ID: 930688744

View in Genome Browser
Species Human (GRCh38)
Location 2:54337109-54337131
Sequence GGAGGCTGACACTGGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930688744_930688750 16 Left 930688744 2:54337109-54337131 CCACTGTGCCAGTGTCAGCCTCC 0: 1
1: 0
2: 2
3: 34
4: 328
Right 930688750 2:54337148-54337170 TCCTCATCTCTCTGTGTGTTAGG 0: 1
1: 0
2: 2
3: 36
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930688744 Original CRISPR GGAGGCTGACACTGGCACAG TGG (reversed) Intronic
900088996 1:911131-911153 GGAGGCTGGCACAGCCACAGTGG - Intergenic
900147907 1:1166434-1166456 GGGGTCTGACCCAGGCACAGAGG - Intergenic
900373993 1:2345050-2345072 GGAGGCTGACACTGTCTTCGGGG - Intronic
900507480 1:3036985-3037007 GGAGGCAGACCCTGGCCCACAGG - Intergenic
901261415 1:7874567-7874589 GGAGGCTGCCCCTGGGACAAAGG + Intergenic
901746328 1:11376119-11376141 GGAGGCTCAGATTGGCAAAGGGG + Intergenic
901870293 1:12134895-12134917 GGAGGCTTCCACTGGGTCAGAGG - Intronic
902212579 1:14914299-14914321 AGAGGCAGACACTTGCCCAGGGG - Intronic
902231271 1:15029248-15029270 GGAGGCTGACGCTCTCATAGAGG - Intronic
902620381 1:17647275-17647297 AGAGGATGACACTGGCACTCAGG - Intronic
902841644 1:19077949-19077971 GGAGGCTGTCAGAGGCCCAGTGG - Intronic
902923453 1:19680679-19680701 GCAGGTGGACTCTGGCACAGGGG + Intergenic
903926241 1:26832735-26832757 TGGAGCTGACACTGGCACAGAGG + Intronic
904750506 1:32738967-32738989 GGAGTCTCACACTGTCACCGGGG + Intergenic
904756171 1:32770025-32770047 GGAGGCTGGCGCTGAGACAGAGG + Exonic
904883895 1:33721306-33721328 GAAGGCAGGCACTGGCAGAGTGG + Intronic
905300728 1:36984876-36984898 AGAGCCTGACACATGCACAGTGG + Intronic
905461071 1:38123374-38123396 GGAGGGTGACGGTGCCACAGAGG - Intergenic
905694121 1:39962549-39962571 GGCGGATGACACTGGTGCAGCGG + Intronic
906179438 1:43805759-43805781 GGAGTCTCACACTGTCACCGAGG + Intronic
906210987 1:44012027-44012049 GGAGGCTGTCTCTGGCACTAAGG - Intronic
906296262 1:44650826-44650848 GGAGACGGTCACTGTCACAGAGG - Exonic
906478455 1:46185321-46185343 GGAGGCTGGGACTGGGACATGGG + Intronic
907547488 1:55274873-55274895 GGAGGCTGACTCTGGGAAGGTGG + Intergenic
907654805 1:56331732-56331754 GGAGGCTCACAGGGGCTCAGTGG - Intergenic
908124591 1:61017606-61017628 GGAGGCTGCCACTTACACAGTGG + Intronic
909242914 1:73237904-73237926 GGAGGCTGCAACTGGCAGAGAGG - Intergenic
910229583 1:84972530-84972552 GAAGGCTGAGACTGGTACTGTGG + Intronic
911391722 1:97253549-97253571 GGAGGATGAGAATGGCACAAGGG - Intronic
912475842 1:109934269-109934291 GGAGGCTTTCACTGGGGCAGGGG - Intergenic
913127288 1:115804380-115804402 GGAGGCTGACACACCCAGAGAGG + Intergenic
914446256 1:147753088-147753110 GGAGTCTGACATGGGCAGAGCGG - Intergenic
916438768 1:164801354-164801376 GCAGGGTGGCAGTGGCACAGAGG - Intronic
916709652 1:167392245-167392267 GGAGGCTGAGGCAGGGACAGTGG + Intronic
917720832 1:177785044-177785066 GGAGGCTGACAGTGGGTAAGGGG - Intergenic
918143290 1:181735499-181735521 GGAGGCTGAAGCTGTCACAGTGG - Intronic
918466286 1:184824535-184824557 AAAGGCTGGCACTGGCAAAGAGG + Intronic
