ID: 930688007

View in Genome Browser
Species Human (GRCh38)
Location 2:54330101-54330123
Sequence CTCTGGTAGTGGAAATTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1502
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 1481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930688003_930688007 -9 Left 930688003 2:54330087-54330109 CCAAAGACTTTTGGCTCTGGTAG 0: 1
1: 0
2: 1
3: 11
4: 124
Right 930688007 2:54330101-54330123 CTCTGGTAGTGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 1481
930688000_930688007 23 Left 930688000 2:54330055-54330077 CCAGGGAAATGCGTGAGTTACTA 0: 1
1: 0
2: 0
3: 3
4: 90
Right 930688007 2:54330101-54330123 CTCTGGTAGTGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 1481
930687999_930688007 30 Left 930687999 2:54330048-54330070 CCGTTATCCAGGGAAATGCGTGA 0: 1
1: 0
2: 0
3: 2
4: 79
Right 930688007 2:54330101-54330123 CTCTGGTAGTGGAAATTGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 1481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930688007 Original CRISPR CTCTGGTAGTGGAAATTGGG AGG Intronic
903957744 1:27036769-27036791 CTCAGAGAGTGGAATTTGGGGGG - Intergenic
903988788 1:27250038-27250060 CTCTGGTAGGGAAATTGGGGCGG + Intronic
904541758 1:31238522-31238544 CCCTGGCAGGGGAATTTGGGAGG - Intronic
907156104 1:52335662-52335684 CTCTGGTGTTGGAAAAAGGGAGG + Intronic
907947624 1:59150172-59150194 CACTGGTGGTGGAAGGTGGGGGG - Intergenic
908001403 1:59683955-59683977 CTCTGCTGCTGGAGATTGGGTGG + Intronic
908016292 1:59840568-59840590 CTCTGATAGTTGAAATTTGCTGG + Intronic
913921622 1:124839533-124839555 ATCTGCAAGTGGACATTGGGAGG + Intergenic
913927429 1:124911732-124911754 ATCTGCAAGTGGACATTGGGAGG + Intergenic
913930325 1:124952829-124952851 ATCTGTTAGTGGATATTTGGAGG - Intergenic
913931556 1:124971819-124971841 ATCTGCTAGTGGATATTTGGAGG - Intergenic
913934713 1:125024724-125024746 ATCTGGTAGTGGATATATGGAGG + Intergenic
915978829 1:160407861-160407883 GCCTGGTGGTGGAAATTGTGGGG + Intronic
916584645 1:166139936-166139958 CTCTGGTGGTGGTAGTAGGGAGG - Intronic
919431537 1:197498394-197498416 CTCTTGTAGTGCAAATTTGCTGG - Intergenic
921789119 1:219269417-219269439 CACAGGTAGTGGAAATAGTGTGG + Intergenic
922768589 1:228169484-228169506 CTCTGGTGGGGGAAGTTGTGAGG - Intronic
924144530 1:241060471-241060493 AACTGGGAGTGGAAGTTGGGGGG - Intronic
924833816 1:247628315-247628337 CTCTGCCTGTGGAAAATGGGGGG - Intergenic
1064685863 10:17860519-17860541 CTTTGGGAGTCGAAGTTGGGAGG - Intronic
1066823811 10:39535128-39535150 CTCTGCAAGTGGACATTAGGAGG + Intergenic
1067378207 10:45747826-45747848 CTCTGGGAGGGCAAAGTGGGTGG - Intronic
1068880079 10:62038954-62038976 CGCTGTTAGTGGAAACTCGGAGG - Intronic
1071644211 10:87344598-87344620 CCCTGGTAGTGGAAAGTAGAAGG + Intergenic
1072368302 10:94737468-94737490 CTCTGGTTATGGGCATTGGGAGG + Intronic
1072531497 10:96323677-96323699 CTAAGGTAGGGAAAATTGGGAGG - Intronic
1072811194 10:98463336-98463358 CTCTGGGAGTGGGCATTGGTAGG + Intronic
1073487431 10:103828552-103828574 ACCTGGTGGTGGAAAGTGGGTGG + Intronic
1074134658 10:110616060-110616082 CTCTGAGGGTGGAAATTGGGAGG - Intergenic
1075047620 10:119158737-119158759 CTCTGGTAGGCCAAACTGGGAGG + Intronic
1080370086 11:31627701-31627723 CTTTATTAGTGGAAATTTGGAGG - Intronic
1080711833 11:34755832-34755854 CTGTGGGAGTGGAAACTGTGAGG + Intergenic
1080881917 11:36329310-36329332 CTCTGGAAGTTGAAACTGGATGG - Intronic
1081003025 11:37697816-37697838 CAGTGGTTCTGGAAATTGGGTGG - Intergenic
1081214671 11:40381495-40381517 CTCTGGTGTTGAAAATTGGCTGG + Intronic
1082156475 11:48823949-48823971 ATCTGCAAGTGGATATTGGGAGG + Intergenic
1082327510 11:51165041-51165063 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082327570 11:51165891-51165913 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082332921 11:51243750-51243772 ATCTGCAAGTGGATATTGGGAGG + Intergenic
1082369796 11:51780004-51780026 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082371312 11:51802107-51802129 ATCTGCTAGTGGACATTTGGAGG + Intergenic
1082377702 11:51894766-51894788 ATCTGCTAGTGGACATTTGGAGG + Intergenic
1082390068 11:52075111-52075133 ATCTGCTAGTGGACATTTGGAGG + Intergenic
1082399755 11:52215514-52215536 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1082419237 11:52496895-52496917 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082420177 11:52510494-52510516 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082424866 11:52578510-52578532 CTCTGCAAGTGGACATTTGGAGG + Intergenic
1082468031 11:53203266-53203288 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082470947 11:53245135-53245157 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082472158 11:53262987-53263009 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082478146 11:53349701-53349723 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082491948 11:53547374-53547396 ATCTGCAAGTGGAAATTTGGAGG + Intergenic
1082524840 11:54023498-54023520 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1082605857 11:55232068-55232090 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1084132587 11:67148174-67148196 CTTTGGTAGACCAAATTGGGAGG + Intronic
1085461647 11:76697542-76697564 CTGGGGTGGGGGAAATTGGGTGG - Intergenic
1085666837 11:78421293-78421315 ATCTGGAAGTGGGAATGGGGTGG + Intergenic
1087417897 11:97882005-97882027 GTCTGGCAGTGGAAAGAGGGAGG + Intergenic
1087672723 11:101127434-101127456 CTCAGGTAGTTGAGATAGGGCGG + Exonic
1089513689 11:119018126-119018148 CTCTGGTGGTGGAGTTTGCGGGG - Intronic
1091417774 12:304637-304659 CTTTGGTAGTGGGTATTGGCAGG - Intronic
1095057509 12:37630990-37631012 ATCTGTAAGTGGATATTGGGAGG - Intergenic
1095058454 12:37649432-37649454 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1095058558 12:37651448-37651470 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1095058752 12:37655026-37655048 TTCTGGAAGTGGATATTTGGAGG + Intergenic
1097935532 12:65245450-65245472 CTCTTTTACTGGAAAGTGGGAGG + Intronic
1098807569 12:75038762-75038784 TTTTGGCAGTGGAAATTGGATGG + Intergenic
1099225730 12:79966888-79966910 CCCTGGAACTGGTAATTGGGTGG + Intergenic
1102644205 12:114393338-114393360 CTCTGGAAGGGCAAAGTGGGAGG - Intronic
1105100595 13:16446034-16446056 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1105143254 13:17143040-17143062 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1105193869 13:17945974-17945996 GTCTGGAAGTGGACATTTGGAGG + Intergenic
1106166850 13:27254888-27254910 AACAGCTAGTGGAAATTGGGTGG + Intronic
1108580917 13:51827560-51827582 CTCTGACAGTGGGAACTGGGGGG - Intergenic
1112796893 13:103066932-103066954 TACTGGGAGTGGAAATTGGATGG - Intergenic
1114000199 14:18230416-18230438 ATCTGGAAGTGGATATTTGGGGG - Intergenic
1115142597 14:30190363-30190385 GTCTGGTGGTGGAAATCTGGTGG - Intronic
1118345631 14:64938854-64938876 CTTTGGTTGGGGATATTGGGAGG - Intronic
1120612816 14:86663879-86663901 CTCTGGAAATGGAAACTTGGAGG + Intergenic
1120747652 14:88166537-88166559 TTCTGGTAGAGGGAAGTGGGTGG - Intergenic
1128359471 15:66951042-66951064 CTCTGGAAGTGGAAATGAAGAGG - Intergenic
1130131296 15:81145000-81145022 CTCTGGTCCTTGAAATAGGGAGG - Intronic
1133753667 16:8745223-8745245 CTCTGGGAGTCGAAGGTGGGTGG - Intronic
1135492667 16:22923239-22923261 CTCTGGTGCTGAACATTGGGAGG - Intergenic
1137273444 16:46918124-46918146 CTCTGGCAGGGAAAAGTGGGTGG + Intronic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1139423836 16:66866554-66866576 CTCTGGGGGTGGAAGGTGGGGGG + Intronic
1142391508 16:89803976-89803998 CTCTGGTATTGGAGATTGGCAGG - Intronic
1145264721 17:21374272-21374294 CTCTGGGAGTGGGGATAGGGAGG + Intergenic
1145418668 17:22747503-22747525 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145418842 17:22749882-22749904 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145419010 17:22752258-22752280 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145419175 17:22754637-22754659 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145419350 17:22757016-22757038 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145419521 17:22759394-22759416 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145419692 17:22761773-22761795 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145419848 17:22813971-22813993 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145420189 17:22818728-22818750 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145420441 17:22822301-22822323 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145420613 17:22824680-22824702 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145420785 17:22827060-22827082 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145420957 17:22829439-22829461 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145421129 17:22831817-22831839 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145421302 17:22834197-22834219 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145421481 17:22836576-22836598 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145421654 17:22838955-22838977 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145421999 17:22843714-22843736 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145422176 17:22846092-22846114 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145422352 17:22848471-22848493 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145422527 17:22850850-22850872 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145422702 17:22853229-22853251 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145422873 17:22855608-22855630 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145423048 17:22857986-22858008 ATCTGCCAGTGGACATTGGGAGG + Intergenic
1145423222 17:22860365-22860387 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145423397 17:22862744-22862766 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145423567 17:22865123-22865145 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145423741 17:22867502-22867524 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145424080 17:22872260-22872282 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145424250 17:22874639-22874661 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145424424 17:22877018-22877040 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145424603 17:22879397-22879419 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145424779 17:22881776-22881798 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145424950 17:22884155-22884177 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145425287 17:22888913-22888935 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145425462 17:22891292-22891314 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145425637 17:22893671-22893693 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145425809 17:22896048-22896070 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145425982 17:22898427-22898449 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145426152 17:22900806-22900828 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145426329 17:22903186-22903208 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145426496 17:22905563-22905585 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145426666 17:22907942-22907964 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145426834 17:22910322-22910344 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145427007 17:22912701-22912723 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145427173 17:22915083-22915105 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145427342 17:22917462-22917484 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145427517 17:22919841-22919863 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145427691 17:22922221-22922243 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145427861 17:22924599-22924621 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145428035 17:22926978-22927000 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145428206 17:22929357-22929379 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145428379 17:22931736-22931758 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145428726 17:22936496-22936518 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145428897 17:22938876-22938898 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145429246 17:22943634-22943656 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145429420 17:22946013-22946035 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145429588 17:22948392-22948414 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145429761 17:22950770-22950792 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145429936 17:22953149-22953171 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145430106 17:22955527-22955549 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145430283 17:22957906-22957928 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145430455 17:22960286-22960308 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145430634 17:22962666-22962688 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145430807 17:22965045-22965067 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145430979 17:22967427-22967449 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145431155 17:22969806-22969828 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145431331 17:22972187-22972209 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145431506 17:22974566-22974588 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145432023 17:22981704-22981726 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145432367 17:22986463-22986485 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145432537 17:22988845-22988867 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145432715 17:22991229-22991251 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145432890 17:22993609-22993631 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145433061 17:22995988-22996010 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145433232 17:22998367-22998389 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145433320 17:22999559-22999581 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145433487 17:23001924-23001946 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145433659 17:23004304-23004326 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145433836 17:23006683-23006705 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145434009 17:23009062-23009084 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145434188 17:23011442-23011464 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145434362 17:23013822-23013844 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145434538 17:23016202-23016224 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145434708 17:23018581-23018603 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145435051 17:23023339-23023361 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145435221 17:23025720-23025742 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145435389 17:23028098-23028120 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145435561 17:23030478-23030500 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145435732 17:23032857-23032879 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145435897 17:23035236-23035258 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145436068 17:23037615-23037637 