ID: 930683221

View in Genome Browser
Species Human (GRCh38)
Location 2:54279989-54280011
Sequence GGGAAGATAAATGCAAGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930683216_930683221 9 Left 930683216 2:54279957-54279979 CCATGCCCATTTTAAGATAAACT 0: 1
1: 0
2: 0
3: 16
4: 243
Right 930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG 0: 1
1: 0
2: 1
3: 25
4: 281
930683217_930683221 4 Left 930683217 2:54279962-54279984 CCCATTTTAAGATAAACTTCAAC 0: 1
1: 0
2: 0
3: 25
4: 318
Right 930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG 0: 1
1: 0
2: 1
3: 25
4: 281
930683218_930683221 3 Left 930683218 2:54279963-54279985 CCATTTTAAGATAAACTTCAACT 0: 1
1: 1
2: 4
3: 51
4: 385
Right 930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG 0: 1
1: 0
2: 1
3: 25
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930683221 Original CRISPR GGGAAGATAAATGCAAGTTG TGG Intronic
902208636 1:14888436-14888458 TTGAAGATAAATGCACGTAGAGG - Intronic
902798394 1:18814542-18814564 GGGAAGAGAAAGGCAAGCAGAGG - Intergenic
904482194 1:30801105-30801127 GGTAAGAGAGAAGCAAGTTGAGG - Intergenic
906032426 1:42732334-42732356 GACAAGATACATGCAAGTGGCGG - Intergenic
907456676 1:54580817-54580839 GGGAAGAGAGATGCAGGATGAGG + Intronic
908724973 1:67165660-67165682 GGTAACATAGATGCAACTTGAGG + Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909069057 1:70971666-70971688 GGGAAGAAATATGCAAATTCAGG + Intronic
909226624 1:73032826-73032848 GAAAAGAAGAATGCAAGTTGTGG - Intergenic
909664800 1:78121174-78121196 AGGAAGAAAACTGCAAGTTTGGG + Intronic
911319392 1:96394541-96394563 GCAAAGATAAATGCAATTTGGGG + Intergenic
913362289 1:117995042-117995064 GGGAAGAATAGTACAAGTTGAGG - Intronic
913505232 1:119510832-119510854 GGGAGGATAAATGGAGGCTGGGG - Intronic
914254386 1:145949496-145949518 GGGAAGTGTAATGCAAGATGAGG + Intronic
915818319 1:158993826-158993848 GGGAACATAAATGCAGCTGGAGG - Intergenic
916438004 1:164794475-164794497 AGGAAAATAAAAGCAAGCTGTGG + Intronic
916755380 1:167764506-167764528 AGGAAGAAAAATGCATGTTTTGG - Intronic
916945238 1:169719701-169719723 TGGAAGGTAAAGGCAAGATGGGG - Intronic
919366503 1:196668654-196668676 GGAGAGAGAAGTGCAAGTTGGGG - Intronic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
920655057 1:207868704-207868726 GAGAGGAGAAATGCAAGGTGGGG + Intergenic
922251054 1:223848735-223848757 GGGAACATGAATGGAAGTGGAGG - Intergenic
923879451 1:238087390-238087412 GGAAAAATAATTGCAATTTGGGG + Intergenic
924705732 1:246500460-246500482 GGGAAGACAAATCCAAGTACAGG + Intronic
1064234570 10:13562327-13562349 GGGAAAAAACATGCCAGTTGTGG - Intergenic
1064604019 10:17019501-17019523 AGCAAGCTAACTGCAAGTTGGGG - Intronic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1065135345 10:22662265-22662287 GGGAAGATAGATGTAAGTGATGG - Intronic
1066528142 10:36304941-36304963 AGGAAGACAAATGCATGATGAGG + Intergenic
1068639364 10:59385269-59385291 GGGAAGATATTTACATGTTGCGG - Intergenic
1068677183 10:59780125-59780147 GGGAAGATAAAGGCAGGCTAGGG + Intergenic
1069292027 10:66791415-66791437 GGGAAAATAATTCCAAATTGAGG - Intronic
