCTGAGATGAAGGAGGAGTTGGG - Intergenic
956957842 3:74361405-74361427 ACTGAGATGAAGAAGCAGGATGG - Intronic
957151461 3:76491326-76491348 GATGAGAGGAAGACTGAGCATGG - Intronic
958051292 3:88350160-88350182 CCTTGGCTGAAGAAAGAGCATGG - Intergenic
960694548 3:120383318-120383340 CCTGAGATGAAGGATGAACTGGG + Intergenic
960703384 3:120459007-120459029 CCTGAAATCAAGGATCAGCAGGG - Intergenic
961214957 3:125152314-125152336 CGTGGTATGAGGAATGAGCATGG - Intronic
962055440 3:131866419-131866441 CCAGAGAGGAGGAATGAGAAAGG + Intronic
962337651 3:134550803-134550825 CCTTAAATGGAGAATAAGCAGGG + Intronic
962801473 3:138894562-138894584 ACTGAGATGAAGAAAGAGAGGGG + Intergenic
962933596 3:140059525-140059547 CTTGAGGGGAAGACTGAGCAGGG - Intronic
964680948 3:159338005-159338027 CTTGTGATGAAGTAAGAGCATGG + Intronic
965294247 3:166923538-166923560 CATGAGATGTGGAAGGAGCAAGG - Intergenic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
970050625 4:11910619-11910641 CTTTAGATGAAGAATGACTATGG + Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
972202021 4:36724538-36724560 CCTGAAGTGAGGAATGAGGAGGG + Intergenic
972796743 4:42428822-42428844 CCTGAGGACAAGAGTGAGCATGG - Intronic
972894595 4:43604172-43604194 TCTGGGAGGAAGAAAGAGCAAGG - Intergenic
973178568 4:47240226-47240248 TTTGAGAGGAAGAAGGAGCAAGG + Intronic
975647332 4:76558147-76558169 CCTGCTATGAAGAATAATCATGG + Intronic
976260330 4:83139275-83139297 TATGAGCTTAAGAATGAGCAAGG + Intergenic
977350248 4:95875378-95875400 CCTGTAATGAAGAGTGAACATGG + Intergenic
978467158 4:109020474-109020496 ACAGAGAGCAAGAATGAGCATGG + Intronic
979270605 4:118756348-118756370 TCTAAAATGAAGAATGAGCTGGG - Intronic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982410146 4:155066198-155066220 CGTAAGAAGGAGAATGAGCAAGG - Intergenic
983229804 4:165117535-165117557 TCTGTGATCAGGAATGAGCACGG - Intronic
983957032 4:173710032-173710054 CCTGAGAAGGGGATTGAGCATGG + Intergenic
984185554 4:176538750-176538772 CCTCAGGTGATGACTGAGCAAGG - Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
987381064 5:17286667-17286689 CCTGAAAGGATGAAGGAGCAAGG - Intergenic
989166267 5:38436339-38436361 CCTGAGATGGAGCATGAGGGAGG + Intronic
990498179 5:56369355-56369377 GCTAAGATGAAGGTTGAGCAAGG + Intergenic
995534464 5:113121210-113121232 CCATAGATGAAGAATGAGTTGGG - Intronic
996884753 5:128341740-128341762 CCTGGGATGAACAATGAGGAAGG - Intronic
996970035 5:129356034-129356056 CTTGAGATGAAGAAGCAGAAAGG - Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
999616231 5:153427521-153427543 CCTGAGATGATGTATAAGCTAGG + Intergenic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1003484233 6:6561981-6562003 CCTGAGATGAAGTTAAAGCAGGG - Intergenic
1005429090 6:25735299-25735321 AATGAAATGGAGAATGAGCAAGG + Intergenic
1005614319 6:27558003-27558025 CCGGAGCTGAAGATTGAGCTGGG - Intergenic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1009494659 6:64332183-64332205 CCTGACATGGAGAAGGACCACGG - Intronic
1009849752 6:69180560-69180582 CCTGAGATAATGATGGAGCAGGG - Intronic
1012013070 6:93816820-93816842 GATGAAATGAAGAATTAGCAAGG + Intergenic
1012148537 6:95717428-95717450 TCTGATATTAAAAATGAGCAAGG - Intergenic
1013608942 6:111776002-111776024 GCTGAGATGAAGAGTGAAAATGG - Intronic
1014263846 6:119251925-119251947 CCTGAAGGTAAGAATGAGCAAGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015712600 6:136158599-136158621 CCTGAGATAAAGAGAGAGCAGGG + Intronic
1016376174 6:143422619-143422641 CCTGAGATGGACAAGAAGCAAGG + Intergenic
1016550530 6:145274681-145274703 CCAGAAATGAAGAATTAGCTGGG + Intergenic
1017126865 6:151073114-151073136 CCTGAGTTGAAGACAGAGCTGGG + Intronic
1017924329 6:158897622-158897644 CCAGAGATGAAGATGGAACATGG + Intronic
1018394205 6:163364903-163364925 CCAGAGCTGACGTATGAGCAGGG + Intergenic
1019460367 7:1155184-1155206 CCTGAGATGGAGAATTCACATGG - Intronic
1019481267 7:1267850-1267872 CCTGAGATGCAGGACGAGCTGGG - Intergenic
1020468106 7:8504051-8504073 CCTGAAATGAAGCAGGGGCAGGG - Intronic
1021280732 7:18714653-18714675 CAAGAGATGAAGAATGAGAAGGG - Intronic
1022010192 7:26302148-26302170 CCTGAGATGGAAAATGGGAAGGG - Intronic