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145436245 17:23039994-23040016 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145436420 17:23042375-23042397 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145436592 17:23044755-23044777 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145437449 17:23056653-23056675 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145437626 17:23059033-23059055 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145437798 17:23061411-23061433 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145437968 17:23063788-23063810 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145438305 17:23068546-23068568 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145438475 17:23070925-23070947 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145438651 17:23073305-23073327 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145438820 17:23075688-23075710 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145438992 17:23078069-23078091 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145439161 17:23080449-23080471 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145439498 17:23085206-23085228 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145439672 17:23087585-23087607 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145439754 17:23088777-23088799 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145439923 17:23091156-23091178 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145440005 17:23092348-23092370 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145440093 17:23093535-23093557 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145440615 17:23100673-23100695 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145440786 17:23103052-23103074 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145441480 17:23112571-23112593 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145441651 17:23114950-23114972 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145441824 17:23117330-23117352 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145442000 17:23119710-23119732 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145442177 17:23122088-23122110 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145442350 17:23124469-23124491 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145442524 17:23126850-23126872 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145442695 17:23129230-23129252 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145442866 17:23131613-23131635 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145443036 17:23133992-23134014 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145443117 17:23135185-23135207 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145443285 17:23137565-23137587 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145443461 17:23139944-23139966 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145443630 17:23142323-23142345 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145443802 17:23144702-23144724 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145443976 17:23147084-23147106 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145444149 17:23149463-23149485 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145444327 17:23151844-23151866 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145444500 17:23154223-23154245 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145444674 17:23156602-23156624 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145444853 17:23158982-23159004 ATCTGAAAGTGGACATTGGGAGG + Intergenic
1145445028 17:23161362-23161384 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145445202 17:23163742-23163764 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145445549 17:23168500-23168522 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145445724 17:23170880-23170902 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145445898 17:23173261-23173283 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145446237 17:23178019-23178041 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145446415 17:23180398-23180420 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145446584 17:23182777-23182799 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145446922 17:23187533-23187555 ATCTGCAAGTGGAGATTGGGAGG + Intergenic
1145447096 17:23189913-23189935 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145447437 17:23194672-23194694 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1145462356 17:23412641-23412663 ATCTGCAAGTGGAAATTTGGAGG + Intergenic
1145500688 17:23969943-23969965 ATCTGCAAGTGGAAATTTGGAGG + Intergenic
1145534068 17:24455478-24455500 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1145636920 17:25951522-25951544 CTCTGCAAGTGGATATTTGGAGG + Intergenic
1145656075 17:26229634-26229656 ATCTGCAAGTGGAAATTTGGAGG + Intergenic
1145682575 17:26614730-26614752 CTCTGCAAGTGGATATTTGGAGG + Intergenic
1145707216 17:26882765-26882787 CTCTGCAAGTGGATATTTGGAGG - Intergenic
1145862256 17:28220901-28220923 CTCTGGTAGACCAAGTTGGGAGG - Intergenic
1148785108 17:50142423-50142445 CTCTGGAAGTTCACATTGGGAGG + Intronic
1149575055 17:57705981-57706003 CACATGTGGTGGAAATTGGGGGG + Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151082467 17:71344633-71344655 GTCTGGAAGTGGAAATGGAGGGG - Intergenic
1153106993 18:1538928-1538950 CTCTGGAAATGGAACTTGGCTGG + Intergenic
1154558675 18:15795967-15795989 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154583785 18:16140215-16140237 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154685869 18:17539273-17539295 ATCTGGAAGTGGACATTTGGGGG + Intergenic
1154705126 18:17803415-17803437 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154729238 18:18133781-18133803 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154816776 18:19335413-19335435 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154857750 18:19900897-19900919 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154906758 18:20583953-20583975 ATCTGGAAGTGGACATTGCGAGG - Intergenic
1154908095 18:20605044-20605066 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154908511 18:20611680-20611702 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154909319 18:20624429-20624451 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154909753 18:20631016-20631038 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154911863 18:20664370-20664392 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1154925432 18:20925978-20926000 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1157465353 18:47939462-47939484 GTCTGGGAGTGGAGATGGGGTGG + Intergenic
1158102893 18:53850641-53850663 CTTTGGCAGTGAAAATGGGGTGG + Intergenic
1159875063 18:73801620-73801642 CTCTGGTAGTGTACATAGTGTGG - Intergenic
1160765510 19:805876-805898 CTCTAGTAGTTGAATTTGAGTGG + Intronic
1161155597 19:2730749-2730771 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1161155650 19:2730935-2730957 CTCCTGGAGTGGAAGTTGGGGGG + Intronic
1164514626 19:28923206-28923228 CTAGGCTGGTGGAAATTGGGAGG + Intergenic
1164902014 19:31936134-31936156 CTTTAGTAGTGGAAATATGGTGG - Intergenic
1167349217 19:48964440-48964462 TTCTGGGAGTGGAAATGGGGAGG - Intergenic
1167353882 19:48992012-48992034 GTCAGGGAGAGGAAATTGGGAGG - Intronic
1167571856 19:50293400-50293422 CTCTGGGACAGGAAACTGGGAGG + Intronic
925222215 2:2151390-2151412 CTCTCGGTGTGGACATTGGGAGG - Intronic
928325307 2:30314975-30314997 CTCTGGTACTGGAAACCTGGTGG - Intronic
929911498 2:46093426-46093448 CTTTGGAAGGGGAAATTGAGGGG - Intronic
930688007 2:54330101-54330123 CTCTGGTAGTGGAAATTGGGAGG + Intronic
932696899 2:73964589-73964611 TACTGGTAGTAGTAATTGGGGGG - Intergenic
934357932 2:92534061-92534083 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934361324 2:92587767-92587789 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934368962 2:92710272-92710294 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934382544 2:92927962-92927984 GTCTGGAAGTGGACATTTGGAGG + Intergenic
934382614 2:92929152-92929174 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934386943 2:92999123-92999145 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934389973 2:93048199-93048221 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934390385 2:93054653-93054675 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934395619 2:93139347-93139369 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934405621 2:93301214-93301236 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934424545 2:93604775-93604797 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934426173 2:93630919-93630941 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934435426 2:93780277-93780299 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934438909 2:93836659-93836681 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934447025 2:93967756-93967778 ATCTGGAAGTGGACATTTGGAGG + Intergenic
934455045 2:94146889-94146911 ATCTGGAAGTGGACATTTGGAGG + Intergenic
938225463 2:129612093-129612115 CACTGGTAGTTGAGAGTGGGTGG - Intergenic
941042482 2:160638237-160638259 CTCAGGTAGTGGAAATGGCATGG - Intergenic
941125364 2:161578214-161578236 CTCTAGTAGTGGAAGGAGGGAGG + Intronic
941357552 2:164512042-164512064 CTCTGCCAGTGAAAAGTGGGGGG + Intronic
944023885 2:195140906-195140928 CTCTGGTAGTGCAAGGTGGATGG + Intergenic
944118095 2:196210485-196210507 AGCTAGTAGTGGACATTGGGTGG + Intronic
947634768 2:231674361-231674383 CTCTGAGAGTGGAAGTGGGGAGG + Intergenic
948924540 2:241086607-241086629 CTCTGGTTGTTCACATTGGGAGG + Intronic
1168923603 20:1561095-1561117 CTCTGGTAGTGGACAGAGGAAGG + Intronic
1169496247 20:6118371-6118393 CTTTGGTAGTGGTGACTGGGAGG + Intronic
1171084547 20:22225481-22225503 CAATGGCAGTGGAAATGGGGAGG - Intergenic
1171573985 20:26281898-26281920 ATCTGCAAGTGGAAATTTGGAGG + Intergenic
1171575628 20:26311401-26311423 ATCTGCTAGTGGACATTTGGAGG + Intergenic
1171576637 20:26332336-26332358 ATCTGGAAGTGGAAATTTGGAGG + Intergenic
1171578477 20:26367339-26367361 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1171595932 20:26675746-26675768 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1171631649 20:27211483-27211505 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1171641758 20:27362898-27362920 CCCTGGAAGTGGACATTTGGAGG + Intergenic
1171645852 20:27424089-27424111 CCCTGGAAGTGGACATTTGGAGG + Intergenic
1171668491 20:27763633-27763655 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1171686471 20:28033250-28033272 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1171737330 20:28807260-28807282 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1171738623 20:28830650-28830672 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1171738944 20:28836081-28836103 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1171739040 20:28837953-28837975 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1171739086 20:28838806-28838828 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1171739741 20:28866712-28866734 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1171807430 20:29692971-29692993 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1171821795 20:29854003-29854025 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1171821852 20:29855028-29855050 ATCTGGAAGTGGATATTTGGTGG + Intergenic
1171825368 20:29896649-29896671 ATCTGCTAGTGGACATTTGGAGG + Intergenic
1173874766 20:46363627-46363649 CTGTGGTAGTGGGAATGGAGAGG - Intronic
1176320929 21:5323458-5323480 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1176322006 21:5337242-5337264 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1176478219 21:7251768-7251790 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1176478310 21:7253479-7253501 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1176479662 21:7269027-7269049 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1176758541 21:10746634-10746656 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG + Intergenic
1180424663 22:15160189-15160211 ATCTGGAAGTGGATATTTGGGGG - Intergenic
1180503026 22:15955379-15955401 ATCTGGAAGTGGACATTTGGAGG - Intergenic
1180508768 22:16050956-16050978 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1180872383 22:19153733-19153755 ATCTGGTACTGGAAGTGGGGTGG + Intergenic
1181168333 22:20994952-20994974 CACTGATAGTGGAGATTGTGCGG + Exonic
1182159354 22:28106115-28106137 AAGCGGTAGTGGAAATTGGGAGG - Intronic
1183005113 22:34894835-34894857 CTTTGGCAGTGGAAATTCTGGGG - Intergenic
1184413065 22:44337045-44337067 CTCTGGAACTGTAAAGTGGGTGG - Intergenic
1203335550 22_KI270739v1_random:67133-67155 ATCTGGAAGTGGACATTTGGAGG + Intergenic
951544929 3:23815223-23815245 CTCTGGAAGGGCAAAGTGGGTGG - Intronic
951902196 3:27667829-27667851 CACTGGTATTTGATATTGGGTGG + Intergenic
952945191 3:38474250-38474272 CCATGGTAGTGGCAAGTGGGTGG + Intronic
952966922 3:38626812-38626834 ATCTGGTAGAGGAACGTGGGAGG + Intronic
953201522 3:40782093-40782115 CTCTGGGTGTGGCAAGTGGGTGG + Intergenic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
956136998 3:66109273-66109295 ATCTGGAAGTAGAAATTAGGTGG - Intergenic
958209915 3:90459841-90459863 ATCTGCTAGTGGAAATTTTGGGG - Intergenic
958210866 3:90473146-90473168 ATCTGCTAGTGGACATTTGGAGG - Intergenic
960527654 3:118728364-118728386 CTCTGATGTTGGAACTTGGGAGG + Intergenic
960851060 3:122054976-122054998 CTTTGGTTGTGGAAATTGGCAGG + Intergenic
961628936 3:128282224-128282246 CACTGGTGGTGGGAAGTGGGTGG + Intronic
961757044 3:129134421-129134443 CTCAGGTTGTGGAAGTGGGGAGG - Intronic
963902622 3:150746823-150746845 CCCTGGTAGTGCTCATTGGGTGG - Intronic
967085889 3:186094903-186094925 CTATGGTAGTCGAAAGGGGGCGG - Intronic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
970687972 4:18590015-18590037 TTCTGGTAGTGGAAATTCAAGGG - Intergenic
973943412 4:55933061-55933083 CTCTGGAAGTGGAAATGAAGTGG - Intergenic
974639964 4:64616015-64616037 CTCTTATAGGGGAAATTGTGTGG + Intergenic
979601926 4:122594686-122594708 CTGTGGTGGTAGAAATTAGGAGG - Intergenic
982119813 4:152132150-152132172 TGCTGGTAGTGGAAAGTGGGAGG + Intergenic
984024360 4:174524851-174524873 CAGTGGCAGTGGAAATTGAGAGG - Intergenic
984591708 4:181624879-181624901 CTCTGGTAGTTGATCTTGGCTGG + Intergenic
985666710 5:1184782-1184804 CTCTGGGAGAGGCCATTGGGAGG + Intergenic
988601403 5:32642572-32642594 CTCTGTTAGTGTAAAGTTGGGGG - Intergenic
988993467 5:36693099-36693121 CTCTGGGAGAGGAAGCTGGGTGG - Intergenic
989831020 5:45919046-45919068 CTCTGCTAATGGATATTTGGGGG - Intergenic
989861496 5:46382867-46382889 ATCTGCTAGTGGACATTGGAGGG + Intergenic
994507348 5:100658850-100658872 CTATGGTACTGGAAACTAGGGGG + Intergenic
994819788 5:104634527-104634549 GACTGGTAGTGGGAAGTGGGGGG + Intergenic
997281234 5:132647559-132647581 CTCTAGTAGTGGAGATCTGGGGG - Intergenic
999676129 5:154004736-154004758 CTCAAGTAGTGGTAATAGGGAGG - Intronic
999722911 5:154412119-154412141 CTCTGCAACAGGAAATTGGGTGG + Intronic
1001891646 5:175344368-175344390 CACTGGGAGAGGAAAGTGGGAGG - Intergenic
1003435930 6:6088064-6088086 CTCTGGTAGTGAGCATTTGGTGG + Intergenic
1005988143 6:30886672-30886694 TTCTGGAAGTGGGAACTGGGGGG + Intronic
1007209327 6:40179479-40179501 CTATGATAGTGGAGGTTGGGAGG + Intergenic
1011211457 6:84960149-84960171 CTCTGGCTGTGGGAATTGAGGGG + Intergenic
1013754267 6:113442536-113442558 CTCATGTAGTGGAGGTTGGGAGG - Intergenic