1070429002 10:76317363-76317385 GGGAGGAAAAATACGAGTTGAGG - Intronic
1072065753 10:91869685-91869707 GGGAAGATAATTACTTGTTGGGG + Intergenic
1073839370 10:107480834-107480856 GGCAAGATAGATGCAGGTTTGGG + Intergenic
1075550160 10:123386795-123386817 GGGAAAAGAAATGAAAGTTTGGG + Intergenic
1076501256 10:130937989-130938011 GTGAAAAAAAATGCAAGTTCCGG - Intergenic
1080857079 11:36121584-36121606 GGGAAAATAATTGCTGGTTGTGG + Intronic
1081315700 11:41626508-41626530 GGGAAGAGAAGTGCAAGCAGGGG + Intergenic
1082887970 11:58108505-58108527 GGGAAGAAAAATGGAGGTAGAGG + Intronic
1083229659 11:61308255-61308277 GGGAAGACAAGTGCAAGGGGTGG - Intronic
1083583517 11:63839827-63839849 GGGAAGAGAAAGGGAAGCTGGGG - Intronic
1085018296 11:73189549-73189571 GGGAAGGGAAATGCAAGCAGGGG + Intergenic
1086924667 11:92627319-92627341 GGGAAGATAAATACAATCTAAGG + Intronic
1088356758 11:108952256-108952278 GGGAAGAAATATACAAGATGAGG + Intergenic
1088631849 11:111781085-111781107 GGGAAAATAAATTAAAGTTGTGG + Intergenic
1088943101 11:114480378-114480400 GGATAGATAAATGAATGTTGGGG + Intergenic
1089021235 11:115217073-115217095 GGAAAGAAAAAAACAAGTTGAGG - Intronic
1089438285 11:118491114-118491136 GGGTTGGTAAATGCAAGTCGAGG + Intronic
1089640579 11:119844913-119844935 GGGAAGAGAAATGGCAGTGGGGG - Intergenic
1089701403 11:120246229-120246251 GGGAAGAGAAAGGCAAGGAGAGG + Intronic
1090109052 11:123885160-123885182 GGTGAGATTAATGCAAGTTAAGG + Intronic
1091237368 11:134031227-134031249 GAGAAGACAAATGCCAGGTGGGG + Intergenic
1092550844 12:9497877-9497899 AGGAAGGTAAATGGAAGGTGAGG - Intergenic
1093062383 12:14620692-14620714 GGGAAAATATATTGAAGTTGGGG + Intronic
1093146209 12:15569790-15569812 AAGAAGAAAAATGCAAGCTGAGG + Intronic
1094009735 12:25794767-25794789 GGGAATATAAATGACATTTGCGG - Intergenic
1094520974 12:31188496-31188518 AGGAAGGTAAATGGAAGGTGAGG + Intergenic
1094704115 12:32897732-32897754 AGCACGATAAATACAAGTTGTGG - Intergenic
1095828590 12:46558068-46558090 GGGAAGATATATGAAAGAAGGGG + Intergenic
1095920993 12:47531113-47531135 GGGATGATATATTCAAATTGCGG - Intergenic
1096395640 12:51264148-51264170 GGGAAGAGAAATGCAAGACAGGG + Intronic
1102963883 12:117111732-117111754 GGGATGATAAATATATGTTGGGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104785327 12:131444875-131444897 GGGGAGCTCACTGCAAGTTGAGG - Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1108728383 13:53205498-53205520 GGGTGGATAAATGAAAGGTGTGG + Intergenic
1109119728 13:58439408-58439430 AGGAAGCTCAATGGAAGTTGTGG + Intergenic
1110259810 13:73472479-73472501 TGGAAGATAAAAGAAAGTTGGGG + Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1110923564 13:81120540-81120562 AGGAAGAGACCTGCAAGTTGAGG - Intergenic
1110950141 13:81476037-81476059 GGGAAGATAAATAAAAGGTGAGG + Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1111438181 13:88240006-88240028 TGGAGGTTAAATGCAAGATGAGG - Intergenic
1112262784 13:97892711-97892733 TGGAAGGTAATTTCAAGTTGTGG - Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1113706980 13:112441407-112441429 GTGAAGACACAGGCAAGTTGGGG - Intergenic