919977170 1:202620216-202620238 TGGGACTGACACTGTCACAGGGG - Intronic
920703062 1:208232224-208232246 GGAGAGGGAGACTGGCACAGTGG - Intronic
921196130 1:212759845-212759867 GGAGGCTGCCCGTGGGACAGAGG + Intronic
923125767 1:231033230-231033252 GGAGAATGACACTGGCAACGGGG + Intronic
923604685 1:235432490-235432512 GGGGCCAGACACTGGCACTGGGG + Intronic
923795051 1:237145607-237145629 GCCTGCTGACACTGGTACAGAGG - Intronic
924225640 1:241919548-241919570 GTATGCTGACACTGGCCGAGTGG + Intergenic
1063021818 10:2136594-2136616 GGAGGCTGGGCCTGGCTCAGAGG - Intergenic
1063298665 10:4831972-4831994 GAAGGCCTGCACTGGCACAGTGG + Intronic
1065736750 10:28759930-28759952 GGAGTCTGGCTCTGGCACCGAGG - Intergenic
1067054829 10:43044437-43044459 GGAAGCTGACACAGACACAAAGG + Intergenic
1067449636 10:46374221-46374243 TGAGGTGGACACTGGCACTGGGG + Intergenic
1067557327 10:47282173-47282195 GCAGTCTGACACGGGCACTGTGG + Intergenic
1067587740 10:47486540-47486562 TGAGGTGGACACTGGCACTGGGG - Intergenic
1067634860 10:47994644-47994666 TGAGGTGGACACTGGCACTGGGG - Intergenic
1069824201 10:71245393-71245415 GGAGGCTGAGTCTGGCAGGGGGG + Intronic
1069950828 10:72017024-72017046 GGCAGCTGACACTGGGACAAGGG + Intergenic
1070131830 10:73661387-73661409 TGAGGTGGACACTGGCACTGGGG - Intronic
1070758384 10:79007658-79007680 GGAGGGTGACAGGGCCACAGAGG + Intergenic
1071463400 10:85919421-85919443 AGAGGGTGCCACTCGCACAGAGG + Intronic
1071470345 10:85979780-85979802 GGAGGCAGACACTGGTCCACAGG + Intronic
1071610255 10:87025390-87025412 TGAGGTGGACACTGGCACTGGGG + Intergenic
1072628879 10:97132188-97132210 GGAGGCTGTGGCTGGCAGAGGGG - Intronic
1072733452 10:97863809-97863831 GGAAGATGACATTGGCACACAGG - Intronic
1072759644 10:98045863-98045885 GGAGGGTGAGACGGGCCCAGAGG - Intergenic
1073045055 10:100632122-100632144 GGAGGGTGGCACTGGCCCATGGG - Intergenic
1075003754 10:118816177-118816199 GGAGTCTCACACTGTCACAGGGG - Intergenic
1075609096 10:123836936-123836958 AGGGGCTGACTCTGGGACAGGGG - Intronic
1075966532 10:126616556-126616578 AGATGCTGACACGGGCACAGAGG + Intronic
1075968328 10:126631914-126631936 GGCGTCAGACACTGACACAGGGG + Intronic
1076364844 10:129915091-129915113 TGAGGCTGAAACTGCCCCAGTGG - Intronic
1076607454 10:131698327-131698349 GCAGGCTGACCCTGCCACACAGG - Intergenic
1077605212 11:3605769-3605791 GGAACCTGGCACTGCCACAGTGG - Intergenic
1077605219 11:3605805-3605827 GGAACCTGGCACTGCCACAGTGG - Intergenic
1077938621 11:6816212-6816234 GGAGTCTGACACTGTCACCCAGG - Intergenic
1077972724 11:7212167-7212189 GGAGGCTGCCACTGAGAAAGTGG + Intergenic
1078866442 11:15302391-15302413 GGAGGCTGACACCGGAAGTGGGG - Intergenic
1079289869 11:19178380-19178402 AGATGATGACAGTGGCACAGAGG + Intergenic
1081805574 11:45888188-45888210 GGGAGCTGACAGTGGCACTGGGG - Intronic
1083708783 11:64534677-64534699 GAAGGCTGACACAGCCACAGAGG + Intergenic
1084150527 11:67285995-67286017 GGAGGCAGCCAGTGACACAGAGG - Exonic
1084297959 11:68225522-68225544 GGAGGCTGACTCTGAGGCAGAGG + Intergenic
1084562071 11:69910795-69910817 GGAGGGAGACAGTGGCAGAGAGG - Intergenic