1015122189 6:129711809-129711831 CTATGGAAGTGGAAATGGGAAGG - Intergenic
1017488125 6:154921474-154921496 CTCGGCTAGTGGAAGCTGGGGGG + Intronic
1023329831 7:39103303-39103325 CTGTTGTAGTGGACACTGGGTGG + Intronic
1025308723 7:57897582-57897604 ATCTGTAAGTGGAAATTTGGAGG + Intergenic
1025310604 7:57934594-57934616 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1025314827 7:58008020-58008042 ATCTGCAAGTGGAAATTTGGAGG + Intergenic
1025660719 7:63556359-63556381 GTCTGGTTGTGGGAGTTGGGTGG + Intergenic
1028266520 7:88733247-88733269 CTCTGCTTGTGGAAATGGGAGGG - Intergenic
1031626003 7:123993549-123993571 CTCTGAAAGTGGGAATTAGGAGG - Intergenic
1032353834 7:131190815-131190837 GACTGGTAGTGGAAAATGGATGG + Intronic
1032730533 7:134637823-134637845 CTCTGATAATGGAAATTAGAGGG - Intergenic
1033187702 7:139243953-139243975 CTTTGGTAGTGAACATTTGGTGG + Intronic
1040144725 8:43976437-43976459 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040145389 8:44035889-44035911 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040145640 8:44039631-44039653 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040145709 8:44040822-44040844 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040145839 8:44042691-44042713 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040145967 8:44044561-44044583 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146047 8:44045754-44045776 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146138 8:44047111-44047133 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146219 8:44048304-44048326 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146310 8:44049661-44049683 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146390 8:44050854-44050876 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146571 8:44053566-44053588 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146729 8:44055953-44055975 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146821 8:44057309-44057331 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040146911 8:44058666-44058688 ATCTGGAAGTGGACATTTGGTGG + Intergenic
1040147040 8:44060536-44060558 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147120 8:44061729-44061751 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147212 8:44063085-44063107 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147292 8:44064278-44064300 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147385 8:44065634-44065656 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147465 8:44066825-44066847 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147544 8:44068018-44068040 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147635 8:44069374-44069396 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147724 8:44070730-44070752 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147850 8:44072598-44072620 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040147941 8:44073955-44073977 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040148034 8:44075311-44075333 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040148426 8:44080922-44080944 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040148506 8:44082115-44082137 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040148632 8:44083983-44084005 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040148725 8:44085340-44085362 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040148895 8:44087890-44087912 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040148975 8:44089083-44089105 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149190 8:44092308-44092330 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149235 8:44092989-44093011 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149362 8:44094859-44094881 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149545 8:44097570-44097592 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149629 8:44098763-44098785 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149676 8:44099438-44099460 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149757 8:44100631-44100653 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149849 8:44101987-44102009 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040149928 8:44103180-44103202 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150009 8:44104373-44104395 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150090 8:44105566-44105588 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150261 8:44108114-44108136 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150340 8:44109307-44109329 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150421 8:44110500-44110522 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150512 8:44111856-44111878 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150592 8:44113050-44113072 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150684 8:44114406-44114428 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040150775 8:44115762-44115784 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151155 8:44121370-44121392 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151235 8:44122563-44122585 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151325 8:44123919-44123941 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151406 8:44125113-44125135 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151495 8:44126469-44126491 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151577 8:44127662-44127684 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151666 8:44129018-44129040 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151793 8:44130886-44130908 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040151873 8:44132079-44132101 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040152000 8:44133947-44133969 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040152093 8:44135303-44135325 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040152185 8:44136659-44136681 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040152532 8:44141754-44141776 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040152736 8:44144817-44144839 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040152826 8:44146171-44146193 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040152996 8:44148720-44148742 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153077 8:44149914-44149936 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153168 8:44151270-44151292 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153340 8:44153819-44153841 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153431 8:44155172-44155194 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153599 8:44157722-44157744 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153680 8:44158916-44158938 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153773 8:44160273-44160295 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153850 8:44161467-44161489 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040153942 8:44162823-44162845 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154069 8:44164691-44164713 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154161 8:44166047-44166069 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154255 8:44167404-44167426 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154346 8:44168760-44168782 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154439 8:44170116-44170138 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154565 8:44171984-44172006 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154647 8:44173177-44173199 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154854 8:44176239-44176261 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040154946 8:44177595-44177617 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155038 8:44178951-44178973 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155119 8:44180141-44180163 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155199 8:44181334-44181356 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155292 8:44182693-44182715 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155383 8:44184049-44184071 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155473 8:44185406-44185428 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155554 8:44186601-44186623 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155645 8:44187957-44187979 ATCTGGAAGTGGACATTCGGAGG + Intergenic
1040155893 8:44191693-44191715 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040155984 8:44193049-44193071 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156076 8:44194405-44194427 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156169 8:44195763-44195785 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156260 8:44197119-44197141 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156341 8:44198312-44198334 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156421 8:44199506-44199528 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156500 8:44200699-44200721 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156592 8:44202055-44202077 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156670 8:44203248-44203270 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156750 8:44204442-44204464 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156887 8:44206313-44206335 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040156978 8:44207669-44207691 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157068 8:44209025-44209047 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157148 8:44210218-44210240 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157275 8:44212086-44212108 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157482 8:44215147-44215169 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157575 8:44216503-44216525 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157667 8:44217859-44217881 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157883 8:44221083-44221105 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040157964 8:44222276-44222298 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158055 8:44223632-44223654 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158147 8:44224988-44225010 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158227 8:44226181-44226203 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158249 8:44226519-44226541 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158329 8:44227712-44227734 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158464 8:44229697-44229719 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158649 8:44232408-44232430 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158743 8:44233765-44233787 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158823 8:44234958-44234980 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158914 8:44236314-44236336 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040158960 8:44236995-44237017 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159039 8:44238189-44238211 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159130 8:44239545-44239567 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159210 8:44240738-44240760 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159302 8:44242094-44242116 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159381 8:44243287-44243309 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159461 8:44244480-44244502 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159541 8:44245673-44245695 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159620 8:44246866-44246888 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040159794 8:44249410-44249432 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040160121 8:44254341-44254363 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040160246 8:44256209-44256231 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040160326 8:44257402-44257424 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040160404 8:44258595-44258617 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040160532 8:44260464-44260486 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040160611 8:44261657-44261679 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040160947 8:44266588-44266610 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161037 8:44267945-44267967 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161118 8:44269138-44269160 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161198 8:44270331-44270353 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161290 8:44271686-44271708 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161398 8:44273221-44273243 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161419 8:44273559-44273581 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161631 8:44276620-44276642 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161710 8:44277813-44277835 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161790 8:44279006-44279028 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040161970 8:44281717-44281739 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040162062 8:44283073-44283095 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040162144 8:44284266-44284288 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040162315 8:44286815-44286837 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040162487 8:44289366-44289388 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040162579 8:44290722-44290744 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040162660 8:44291916-44291938 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040162910 8:44295482-44295504 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040163002 8:44296838-44296860 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040163129 8:44298709-44298731 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040163222 8:44300065-44300087 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040163313 8:44301421-44301443 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040163658 8:44306515-44306537 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040163833 8:44309065-44309087 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040163994 8:44311451-44311473 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164085 8:44312807-44312829 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164163 8:44314003-44314025 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164290 8:44315872-44315894 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164499 8:44318936-44318958 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164581 8:44320131-44320153 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164672 8:44321487-44321509 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164764 8:44322843-44322865 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164844 8:44324038-44324060 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040164924 8:44325231-44325253 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165048 8:44327099-44327121 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165127 8:44328292-44328314 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165331 8:44331354-44331376 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165425 8:44332710-44332732 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165515 8:44334066-44334088 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165597 8:44335259-44335281 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165688 8:44336615-44336637 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165768 8:44337808-44337830 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165861 8:44339164-44339186 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040165990 8:44341032-44341054 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166080 8:44342388-44342410 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166160 8:44343582-44343604 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166243 8:44344776-44344798 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166426 8:44347489-44347511 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166506 8:44348682-44348704 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166584 8:44349877-44349899 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166664 8:44351070-44351092 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040166952 8:44355487-44355509 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040167034 8:44356679-44356701 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040167111 8:44357873-44357895 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040167549 8:44364324-44364346 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040167642 8:44365680-44365702 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040167735 8:44367035-44367057 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040167816 8:44368228-44368250 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040167896 8:44369421-44369443 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040168070 8:44371966-44371988 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040168152 8:44373160-44373182 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040168244 8:44374516-44374538 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040168451 8:44377578-44377600 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040168531 8:44378771-44378793 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169031 8:44386247-44386269 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169112 8:44387440-44387462 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169239 8:44389308-44389330 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169321 8:44390501-44390523 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169401 8:44391695-44391717 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169479 8:44392888-44392910 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169572 8:44394244-44394266 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040169903 8:44399175-44399197 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040170208 8:44403593-44403615 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040170299 8:44404949-44404971 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040170609 8:44409530-44409552 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040170826 8:44412756-44412778 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171158 8:44417679-44417701 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171249 8:44419035-44419057 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171330 8:44420228-44420250 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171456 8:44422095-44422117 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171536 8:44423288-44423310 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171616 8:44424483-44424505 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171709 8:44425839-44425861 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171839 8:44427707-44427729 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040171964 8:44429577-44429599 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172044 8:44430771-44430793 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172125 8:44431964-44431986 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172217 8:44433320-44433342 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172345 8:44435189-44435211 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172426 8:44436384-44436406 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172516 8:44437740-44437762 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172598 8:44438933-44438955 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172678 8:44440126-44440148 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172760 8:44441319-44441341 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172851 8:44442675-44442697 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040172932 8:44443870-44443892 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173026 8:44445226-44445248 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173106 8:44446419-44446441 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173186 8:44447612-44447634 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173268 8:44448806-44448828 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173350 8:44449999-44450021 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040173430 8:44451192-44451214 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040173511 8:44452385-44452407 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173765 8:44456124-44456146 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173845 8:44457317-44457339 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040173892 8:44457993-44458015 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174139 8:44461730-44461752 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174219 8:44462923-44462945 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174299 8:44464116-44464138 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174391 8:44465472-44465494 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174484 8:44466828-44466850 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174701 8:44470054-44470076 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174782 8:44471247-44471269 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174863 8:44472441-44472463 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040174954 8:44473797-44473819 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040175033 8:44474990-44475012 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040175115 8:44476184-44476206 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040175194 8:44477377-44477399 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040175410 8:44480604-44480626 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040175502 8:44481960-44481982 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040175583 8:44483153-44483175 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040175690 8:44484684-44484706 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176152 8:44491483-44491505 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176244 8:44492839-44492861 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176338 8:44494195-44494217 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176418 8:44495388-44495410 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176498 8:44496582-44496604 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176580 8:44497776-44497798 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176705 8:44499644-44499666 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176797 8:44501000-44501022 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176889 8:44502355-44502377 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040176969 8:44503549-44503571 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040177062 8:44504905-44504927 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040177450 8:44510513-44510535 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040177529 8:44511707-44511729 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040177619 8:44513066-44513088 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178007 8:44518841-44518863 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178085 8:44520034-44520056 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178163 8:44521228-44521250 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178254 8:44522584-44522606 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178386 8:44524453-44524475 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178465 8:44525646-44525668 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178546 8:44526839-44526861 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178640 8:44528196-44528218 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178722 8:44529389-44529411 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178845 8:44531257-44531279 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040178972 8:44533126-44533148 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179054 8:44534320-44534342 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179271 8:44537545-44537567 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179351 8:44538738-44538760 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179431 8:44539932-44539954 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179511 8:44541126-44541148 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179678 8:44543675-44543697 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179758 8:44544868-44544890 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179850 8:44546224-44546246 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040179976 8:44548092-44548114 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180055 8:44549285-44549307 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180228 8:44551834-44551856 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180317 8:44553190-44553212 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180408 8:44554546-44554568 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180500 8:44555902-44555924 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180580 8:44557094-44557116 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180672 8:44558450-44558472 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180752 8:44559643-44559665 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180833 8:44560836-44560858 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180916 8:44562031-44562053 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040180996 8:44563224-44563246 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181087 8:44564580-44564602 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181215 8:44566448-44566470 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181307 8:44567804-44567826 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181430 8:44569668-44569690 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181524 8:44571021-44571043 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181618 8:44572377-44572399 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181698 8:44573575-44573597 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181777 8:44574768-44574790 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181869 8:44576124-44576146 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040181959 8:44577480-44577502 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182040 8:44578673-44578695 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182124 8:44579866-44579888 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182204 8:44581060-44581082 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182296 8:44582416-44582438 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182376 8:44583610-44583632 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182455 8:44584803-44584825 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182545 8:44586159-44586181 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182715 8:44588708-44588730 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182795 8:44589902-44589924 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182876 8:44591094-44591116 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040182956 8:44592288-44592310 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183038 8:44593481-44593503 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183118 8:44594676-44594698 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183200 8:44595869-44595891 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040183291 8:44597224-44597246 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183374 8:44598417-44598439 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183454 8:44599610-44599632 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183534 8:44600803-44600825 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183614 8:44601996-44602018 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183742 8:44603864-44603886 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183834 8:44605220-44605242 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183914 8:44606413-44606435 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040183994 8:44607606-44607628 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040184087 8:44608962-44608984 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040184214 8:44610830-44610852 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040184524 8:44615411-44615433 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040184653 8:44617279-44617301 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040184801 8:44619492-44619514 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040184894 8:44620848-44620870 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185065 8:44623397-44623419 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185156 8:44624753-44624775 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185249 8:44626109-44626131 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185329 8:44627302-44627324 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185419 8:44628659-44628681 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185499 8:44629852-44629874 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185579 8:44631045-44631067 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185659 8:44632239-44632261 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185740 8:44633434-44633456 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185820 8:44634626-44634648 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185868 8:44635301-44635323 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040185949 8:44636492-44636514 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186020 8:44637514-44637536 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186099 8:44638709-44638731 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186181 8:44639902-44639924 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186260 8:44641096-44641118 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186440 