1114772478 14:25443999-25444021 GGGAAGATAATTAGAAATTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1119581859 14:75791309-75791331 GGGAATAGAAATATAAGTTGTGG + Intronic
1119715303 14:76854800-76854822 TGGAAAATAAATGAAAGGTGAGG + Intronic
1120246960 14:82018786-82018808 GGGAAGATCAATACAAATTTTGG - Intergenic
1120247128 14:82020423-82020445 GGGAGGAAAAATGAAAGCTGAGG - Intergenic
1122020298 14:98832493-98832515 GGGAAGATAAAAAGAAGTTCTGG - Intergenic
1122047247 14:99033001-99033023 GGGATGATCAATACAAGTGGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1127240031 15:57103236-57103258 TGTAAGATAAATGTAAATTGTGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130275342 15:82473245-82473267 AGGAAGAGAAATGCAAAGTGTGG - Intergenic
1130467702 15:84200640-84200662 AGGAAGAGAAATGCAAAGTGTGG - Intergenic
1130485948 15:84398648-84398670 AGGAAGAGAAATGCAACGTGTGG + Intergenic
1130496563 15:84472902-84472924 AGGAAGAGAAATGCAAAGTGTGG + Intergenic
1130589994 15:85205238-85205260 AGGAAGAGAAATGCAAAGTGTGG - Intergenic
1131397686 15:92099494-92099516 GAGGAGATCAAAGCAAGTTGGGG - Intronic
1131468087 15:92671728-92671750 GGGAAGAGAAACCCCAGTTGAGG + Intronic
1131848844 15:96516370-96516392 GTGAAGATATATGAAAGATGTGG - Intergenic
1134095698 16:11417042-11417064 GGGAAGATAAAAGCAACAAGAGG - Intronic
1135977800 16:27122304-27122326 GGGAAGAGAAAAGCCAGTAGTGG + Intergenic
1137295135 16:47085117-47085139 TGAAAGATAAATGCAGCTTGTGG - Intronic
1138167412 16:54815941-54815963 GGGAAGAAAAATACAAGAAGAGG + Intergenic
1138610738 16:58121902-58121924 GGCCAGAAAAATGAAAGTTGGGG - Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1140095101 16:71868359-71868381 GGGAAGATAGAGGCAAGAAGGGG + Intronic
1140725977 16:77812706-77812728 GGGAAGATACAGGAAAATTGGGG - Intronic
1142678413 17:1530335-1530357 GGGAGAAAAAAGGCAAGTTGGGG + Intronic
1144369340 17:14575189-14575211 GAGAAGCTAAATGCAAGTTTGGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146546856 17:33747660-33747682 AGGGAGAAAAATGGAAGTTGGGG - Intronic
1146602431 17:34229608-34229630 GGGCAGCTAAAGGCAAGGTGGGG - Intergenic
1147050077 17:37787609-37787631 GGGTAGATGAATGCAGGCTGAGG - Intergenic
1148001184 17:44388264-44388286 TGGAACAGAAATGCAAGGTGCGG + Intronic
1148722081 17:49761269-49761291 GGGAATAAAAATGCAAGAGGAGG + Intronic
1148782745 17:50130597-50130619 GGGAAGATAAATTGAAGCTGGGG + Intergenic
1149311519 17:55398876-55398898 TGGAAGATAAATGGAAATTCCGG - Intronic
1151174422 17:72275423-72275445 GGGAAGAGAAAAGCCAGTAGTGG + Intergenic
1151218877 17:72596803-72596825 GTGAAAATAAATGAAAATTGCGG + Intergenic
1153607439 18:6848323-6848345 GAGAAGATAAAGGCAAAATGAGG - Intronic
1155558519 18:27049324-27049346 GGGTATAGAGATGCAAGTTGGGG + Intronic
1157645652 18:49266957-49266979 GGGAAAAAAAAGGCAAATTGAGG + Intronic
1158926126 18:62262992-62263014 GTGAAGATAAAGGCAAGGTTTGG - Intronic
1159036779 18:63285311-63285333 GGGAAGAAAAATGTCAGTAGGGG + Intronic
1160105804 18:75974911-75974933 AGGAAGAAAAATGGAAGTTGGGG - Intergenic
1160279036 18:77469761-77469783 GAGAAGATACATGGAAGTAGGGG + Intergenic
1160905106 19:1448210-1448232 GGGAAGATCAATGCATGCTTGGG - Intronic
