ID: 930686806

View in Genome Browser
Species Human (GRCh38)
Location 2:54318215-54318237
Sequence TTTCAAATGTCAGCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930686803_930686806 17 Left 930686803 2:54318175-54318197 CCATTGTTTGAAAACAGAGTGGG No data
Right 930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG No data
930686801_930686806 18 Left 930686801 2:54318174-54318196 CCCATTGTTTGAAAACAGAGTGG No data
Right 930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930686806 Original CRISPR TTTCAAATGTCAGCAAACCC TGG Intergenic
No off target data available for this crispr