1023183624 7:37511398-37511420 CATGAGATGAACAGTGAGCAAGG - Intergenic
1024065292 7:45727196-45727218 CCTGAGATGATGGTTGAGGAAGG - Intergenic
1024311567 7:47974392-47974414 TCTGTGATGAAGCATGAGAATGG + Intronic
1025227819 7:57179619-57179641 CCTGAGGTGAAGGGTGAGCCTGG - Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1028134511 7:87211338-87211360 CCTGGGATGGGGAAAGAGCAAGG + Intronic
1028983159 7:96989496-96989518 CCTGAGATGAAGGTAGTGCAGGG + Intergenic
1031321855 7:120340077-120340099 ACTGAGATGAAGAACTAGTAGGG + Intronic
1033619405 7:143048913-143048935 CCTGAGGTTAAGAATAACCAGGG - Intergenic
1036436328 8:8737325-8737347 CCTGAGATGACCACTGAGCATGG + Intergenic
1037420205 8:18693926-18693948 ACAGAGATGAAGCATTAGCATGG + Intronic
1037697059 8:21232871-21232893 CCAAAGAAGAAGAAGGAGCAAGG + Intergenic
1039206589 8:35162359-35162381 GCAGAGATGGAGAAAGAGCAGGG - Intergenic
1039225718 8:35385995-35386017 CCTGAGATGTAGATTAAGAAGGG - Intronic
1039983680 8:42429835-42429857 CCTGAGATGAGGAGTGGGAAGGG - Intronic
1040638282 8:49301319-49301341 CCTCAGATGAAGAGTGAGCTAGG + Intergenic
1041629651 8:60072506-60072528 GCTGAGATTAGGAATGAGTAAGG - Intergenic
1041638458 8:60170999-60171021 CCTGAAATGAGGAGTTAGCAAGG - Intergenic
1042104353 8:65308906-65308928 CCTGAGATTAAAAATGTCCAAGG - Intergenic
1043414980 8:80038476-80038498 CCTGTGAAGAACAAGGAGCAGGG - Intronic
1046597080 8:116273291-116273313 TCTGTGATGAAGCATGGGCAGGG - Intergenic
1047330886 8:123885781-123885803 CCTGGGCTCAAGAATGAACATGG - Intronic
1047858134 8:128935243-128935265 GCTGAGCGGAAGAATGAGAATGG + Intergenic
1048808590 8:138264034-138264056 CAGGAGATGAAGATGGAGCAGGG - Intronic
1050365656 9:4871257-4871279 CCTGAGAAGAAGAGTGAGAAAGG + Intronic
1050412618 9:5382487-5382509 CCTGGAAAGAAGAATGAGCATGG + Intronic
1051167478 9:14279703-14279725 CCAGAGATGAAGAGTGTGAAAGG - Intronic
1051710807 9:19928519-19928541 GGTAAGATGAAGAGTGAGCAGGG - Intergenic
1052081623 9:24213140-24213162 CCTGAGAAGAAGAGAAAGCATGG - Intergenic
1055968169 9:81885512-81885534 TCTGAGATCAAGCATGCGCAGGG - Intergenic
1057045323 9:91881817-91881839 CCTGAGATGAAGAAGGATGAGGG + Intronic
1058271609 9:102979258-102979280 CATGAGATGAAAAATGAAAAGGG + Intergenic
1058747056 9:108001946-108001968 CTTGAGAGGTAGAAAGAGCAAGG + Intergenic
1060414628 9:123421641-123421663 CCAGAGATGATAAATGAGCCTGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1202792902 9_KI270719v1_random:99033-99055 CATGGGTTGAAGAATGAGCCTGG - Intergenic
1185454741 X:303225-303247 GCGGAGATGAAGAATTTGCAGGG + Exonic
1185530387 X:813953-813975 CTTGAGATGAAGAATTATCCTGG + Intergenic
1185790198 X:2923538-2923560 TCTGAGATCAAGCATGGGCAGGG + Intronic
1185989764 X:4880557-4880579 TCTGAAAAGAAAAATGAGCATGG + Intergenic
1186204284 X:7185071-7185093 CCAGAGAACAAGAATGATCAGGG + Intergenic
1188287574 X:28346696-28346718 CTTGATTTGAAGAATGAGCAGGG - Intergenic
1188848432 X:35102795-35102817 AGTGAGATGAAGAAGGAGCTAGG - Intergenic
1189567868 X:42261984-42262006 ACTGAAAAGAAGAATGAGTATGG - Intergenic
1189919039 X:45885417-45885439 CATGAGATGAAGAAGGAGTATGG + Intergenic
1192781821 X:74302005-74302027 CCTGAGATAAAGAACGAGACAGG + Intergenic
1193370530 X:80691857-80691879 CCAGAGACGAAGAATGTGAACGG - Exonic
1193845283 X:86462662-86462684 CCTGCTCTGAAGAATGAGCAGGG - Intronic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1194971206 X:100346333-100346355 TCTGAGGCTAAGAATGAGCAAGG + Intronic
1200690298 Y:6302178-6302200 CCTGAGGAGAAAAGTGAGCAAGG + Intergenic
1200826494 Y:7650211-7650233 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201044975 Y:9872538-9872560 CCTGAGGAGAAAAGTGAGCAAGG - Intergenic
1201060854 Y:10045400-10045422 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201284113 Y:12364399-12364421 TCTGAGATCAAGCATGGGCAGGG - Intergenic
1201630204 Y:16063448-16063470 CCTGAGAGGGAGAATGGCCAAGG + Intergenic
1202106793 Y:21379280-21379302 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1202111028 Y:21420861-21420883 CCTGAAGAGAAAAATGAGCAAGG + Intergenic
1202200088 Y:22337126-22337148 CCTGAGGAGAAAAATGAGCAAGG - Intronic