1161645497 19:5451077-5451099 GGCAAGAAAAGTGGAAGTTGGGG - Intergenic
1167906257 19:52663255-52663277 GGGAAAATAATTGCATGTTTAGG - Intronic
926656848 2:15416829-15416851 AGGAAGATAAATATAAGATGGGG + Intronic
927027856 2:19088751-19088773 GGCAAGATTAAAGCAAATTGAGG - Intergenic
929562590 2:42965019-42965041 GGGAGCATTAATCCAAGTTGTGG + Intergenic
930376758 2:50577013-50577035 GGGAATATAGATACAAGTTTTGG - Intronic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
931202593 2:60113399-60113421 GGAAAGATGAATGCAAAGTGAGG - Intergenic
932188109 2:69715770-69715792 GGGAACATAAATGGAGGTGGAGG + Intronic
932890441 2:75591757-75591779 TAGAAGATCAATGGAAGTTGGGG + Intergenic
938262711 2:129906866-129906888 GGGAAGACAGATGCATGTGGAGG - Intergenic
940065997 2:149630128-149630150 GGGAAGAAAAATACAAGATTGGG - Intergenic
940253850 2:151708501-151708523 GGGAACATATATGTAAGATGAGG - Intronic
940991232 2:160098791-160098813 GGGAAAATAAATTCCTGTTGTGG - Intergenic
941149008 2:161890611-161890633 GGAAAGCAAAATGCAAGCTGGGG - Intronic
941684076 2:168429814-168429836 GGGAAAACAAATGCAAGGTTAGG - Intergenic
942809833 2:179985279-179985301 GCAAAGATACATGCAAGTTAAGG + Intronic
943360865 2:186917312-186917334 GGGAAGGTAAATGAAGGTGGGGG + Intergenic
945065761 2:205946508-205946530 GGGAAGCTAAAGACAAGCTGAGG + Intergenic
945814410 2:214586698-214586720 GAGAACATGAATGAAAGTTGAGG - Intergenic
945998889 2:216464180-216464202 GGGAAGCAAAAAGCAAGTTGGGG + Intronic
946609662 2:221443953-221443975 GGGAGGATAACTGAAAGTAGTGG - Intronic
948299162 2:236888980-236889002 GGGAAGATTAACTCACGTTGGGG - Intergenic
1169029003 20:2393917-2393939 GGGAAAATAAATACAGGTTTAGG - Intronic
1169951312 20:11046962-11046984 GTGAAATTAAATCCAAGTTGAGG + Intergenic
1170474726 20:16703529-16703551 GGGAAGATAGATTGAAGTGGAGG - Intergenic
1171510054 20:25674820-25674842 GGGAACAGAGATGCCAGTTGAGG - Exonic
1173550817 20:43932040-43932062 GGGAAGATGTATGCAGTTTGGGG + Intronic
1173999321 20:47362787-47362809 GGGAAGATACAGACATGTTGAGG - Intergenic
1175375892 20:58523801-58523823 GCCAAGGTAAATGCAAGTTGGGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1183826546 22:40392545-40392567 GGGAAGAGAAAGGCAAGATGGGG + Intronic
1184740066 22:46422890-46422912 GGGAAGAAGAATGCAAAGTGAGG - Intronic
950519999 3:13492497-13492519 GGGAAGATGAAGCCAAGGTGTGG + Intronic
951853086 3:27164774-27164796 GTGAATAAAAATGCAACTTGTGG + Intronic
952056690 3:29455148-29455170 GGGAACATACATGTATGTTGTGG - Intronic
952081889 3:29768927-29768949 GGAAAGTCAAATTCAAGTTGGGG + Intronic
953854373 3:46489522-46489544 GGGATGAGAAATGCAGGTTCTGG + Intergenic
955025479 3:55163531-55163553 GGGAAGAACATTGCAAGTAGAGG + Intergenic
956457855 3:69441535-69441557 AAGAAGATAAATTCAAATTGTGG - Intronic
956921949 3:73939262-73939284 GGGAAATCAAATGCAATTTGTGG - Intergenic
957813036 3:85253505-85253527 TGAAAGATAAATGCAGGTTGAGG - Intronic
957992414 3:87643989-87644011 AGGAAAACAAATGCAAGTTATGG - Intergenic
959619748 3:108387045-108387067 GAGAAGATAAATGCAGCATGGGG + Intronic
962426228 3:135271445-135271467 GTGGGGATAAATGCAAGGTGGGG - Intergenic
963898520 3:150711436-150711458 GGGAGGATGAATTCAAGTGGTGG + Intergenic
964770705 3:160221953-160221975 GGGAAGACATGTGCAAGTGGAGG + Intergenic
966138054 3:176723284-176723306 AGCAAGAAAAAAGCAAGTTGGGG - Intergenic
966993174 3:185254589-185254611 GGGCAGCTAAAGGCAAGATGGGG - Intronic
967937019 3:194737156-194737178 GGGAAGAGAAAGGCAGGGTGGGG - Intergenic
969910569 4:10441574-10441596 AGGGAGGGAAATGCAAGTTGGGG + Exonic
970053658 4:11946974-11946996 GAGAAGATAAAAGAAAGTTTGGG - Intergenic
970127802 4:12833760-12833782 GGGAAGACCAATGTAAGTAGTGG - Intergenic
970682524 4:18527232-18527254 GGGAACAAAAAGGCAAGATGAGG - Intergenic
970990057 4:22202624-22202646 GGGAAAATAAAACCAATTTGTGG + Intergenic
971123929 4:23731864-23731886 GGGAAAAGAAATGCAAATAGTGG + Intergenic
971885721 4:32445010-32445032 GGGAATAAAAATGGAAGATGAGG - Intergenic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
973186765 4:47338872-47338894 AGGAAGAAAAATGGGAGTTGGGG + Intronic
973529306 4:51819099-51819121 TGGAAGAGTAATGCAAGCTGGGG + Intergenic
973742945 4:53935775-53935797 TGGAAGATAAGAACAAGTTGAGG + Intronic
973847232 4:54925212-54925234 GAGAAGAAAAATATAAGTTGAGG - Intergenic
976223306 4:82775402-82775424 GGGCAGATAAAGGAAAGTGGGGG + Intronic
976823278 4:89231719-89231741 GGGAAGAGAAGTGCAAGCAGGGG - Intergenic
977481876 4:97588714-97588736 GGTAAAACAAATCCAAGTTGTGG - Intronic
980264180 4:130493775-130493797 GTGAAGATAATTGAAACTTGGGG - Intergenic
981621516 4:146705241-146705263 AGTAACATAAATGCAATTTGAGG - Intergenic
982551095 4:156800808-156800830 TGGAAGTTAAAGGCAAGATGAGG - Intronic
982600916 4:157447226-157447248 AATAAGATAAATGAAAGTTGAGG - Intergenic
982958206 4:161798884-161798906 GGGAAGAAAAGTGGAAGGTGAGG + Intronic
983213039 4:164977780-164977802 GGGGAATTAAATGCCAGTTGGGG - Intergenic
984490732 4:180431525-180431547 GGGAAGATAGTTGCAACTTACGG - Intergenic
984877069 4:184378981-184379003 GGAAAGATGAAAGCACGTTGGGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
988486364 5:31671202-31671224 GGGAAGATAAGTGCAAGGAATGG + Intronic
992084170 5:73263115-73263137 GGGAAGAGAAGTGGAAATTGTGG - Intergenic
992385056 5:76276707-76276729 AGGAAGAAAAAAGCTAGTTGTGG - Intronic
992663949 5:78987705-78987727 GAGAGGAAAAGTGCAAGTTGAGG - Intergenic
994842110 5:104937909-104937931 GGAAATATTAATGCAAATTGAGG - Intergenic
995083417 5:108080679-108080701 GGCAAGATAACTGGAAGTGGGGG + Intronic
995559382 5:113364376-113364398 GGGTACACAAATGCAAGTGGTGG + Intronic
998158845 5:139801763-139801785 AGGAAGATCAGGGCAAGTTGAGG - Intronic
998740892 5:145199996-145200018 GGGAAGATTAATGAAAAATGAGG - Intergenic
999197059 5:149789297-149789319 AGAAAGACAAATGCAAGATGGGG + Intronic
1000974330 5:167748728-167748750 GGGGAGAGAAGTGCAAGTAGGGG + Intronic
1001192944 5:169647454-169647476 GGGAAGATAAAGGCAAGATGGGG - Intronic
1004723464 6:18289371-18289393 GAGAACCTAAATGAAAGTTGTGG + Intergenic
1005671869 6:28114495-28114517 GTAAAGACAGATGCAAGTTGAGG + Intergenic
1005992403 6:30911529-30911551 GGGAAGGGGAAAGCAAGTTGTGG + Intronic
1006040862 6:31253587-31253609 GGTATGAGAAAAGCAAGTTGAGG - Intergenic
