ID: 930686353

View in Genome Browser
Species Human (GRCh38)
Location 2:54312607-54312629
Sequence TAGGAAACAAAAACTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930686353_930686359 26 Left 930686353 2:54312607-54312629 CCATCATCAGTTTTTGTTTCCTA No data
Right 930686359 2:54312656-54312678 GCTATTATTTCTCCGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930686353 Original CRISPR TAGGAAACAAAAACTGATGA TGG (reversed) Intergenic
No off target data available for this crispr