ID: 930687560

View in Genome Browser
Species Human (GRCh38)
Location 2:54325696-54325718
Sequence ACTAGGCAATGCTCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930687560_930687567 -5 Left 930687560 2:54325696-54325718 CCCCCACTGGAGCATTGCCTAGT No data
Right 930687567 2:54325714-54325736 CTAGTGGAGCTGTGAGAAGTGGG No data
930687560_930687569 20 Left 930687560 2:54325696-54325718 CCCCCACTGGAGCATTGCCTAGT No data
Right 930687569 2:54325739-54325761 ACCATCCTCCAGACCCAGAATGG 0: 9
1: 9
2: 28
3: 41
4: 200
930687560_930687566 -6 Left 930687560 2:54325696-54325718 CCCCCACTGGAGCATTGCCTAGT No data
Right 930687566 2:54325713-54325735 CCTAGTGGAGCTGTGAGAAGTGG 0: 1581
1: 2034
2: 1486
3: 837
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930687560 Original CRISPR ACTAGGCAATGCTCCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr