ID: 930686040

View in Genome Browser
Species Human (GRCh38)
Location 2:54309209-54309231
Sequence GGTTAAGTATACATACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930686040_930686042 27 Left 930686040 2:54309209-54309231 CCATGTGGTATGTATACTTAACC No data
Right 930686042 2:54309259-54309281 TAATTCATGAAAAGTACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930686040 Original CRISPR GGTTAAGTATACATACCACA TGG (reversed) Intergenic
No off target data available for this crispr