1006051208 6:31345996-31346018 GGTATGAGAAAAGCAAGTTGAGG - Intronic
1006065658 6:31460657-31460679 GGTATGAGAAAAGCAAGTTGAGG - Intergenic
1008068292 6:47073865-47073887 GGAAAGGTAAGTGCAATTTGGGG + Intergenic
1008745591 6:54666479-54666501 TGGAGGTTAAAGGCAAGTTGGGG - Intergenic
1009708966 6:67292849-67292871 GGGAAGATAAAAGCATCTGGAGG + Intergenic
1009962302 6:70538982-70539004 TGGAATATATATGCAAGATGGGG - Intronic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011975309 6:93288663-93288685 GGGAAGATTTATGCATGGTGAGG - Intronic
1012343875 6:98162931-98162953 GGGAAGCAAAATCCAAGTTTTGG - Intergenic
1013575250 6:111477466-111477488 GGAAAGATAAATCGAAGTTTAGG + Intronic
1013867289 6:114713660-114713682 GGGAAGCTGAATGCATGCTGGGG - Intergenic
1015388434 6:132652711-132652733 GGGAAAATAGAAGCAAGTTCAGG - Intergenic
1015743235 6:136481609-136481631 GGGAAGAGTAGTGCAAGTGGTGG + Intronic
1016515288 6:144886306-144886328 GAGAGAATAAATGCAAGATGAGG + Intergenic
1016538795 6:145139513-145139535 GGGAAAATATATGCAAATTTGGG + Intergenic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1020624548 7:10561404-10561426 GGCAAGATATATGTAAGTTTTGG - Intergenic
1021773415 7:24027845-24027867 GGGGAAATATATGCGAGTTGTGG - Intergenic
1021892186 7:25196551-25196573 GGGAAGCTAAATGCAAACTCAGG - Intergenic
1024245310 7:47465328-47465350 TGGAAGATAACTGCAAGAGGGGG + Intronic
1024345931 7:48313291-48313313 GGGAAGATAAAGGCAAAAAGGGG - Intronic
1024620038 7:51149073-51149095 GGGAAGATAAATGCCCCTTCGGG - Intronic
1026160175 7:67861793-67861815 GGGAAGAGAAAAGCACCTTGGGG - Intergenic
1026309796 7:69173617-69173639 GCGAAGATAAAGGGAAATTGGGG + Intergenic
1027154131 7:75754498-75754520 GGGAAAAAAAATGCCAGGTGCGG + Intergenic
1028147242 7:87331520-87331542 GGGCAGCTAAAAGTAAGTTGGGG - Intergenic
1028937756 7:96485408-96485430 GGGAAGATCAAAGCAAGAGGAGG - Intronic
1029149385 7:98469355-98469377 GGGAAAATAAATGTTTGTTGTGG - Intergenic
1029156473 7:98521084-98521106 GGGAGGATAAAAGCAGGCTGTGG + Intergenic
1029410126 7:100404156-100404178 GGTAGGATAAATGGAGGTTGAGG - Exonic
1029490529 7:100867829-100867851 GGGAAGAGAAATCAAAGGTGGGG - Intronic
1030173137 7:106625039-106625061 GGGAAGTTAAATGCATATTTAGG + Intergenic
1030413183 7:109207885-109207907 GTGAAGATGAATGCAATTTCTGG + Intergenic
1030870393 7:114748660-114748682 GGGAAAATATTTGCAAGTTGAGG + Intergenic
1030967874 7:116016428-116016450 GGGAACAGAAATGCAAATTTGGG - Intronic
1033265190 7:139879507-139879529 AGGAATATAAATCCAACTTGGGG - Intronic
1033718183 7:144025102-144025124 GGGAAGATAAATTGAAGTGGAGG - Intergenic
1036572247 8:9990712-9990734 AGGAAGATATATGTAAATTGGGG + Intergenic
1037077935 8:14745083-14745105 GGGAAAATAAATGGAAGGAGAGG - Intronic
1038575913 8:28702593-28702615 GGGAAGAAAAATCCAGGTTGCGG - Intronic
1039129825 8:34250327-34250349 GGGAAGAGAAATAGAAGTTTAGG + Intergenic
1040439662 8:47427881-47427903 GAGAAGAAGAATGAAAGTTGGGG + Intronic
1040694768 8:49982695-49982717 GTAAAGATAAATGCAAGTTAAGG - Intronic
1041075642 8:54167172-54167194 GGTACTATAAATGCAAGTTTAGG - Intergenic
1041979490 8:63840595-63840617 GAGAAGTTAAATGGTAGTTGTGG - Intergenic