8:44643810-44643832 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186567 8:44645678-44645700 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186649 8:44646871-44646893 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186730 8:44648064-44648086 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186857 8:44649934-44649956 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040186949 8:44651290-44651312 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187040 8:44652646-44652668 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187120 8:44653840-44653862 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187246 8:44655709-44655731 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187326 8:44656902-44656924 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187409 8:44658095-44658117 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187490 8:44659291-44659313 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187537 8:44659967-44659989 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187667 8:44661835-44661857 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187748 8:44663028-44663050 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187840 8:44664384-44664406 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040187966 8:44666252-44666274 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188057 8:44667607-44667629 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188149 8:44668963-44668985 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188242 8:44670321-44670343 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188321 8:44671516-44671538 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188412 8:44672872-44672894 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188505 8:44674226-44674248 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188586 8:44675421-44675443 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188676 8:44676777-44676799 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188846 8:44679326-44679348 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040188926 8:44680519-44680541 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189018 8:44681874-44681896 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189108 8:44683230-44683252 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189201 8:44684587-44684609 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189591 8:44690360-44690382 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189671 8:44691553-44691575 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189763 8:44692909-44692931 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189843 8:44694101-44694123 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040189925 8:44695295-44695317 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190017 8:44696651-44696673 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190099 8:44697844-44697866 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190145 8:44698519-44698541 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190225 8:44699712-44699734 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190350 8:44701580-44701602 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190478 8:44703451-44703473 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190649 8:44706001-44706023 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190742 8:44707357-44707379 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190822 8:44708548-44708570 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190902 8:44709741-44709763 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040190982 8:44710934-44710956 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191061 8:44712127-44712149 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191141 8:44713320-44713342 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191232 8:44714676-44714698 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191311 8:44715869-44715891 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191391 8:44717062-44717084 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191484 8:44718418-44718440 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191693 8:44721479-44721501 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191764 8:44722501-44722523 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191845 8:44723694-44723716 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040191925 8:44724887-44724909 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040192017 8:44726243-44726265 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040192097 8:44727436-44727458 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040192189 8:44728792-44728814 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040192269 8:44729986-44730008 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193119 8:44742392-44742414 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193198 8:44743585-44743607 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193289 8:44744941-44744963 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193369 8:44746134-44746156 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193415 8:44746815-44746837 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193494 8:44748009-44748031 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193665 8:44750558-44750580 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193756 8:44751913-44751935 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193836 8:44753107-44753129 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040193917 8:44754300-44754322 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194000 8:44755494-44755516 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194081 8:44756687-44756709 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194161 8:44757881-44757903 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194241 8:44759074-44759096 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194368 8:44760944-44760966 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194460 8:44762300-44762322 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194540 8:44763493-44763515 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194631 8:44764849-44764871 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194724 8:44766205-44766227 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194804 8:44767401-44767423 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194896 8:44768757-44768779 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040194975 8:44769950-44769972 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040195053 8:44771144-44771166 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040195100 8:44771825-44771847 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040195180 8:44773019-44773041 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040195260 8:44774212-44774234 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040195440 8:44776924-44776946 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040195649 8:44779984-44780006 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040195935 8:44784232-44784254 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196012 8:44785426-44785448 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040196059 8:44786101-44786123 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196139 8:44787294-44787316 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196360 8:44790520-44790542 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196568 8:44793581-44793603 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196700 8:44795449-44795471 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196781 8:44796640-44796662 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196861 8:44797834-44797856 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040196941 8:44799027-44799049 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197034 8:44800383-44800405 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197113 8:44801575-44801597 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197205 8:44802931-44802953 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197284 8:44804124-44804146 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197411 8:44805994-44806016 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197491 8:44807187-44807209 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197617 8:44809056-44809078 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197708 8:44810412-44810434 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197802 8:44811768-44811790 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040197929 8:44813637-44813659 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040198010 8:44814828-44814850 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040198090 8:44816021-44816043 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040198294 8:44819083-44819105 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040198475 8:44821795-44821817 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040198554 8:44822990-44823012 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040198680 8:44824858-44824880 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040198772 8:44826214-44826236 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199018 8:44829950-44829972 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199098 8:44831143-44831165 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199224 8:44833011-44833033 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199315 8:44834367-44834389 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199394 8:44835559-44835581 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199550 8:44837946-44837968 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199597 8:44838621-44838643 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199724 8:44840488-44840510 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199806 8:44841681-44841703 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199886 8:44842874-44842896 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040199978 8:44844230-44844252 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200058 8:44845423-44845445 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200241 8:44848136-44848158 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200332 8:44849492-44849514 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200412 8:44850685-44850707 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200538 8:44852554-44852576 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200710 8:44855105-44855127 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200790 8:44856298-44856320 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200919 8:44858167-44858189 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040200999 8:44859361-44859383 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201081 8:44860554-44860576 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201172 8:44861910-44861932 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201266 8:44863266-44863288 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201482 8:44866492-44866514 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201576 8:44867847-44867869 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201749 8:44870396-44870418 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201829 8:44871589-44871611 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040201954 8:44873458-44873480 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202079 8:44875326-44875348 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202155 8:44876519-44876541 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202200 8:44877200-44877222 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202292 8:44878556-44878578 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202380 8:44879911-44879933 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202472 8:44881267-44881289 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202552 8:44882460-44882482 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202632 8:44883653-44883675 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202724 8:44885009-44885031 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202815 8:44886366-44886388 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202887 8:44887388-44887410 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040202968 8:44888582-44888604 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203060 8:44889938-44889960 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203149 8:44891294-44891316 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203330 8:44894006-44894028 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203412 8:44895199-44895221 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203492 8:44896392-44896414 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203571 8:44897586-44897608 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203663 8:44898942-44898964 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203743 8:44900135-44900157 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040203822 8:44901328-44901350 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204048 8:44904729-44904751 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204128 8:44905922-44905944 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204219 8:44907278-44907300 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204348 8:44909146-44909168 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204394 8:44909827-44909849 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204485 8:44911183-44911205 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204564 8:44912376-44912398 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204690 8:44914243-44914265 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204815 8:44916111-44916133 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040204907 8:44917465-44917487 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040205078 8:44920014-44920036 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040205355 8:44924082-44924104 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040205572 8:44927306-44927328 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040205663 8:44928662-44928684 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040205755 8:44930019-44930041 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040205826 8:44931041-44931063 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040205918 8:44932397-44932419 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206009 8:44933754-44933776 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206101 8:44935110-44935132 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206181 8:44936303-44936325 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206261 8:44937496-44937518 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206386 8:44939366-44939388 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206515 8:44941235-44941257 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206607 8:44942591-44942613 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206687 8:44943784-44943806 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206778 8:44945140-44945162 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206871 8:44946496-44946518 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040206963 8:44947852-44947874 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207055 8:44949209-44949231 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207224 8:44951759-44951781 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207269 8:44952434-44952456 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207383 8:44954128-44954150 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207510 8:44955997-44956019 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207603 8:44957353-44957375 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207861 8:44961090-44961112 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040207932 8:44962112-44962134 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208021 8:44963468-44963490 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208146 8:44965336-44965358 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208225 8:44966532-44966554 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208305 8:44967725-44967747 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208484 8:44970437-44970459 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208576 8:44971793-44971815 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208669 8:44973149-44973171 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208763 8:44974506-44974528 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040208855 8:44975862-44975884 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040209060 8:44978927-44978949 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040209152 8:44980283-44980305 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040209275 8:44982151-44982173 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040209352 8:44983344-44983366 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040209558 8:44986408-44986430 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040209648 8:44987764-44987786 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040209739 8:44989120-44989142 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210005 8:44993022-44993044 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210085 8:44994215-44994237 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210178 8:44995571-44995593 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210268 8:44996927-44996949 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210358 8:44998283-44998305 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210484 8:45000151-45000173 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210701 8:45003375-45003397 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210825 8:45005243-45005265 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040210909 8:45006437-45006459 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040211001 8:45007793-45007815 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040211082 8:45008986-45009008 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040211336 8:45012725-45012747 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040211459 8:45014594-45014616 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040211539 8:45015786-45015808 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040211844 8:45020198-45020220 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040211924 8:45021391-45021413 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040212014 8:45022748-45022770 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040212198 8:45025460-45025482 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040212324 8:45027329-45027351 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040212404 8:45028523-45028545 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040212496 8:45029880-45029902 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213007 8:45037357-45037379 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213088 8:45038550-45038572 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040213168 8:45039743-45039765 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213296 8:45041610-45041632 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213379 8:45042804-45042826 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213459 8:45043997-45044019 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213539 8:45045189-45045211 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213619 8:45046383-45046405 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213667 8:45047060-45047082 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213749 8:45048253-45048275 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213839 8:45049608-45049630 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213918 8:45050801-45050823 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040213964 8:45051476-45051498 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214044 8:45052669-45052691 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214134 8:45054025-45054047 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214227 8:45055381-45055403 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214318 8:45056737-45056759 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214527 8:45059803-45059825 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214619 8:45061160-45061182 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214697 8:45062353-45062375 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214791 8:45063709-45063731 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040214871 8:45064902-45064924 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040215089 8:45068127-45068149 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040215169 8:45069320-45069342 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040215432 8:45073225-45073247 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040215524 8:45074580-45074602 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040215616 8:45075936-45075958 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040215696 8:45077128-45077150 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040215777 8:45078321-45078343 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216092 8:45083081-45083103 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216173 8:45084275-45084297 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216254 8:45085468-45085490 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216463 8:45088530-45088552 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216556 8:45089886-45089908 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216726 8:45092437-45092459 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216819 8:45093792-45093814 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216913 8:45095147-45095169 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040216994 8:45096340-45096362 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217086 8:45097696-45097718 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217251 8:45100083-45100105 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217344 8:45101439-45101461 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217423 8:45102633-45102655 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217551 8:45104503-45104525 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217677 8:45106372-45106394 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217805 8:45108241-45108263 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217887 8:45109436-45109458 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040217967 8:45110629-45110651 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218045 8:45111822-45111844 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218125 8:45113015-45113037 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218217 8:45114371-45114393 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218344 8:45116240-45116262 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218516 8:45118789-45118811 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218607 8:45120145-45120167 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218688 8:45121338-45121360 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218779 8:45122694-45122716 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218855 8:45123884-45123906 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040218937 8:45125075-45125097 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219062 8:45126943-45126965 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219142 8:45128135-45128157 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219234 8:45129492-45129514 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219359 8:45131360-45131382 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219440 8:45132553-45132575 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219486 8:45133228-45133250 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219579 8:45134583-45134605 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219705 8:45136451-45136473 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040219927 8:45139676-45139698 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220142 8:45142901-45142923 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220331 8:45145613-45145635 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220411 8:45146806-45146828 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220492 8:45147999-45148021 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220572 8:45149192-45149214 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220652 8:45150385-45150407 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220868 8:45153609-45153631 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040220992 8:45155477-45155499 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221083 8:45156834-45156856 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221165 8:45158027-45158049 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221257 8:45159382-45159404 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221337 8:45160576-45160598 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221416 8:45161769-45161791 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221506 8:45163125-45163147 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221729 8:45166350-45166372 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221886 8:45168737-45168759 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040221979 8:45170093-45170115 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222155 8:45172642-45172664 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222282 8:45174510-45174532 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222375 8:45175866-45175888 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222465 8:45177223-45177245 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222590 8:45179091-45179113 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222682 8:45180446-45180468 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222761 8:45181639-45181661 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222886 8:45183507-45183529 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040222978 8:45184862-45184884 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223071 8:45186218-45186240 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223270 8:45189279-45189301 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223395 8:45191147-45191169 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223475 8:45192341-45192363 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223567 8:45193697-45193719 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223661 8:45195053-45195075 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223859 8:45197487-45197509 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040223951 8:45198842-45198864 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224077 8:45200710-45200732 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224157 8:45201903-45201925 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224406 8:45205640-45205662 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224530 8:45207509-45207531 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224610 8:45208702-45208724 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224690 8:45209896-45209918 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224781 8:45211252-45211274 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224870 8:45212608-45212630 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040224955 8:45213798-45213820 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225081 8:45215668-45215690 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225161 8:45216861-45216883 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225252 8:45218215-45218237 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225345 8:45219570-45219592 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225426 8:45220763-45220785 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225518 8:45222119-45222141 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225609 8:45223475-45223497 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225687 8:45224668-45224690 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225768 8:45225861-45225883 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040225861 8:45227216-45227238 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040226168 8:45231634-45231656 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040226258 8:45232990-45233012 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040226593 8:45237922-45237944 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040226721 8:45239790-45239812 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040226813 8:45241147-45241169 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040226905 8:45242503-45242525 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040226987 8:45243698-45243720 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227243 8:45247436-45247458 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227324 8:45248629-45248651 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227451 8:45250497-45250519 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227531 8:45251690-45251712 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227737 8:45254752-45254774 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227817 8:45255946-45255968 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227909 8:45257302-45257324 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040227990 8:45258496-45258518 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228070 8:45259689-45259711 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228196 8:45261559-45261581 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228279 8:45262752-45262774 ATCTGGAAGTGGACATTGGGAGG + Intergenic
1040228402 8:45264619-45264641 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228483 8:45265813-45265835 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228530 8:45266488-45266510 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228622 8:45267844-45267866 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228713 8:45269201-45269223 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228840 8:45271069-45271091 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040228920 8:45272263-45272285 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229010 8:45273619-45273641 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229092 8:45274812-45274834 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229171 8:45276006-45276028 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229376 8:45279068-45279090 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229469 8:45280424-45280446 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229599 8:45282294-45282316 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229769 8:45284843-45284865 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040229850 8:45286036-45286058 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230021 8:45288581-45288603 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230105 8:45289774-45289796 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230188 8:45290966-45290988 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230279 8:45292322-45292344 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230407 8:45294192-45294214 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230487 8:45295386-45295408 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230616 8:45297259-45297281 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040230788 8:45299808-45299830 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231009 8:45303032-45303054 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231100 8:45304388-45304410 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231191 8:45305744-45305766 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231282 8:45307100-45307122 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231367 8:45308293-45308315 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231446 8:45309488-45309510 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231529 8:45310683-45310705 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231622 8:45312039-45312061 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231713 8:45313396-45313418 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231794 8:45314590-45314612 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231886 8:45315946-45315968 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040231975 8:45317302-45317324 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232195 8:45320527-45320549 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232275 8:45321720-45321742 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232356 8:45322912-45322934 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232482 8:45324780-45324802 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232562 8:45325973-45325995 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232643 8:45327165-45327187 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232723 8:45328357-45328379 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232804 8:45329552-45329574 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232883 8:45330745-45330767 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040232964 8:45331938-45331960 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040233045 8:45333131-45333153 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040233230 8:45335842-45335864 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040233310 8:45337035-45337057 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040233434 8:45338905-45338927 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040233606 8:45341447-45341469 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040233767 8:45343834-45343856 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234005 8:45347159-45347181 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234096 8:45348515-45348537 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234176 8:45349709-45349731 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234305 8:45351582-45351604 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234396 8:45352938-45352960 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234519 8:45354807-45354829 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234599 8:45355999-45356021 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234646 8:45356674-45356696 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234737 8:45358029-45358051 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234831 8:45359383-45359405 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040234957 8:45361251-45361273 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235050 8:45362607-45362629 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235136 8:45363800-45363822 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235227 8:45365156-45365178 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235309 8:45366349-45366371 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235355 8:45367024-45367046 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235480 8:45368893-45368915 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235559 8:45370087-45370109 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235606 8:45370762-45370784 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235728 8:45372631-45372653 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235808 8:45373825-45373847 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235855 8:45374500-45374522 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040235936 8:45375694-45375716 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236195 8:45379431-45379453 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236288 8:45380787-45380809 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236368 8:45381980-45382002 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236494 8:45383848-45383870 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236586 8:45385204-45385226 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236715 8:45387073-45387095 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236805 8:45388431-45388453 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040236930 8:45390297-45390319 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040237105 8:45392846-45392868 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040237321 8:45396070-45396092 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040237446 8:45397939-45397961 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040237617 8:45400488-45400510 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040237698 8:45401683-45401705 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040237791 8:45403040-45403062 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040237882 8:45404395-45404417 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040238088 8:45407459-45407481 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040238295 8:45410524-45410546 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040238388 8:45411880-45411902 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040238561 8:45414431-45414453 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040238645 8:45415624-45415646 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040238900 8:45419363-45419385 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040238995 8:45420719-45420741 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040239214 8:45423943-45423965 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040239505 8:45428353-45428375 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040239597 8:45429709-45429731 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040239725 8:45431577-45431599 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040239943 8:45434802-45434824 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240034 8:45436159-45436181 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240115 8:45437353-45437375 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240253 8:45439384-45439406 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240334 8:45440578-45440600 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240588 8:45444315-45444337 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240672 8:45445508-45445530 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240848 8:45448051-45448073 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040240973 8:45449921-45449943 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241065 8:45451277-45451299 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241190 8:45453145-45453167 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241280 8:45454501-45454523 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241405 8:45456370-45456392 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241486 8:45457564-45457586 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241614 8:45459435-45459457 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241702 8:45460791-45460813 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241782 8:45461984-45462006 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040241972 8:45464695-45464717 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040242063 8:45466051-45466073 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040242318 8:45469788-45469810 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040242410 8:45471145-45471167 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040242581 8:45473694-45473716 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040242671 8:45475049-45475071 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040242752 8:45476243-45476265 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040242799 8:45476919-45476941 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243008 8:45479985-45480007 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243177 8:45482534-45482556 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243270 8:45483890-45483912 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243399 8:45485759-45485781 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243528 8:45487626-45487648 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243656 8:45489495-45489517 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243749 8:45490850-45490872 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243829 8:45492044-45492066 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040243920 8:45493401-45493423 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040244001 8:45494594-45494616 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040244023 8:45494932-45494954 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040244152 8:45496800-45496822 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040244245 8:45498155-45498177 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040244337 8:45499511-45499533 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040244571 8:45502917-45502939 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040244871 8:45507334-45507356 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245042 8:45509880-45509902 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245171 8:45511750-45511772 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245251 8:45512943-45512965 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245342 8:45514299-45514321 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245548 8:45517363-45517385 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245628 8:45518556-45518578 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245798 8:45521100-45521122 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040245877 8:45522291-45522313 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246048 8:45524840-45524862 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246094 8:45525515-45525537 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246181 8:45526708-45526730 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246358 8:45529257-45529279 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246404 8:45529931-45529953 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246538 8:45531800-45531822 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246630 8:45533156-45533178 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246712 8:45534349-45534371 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040246946 8:45537736-45537758 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040247163 8:45540961-45540983 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040247292 8:45542834-45542856 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040247418 8:45544702-45544724 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040247542 8:45546570-45546592 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040247667 8:45548438-45548460 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040247793 8:45550307-45550329 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040247874 8:45551502-45551524 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248000 8:45553372-45553394 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248126 8:45555240-45555262 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248205 8:45556435-45556457 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248296 8:45557793-45557815 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248390 8:45559151-45559173 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248473 8:45560344-45560366 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248565 8:45561700-45561722 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248771 8:45564762-45564784 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040248816 8:45565437-45565459 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040249186 8:45571041-45571063 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040249268 8:45572234-45572256 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040249397 8:45574104-45574126 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040249488 8:45575460-45575482 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040249617 8:45577327-45577349 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040249697 8:45578520-45578542 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040249787 8:45579875-45579897 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250007 8:45583101-45583123 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250134 8:45584970-45584992 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250213 8:45586163-45586185 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250304 8:45587519-45587541 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250394 8:45588875-45588897 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250518 8:45590743-45590765 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250774 8:45594480-45594502 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040250988 8:45597704-45597726 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040251114 8:45599571-45599593 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040251241 8:45601442-45601464 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040251498 8:45605178-45605200 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040251840 8:45610271-45610293 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040252018 8:45612823-45612845 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040252064 8:45613498-45613520 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040252282 8:45616725-45616747 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040252374 8:45618081-45618103 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040252504 8:45619952-45619974 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040252757 8:45623689-45623711 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040252885 8:45625557-45625579 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253011 8:45627425-45627447 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253103 8:45628781-45628803 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253276 8:45631331-45631353 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253414 8:45633362-45633384 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253505 8:45634718-45634740 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253586 8:45635914-45635936 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253632 8:45636589-45636611 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040253968 8:45641520-45641542 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254096 8:45643390-45643412 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254188 8:45644746-45644768 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254273 8:45645939-45645961 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254526 8:45649680-45649702 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254573 8:45650355-45650377 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254699 8:45652224-45652246 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254824 8:45654094-45654116 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040254917 8:45655450-45655472 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255041 8:45657319-45657341 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255121 8:45658512-45658534 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255168 8:45659187-45659209 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255248 8:45660382-45660404 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255299 8:45661058-45661080 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255380 8:45662252-45662274 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255428 8:45662927-45662949 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255597 8:45665475-45665497 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255645 8:45666150-45666172 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255770 8:45668018-45668040 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040255894 8:45669887-45669909 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040256021 8:45671755-45671777 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040256149 8:45673624-45673646 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040256374 8:45676851-45676873 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040256624 8:45680589-45680611 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040256843 8:45683814-45683836 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040256921 8:45685008-45685030 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040256968 8:45685683-45685705 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257140 8:45688232-45688254 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257187 8:45688908-45688930 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257528 8:45694000-45694022 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257621 8:45695356-45695378 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257703 8:45696550-45696572 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257750 8:45697225-45697247 ATCTGGAAGTGGACATTCGGAGG + Intergenic
1040257831 8:45698418-45698440 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257877 8:45699093-45699115 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040257968 8:45700448-45700470 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040258058 8:45701804-45701826 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040258150 8:45703160-45703182 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040258396 8:45706726-45706748 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040258614 8:45709950-45709972 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040258709 8:45711305-45711327 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040258838 8:45713173-45713195 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040259181 8:45718267-45718289 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040259309 8:45720137-45720159 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040259436 8:45722005-45722027 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040259648 8:45725232-45725254 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040259954 8:45729813-45729835 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260034 8:45731006-45731028 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260081 8:45731681-45731703 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260333 8:45735419-45735441 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260463 8:45737287-45737309 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260543 8:45738482-45738504 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260590 8:45739157-45739179 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260715 8:45741025-45741047 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040260840 8:45742893-45742915 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040261062 8:45746118-45746140 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040261144 8:45747311-45747333 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040261317 8:45749854-45749876 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040261566 8:45753591-45753613 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040261817 8:45757327-45757349 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040262022 8:45760390-45760412 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040262066 8:45761066-45761088 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040262194 8:45762934-45762956 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040262323 8:45764804-45764826 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040262700 8:45770410-45770432 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040262826 8:45772279-45772301 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040262953 8:45774149-45774171 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263081 8:45776017-45776039 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263207 8:45777887-45777909 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263289 8:45779081-45779103 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263336 8:45779756-45779778 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263420 8:45780950-45780972 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263467 8:45781625-45781647 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263547 8:45782818-45782840 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263593 8:45783493-45783515 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263672 8:45784686-45784708 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040263840 8:45787230-45787252 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264046 8:45790291-45790313 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264092 8:45790966-45790988 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264173 8:45792159-45792181 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264220 8:45792834-45792856 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264310 8:45794189-45794211 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264391 8:45795383-45795405 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264437 8:45796059-45796081 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264563 8:45797927-45797949 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264642 8:45799121-45799143 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264688 8:45799796-45799818 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264767 8:45800990-45801012 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040264813 8:45801666-45801688 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040265068 8:45805403-45805425 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040265323 8:45809139-45809161 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040265579 8:45812876-45812898 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040265704 8:45814745-45814767 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040265828 8:45816613-45816635 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040265953 8:45818482-45818504 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266082 8:45820352-45820374 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266162 8:45821547-45821569 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266208 8:45822222-45822244 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266285 8:45823417-45823439 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266332 8:45824093-45824115 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266581 8:45827831-45827853 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266914 8:45832764-45832786 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040266961 8:45833441-45833463 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040267211 8:45837178-45837200 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040267462 8:45840916-45840938 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040267545 8:45842111-45842133 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040267715 8:45844655-45844677 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040267841 8:45846522-45846544 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040267925 8:45847715-45847737 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040267972 8:45848390-45848412 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268179 8:45851451-45851473 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268226 8:45852126-45852148 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268355 8:45853994-45854016 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268482 8:45855863-45855885 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268655 8:45858412-45858434 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268702 8:45859087-45859109 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268827 8:45860956-45860978 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040268978 8:45863163-45863185 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040269235 8:45866992-45867014 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040269315 8:45868189-45868211 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040269361 8:45868864-45868886 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040269487 8:45870733-45870755 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040269571 8:45871926-45871948 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040269741 8:45874469-45874491 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1040269867 8:45876338-45876360 ATCTGGAAGTGGACATTTGGAGG + Intergenic
1042672811 8:71283125-71283147 CTCTGGGAAAGGAAAGTGGGAGG - Intronic
1042761209 8:72273312-72273334 CTCCTGCAGTGGAAACTGGGTGG + Intergenic
1044943626 8:97369418-97369440 CTCTGTTAGTGGAATTTGCCTGG + Intergenic
1047095442 8:121620012-121620034 CTTTGCTATTGGAAATTGGGAGG - Intronic
1048054329 8:130849067-130849089 CTCTGGGAGTGGGAGTGGGGTGG - Intronic
1048426979 8:134332154-134332176 CTTTGGCAGTGGAAAGTGGGTGG - Intergenic
1053713674 9:40856764-40856786 ATCTGGAAGTGGATATTTGGGGG + Intergenic
1054076222 9:60536054-60536076 ATCTGGAAGTGGACATTTGGAGG - Intergenic
1054424059 9:64987112-64987134 ATCTGGAAGTGGATATTTGGGGG + Intergenic
1055152653 9:73021146-73021168 TTGTGGTAGGGGAAATTGAGTGG + Intronic
1056505850 9:87257620-87257642 CTCTGGAAGCAGAACTTGGGTGG + Intergenic
1057202830 9:93151972-93151994 CTCTGGTCGTGGAGATACGGAGG + Intergenic
1058408172 9:104700805-104700827 CCCTGGCAGTGGAAAGTGGTTGG - Intergenic
1060064169 9:120488492-120488514 CTCTGGGAGTGGGATTTGAGAGG - Intronic
1060998078 9:127886170-127886192 TTCTGGTGCTGGAAATTGAGGGG + Exonic
1203340012 Un_KI270320v1:2625-2647 ATCTGCAAGTGGACATTGGGAGG + Intergenic
1203339466 Un_KI270322v1:8226-8248 ATCTGCAAGTGGACATTGGGAGG - Intergenic
1203378359 Un_KI270435v1:3030-3052 ATCTGCAAGAGGAAATTGGGAGG + Intergenic
1203357483 Un_KI270442v1:171964-171986 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1203396530 Un_KI270519v1:20343-20365 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1203409870 Un_KI270587v1:1341-1363 GTCTGGAAGTGGATATTTGGAGG - Intergenic
1203415957 Un_KI270588v1:3130-3152 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1203412700 Un_KI270589v1:5414-5436 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1203685653 Un_KI270757v1:54156-54178 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1187792852 X:22969823-22969845 TTCTAGTGGTGGAAACTGGGTGG - Intergenic
1189400926 X:40667806-40667828 CTATGGTAGTGAAAAGTGGTTGG + Intronic
1189411828 X:40779539-40779561 CTCTGCTTGTGGAAAGTGGAGGG - Intergenic
1190150625 X:47944458-47944480 CTCTGGTAGTGGGAGTGGGGTGG + Intronic
1191569144 X:62585809-62585831 ATCTGCTAGTGGATATTTGGAGG + Intergenic
1193574657 X:83183315-83183337 CTTTTGTAGTGGGAACTGGGAGG - Intergenic
1194892689 X:99399303-99399325 CTCTGGTGGAGGAAATGGTGGGG + Intergenic
1194959946 X:100223756-100223778 ATTTGGTAATGGAAAATGGGTGG + Intergenic
1195392378 X:104376089-104376111 CTCCTGTAGTGTAAATTGCGTGG - Intergenic
1195403645 X:104489200-104489222 CACTGTGAGTGGCAATTGGGTGG - Intergenic
1196761485 X:119204687-119204709 CTCTGGTAAGGGAACTTGGGTGG - Intergenic
1197280786 X:124533487-124533509 CTCTGGAAGAGGAAACAGGGAGG - Intronic
1197488810 X:127090227-127090249 CTCTGCTTGTGGAAAATGGGAGG - Intergenic
1199758101 X:150883486-150883508 CTCTGGGGGTGGAATTTGGGAGG - Intronic
1201064377 Y:10079703-10079725 ATCTGGAAGTGGATATTTGGAGG + Intergenic
1201064502 Y:10082002-10082024 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1201064601 Y:10083944-10083966 ATCTGGAAGTGGATATTTGGAGG - Intergenic
1201941078 Y:19460847-19460869 CTCTGGTGGTGTAAATGTGGTGG - Intergenic