1042275710 8:67003223-67003245 GGGAAGAGAAATGGAAAGTGTGG - Intronic
1042991088 8:74640652-74640674 GGGAAAATAAATGCCAGCTGAGG + Intronic
1043809089 8:84712275-84712297 GGGACTATAAATGCCAGTTTGGG + Intronic
1045288943 8:100815584-100815606 GGGCAGTTTAATGTAAGTTGGGG - Intergenic
1046538061 8:115542051-115542073 TGGAAGAGAAATGCAAGATATGG + Intronic
1047208922 8:122825118-122825140 GGGAACATAACTGCAAGTTCTGG + Intronic
1047412448 8:124635112-124635134 GGGTAAATAAATGGAAGTTTGGG - Intronic
1049735966 8:144205219-144205241 TGGAACATGATTGCAAGTTGAGG + Intronic
1050442132 9:5675967-5675989 GGGAGGTTAAAGGCAAGATGGGG - Intronic
1050806266 9:9682523-9682545 GGGTAGATCAATGCAAGTGTGGG + Intronic
1050956745 9:11671418-11671440 GGGAACAAAAATGCAGATTGAGG - Intergenic
1051199824 9:14604521-14604543 GGGAGGAAAACTGCAGGTTGAGG + Intergenic
1051354937 9:16232660-16232682 GGGGAAATAAATGGAAATTGTGG + Intronic
1053138733 9:35668530-35668552 GGGAAGACAAATTCAACCTGGGG + Intronic
1053444275 9:38139705-38139727 TGGAAGATACATGCACGTTGAGG - Intergenic
1054716063 9:68558940-68558962 GAGAAGATGAATGCAGGTTGAGG - Intergenic
1055098146 9:72435762-72435784 TTTAAGATAAATGCTAGTTGAGG + Intergenic
1057612951 9:96562926-96562948 GGGAAGATATATGGTATTTGTGG - Intronic
1057911478 9:99023315-99023337 TGGCAGTTAAATGCAAGTAGTGG + Intronic
1058816022 9:108683513-108683535 GGGAAGCAAAATGCTAGCTGTGG - Intergenic
1062074353 9:134576425-134576447 AGAAAGGTAAATGCAATTTGAGG + Intergenic
1187491242 X:19753464-19753486 GGGGAGAGATATGCATGTTGGGG - Intronic
1187766665 X:22650067-22650089 AGGAAGATAAAAGCAAATTAAGG - Intergenic
1188669432 X:32865448-32865470 GGGAAGATAAAGTCAAGCAGAGG + Intronic
1190365837 X:49694065-49694087 GGGAAGAAGAATGCCTGTTGGGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191105274 X:56768542-56768564 AGAAAGATAAAGGCAAGGTGGGG - Intergenic
1191106267 X:56773944-56773966 AGAAAGATAAAGGCAAGGTGGGG - Intergenic
1191107260 X:56779346-56779368 AGAAAGATAAAGGCAAGGTGGGG - Intergenic
1192881754 X:75292516-75292538 GGGAAATCAAATGCAACTTGAGG + Intronic
1193432591 X:81427720-81427742 GAGAAAATAAATATAAGTTGGGG + Intergenic
1193606209 X:83570215-83570237 GGGAAGAAAGATGCCAGTAGTGG + Intergenic
1193865887 X:86729163-86729185 GGGAACACTAATGCAAGTGGTGG - Intronic
1195346943 X:103960290-103960312 GGGAAGGTGAATGGAAGTGGAGG + Intronic
1195360499 X:104078551-104078573 GGGAAGGTGAATGGAAGTGGAGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1195574556 X:106435419-106435441 GGAAAGACAAATGTAAGATGGGG + Intergenic
1196238576 X:113312258-113312280 GGGAATATAAATCCAGGTAGTGG - Intergenic
1196283310 X:113849752-113849774 AGGAAGATAAAAGCAGGTAGAGG + Intergenic
1198281696 X:135149073-135149095 GGGATGAGAAATGAAACTTGAGG - Intergenic
1198289263 X:135223449-135223471 GGGATGAGAAATGAAACTTGAGG + Intergenic
1198606160 X:138340310-138340332 GGGTAGATAAATTCAAATTAAGG - Intergenic
1198637617 X:138716634-138716656 AGGAAGAAAAATGCAATTTAAGG + Intronic
1202368480 Y:24182507-24182529 AGGAAGAGAAATGCAAAGTGTGG + Intergenic
1202502305 Y:25487610-25487632 AGGAAGAGAAATGCAAAGTGTGG - Intergenic