1084669189 11:70595282-70595304 GGAGGGTGGCACTGGCACCGGGG - Intronic
1085503506 11:77042288-77042310 GGAGGCTGACAGTGGGAGGGAGG - Intergenic
1086549778 11:88042431-88042453 GGAGGCTGACAGTGTCAGACAGG - Intergenic
1086935632 11:92742938-92742960 GGAGGCTAAGAATAGCACAGTGG + Intronic
1088645491 11:111913383-111913405 GGAGGATGAGGCTGGCACAGGGG - Intronic
1088907380 11:114164917-114164939 CGAGGCTGACACAGACACAAAGG - Intronic
1089638404 11:119831439-119831461 GGAGGCTGACAATAACCCAGAGG + Intergenic
1090387606 11:126365811-126365833 AGAGGCTGAGACGGGCCCAGAGG + Intronic
1090390171 11:126383009-126383031 AGAGGCTGAGACAGGCCCAGAGG + Intronic
1090433916 11:126670097-126670119 GGAGGCTTGGACTGGAACAGTGG - Intronic
1090937412 11:131356083-131356105 GCAGACTGTCACTGGCTCAGTGG - Intergenic
1092464849 12:8721767-8721789 GGAGTCTGACTCTGGCACCCAGG + Intronic
1092655194 12:10676675-10676697 AAAGGCTTGCACTGGCACAGAGG + Intergenic
1093180915 12:15966142-15966164 GGAGGCTGAAACAGGCACTTTGG + Intronic
1095086959 12:38067146-38067168 GGAGTCTGACACTGTCACTCAGG - Intergenic
1096892479 12:54785927-54785949 GGAGGCTGTCCCTGGAACAAAGG - Intergenic
1098077052 12:66743296-66743318 GGAGGTTGCCACTCGCCCAGTGG - Intronic
1098286817 12:68915508-68915530 GGAGGCTGACATTTGAACAAAGG - Intronic
1098926538 12:76357240-76357262 GAAAGCTGACACTTGCAGAGAGG - Intronic
1099863799 12:88253086-88253108 GGAGTCTGACACTGTCACCCAGG - Intergenic
1099935120 12:89116256-89116278 GGAGTCTCACTCTGTCACAGGGG - Intergenic
1100528932 12:95446686-95446708 GCAGGCTAACACTGGCGCACTGG + Intergenic
1103317915 12:120071900-120071922 AGGGGCTGACACAGGCACAGGGG - Intronic
1103702361 12:122854584-122854606 CCAGGCTGACACTAACACAGTGG - Intronic
1103763667 12:123267871-123267893 GGAGGGGGAGACAGGCACAGAGG - Intronic
1104418998 12:128619672-128619694 CAAGCCTAACACTGGCACAGTGG - Intronic
1104931389 12:132341216-132341238 GGAGGCTGACGGAGGCAGAGTGG + Intergenic
1105896792 13:24723407-24723429 GCAGGCTGCCACTGTCACCGTGG + Intergenic
1106760051 13:32859201-32859223 GGAGGGTGCCCCTGGCACCGTGG + Intergenic
1107689022 13:42933561-42933583 GAAGGATGACAATGGCAAAGAGG - Intronic
1109190017 13:59312957-59312979 GGATGCTGCCGCTGGCACAGAGG + Intergenic
1109209989 13:59524153-59524175 GGAGGCTAAGGCTGGCACAGAGG - Intergenic
1109325535 13:60862910-60862932 GGAGGCAGACACTGTCATAAAGG + Intergenic
1111127892 13:83935734-83935756 GCAGGCTGCCACATGCACAGTGG - Intergenic
1115337317 14:32254840-32254862 GGAGGCTGAAACCTGCAAAGAGG - Intergenic
1117919978 14:60719764-60719786 TGAAGCTGCCACTGACACAGGGG + Exonic
1117983253 14:61362851-61362873 GGATGTGGACATTGGCACAGGGG + Intronic
1118805233 14:69230571-69230593 GGATGCTGAGACTCTCACAGAGG + Exonic
1118993520 14:70817321-70817343 GGAGGCTCACACTGTCACCCAGG + Intergenic
1119285192 14:73447806-73447828 GGAGGCTGACTCTGTCACCCAGG + Intronic
1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG + Intronic
1121721720 14:96113708-96113730 AGAGTCTGAGCCTGGCACAGTGG + Intergenic
1122160523 14:99781126-99781148 GGAGGCGGCCAGTGGAACAGGGG - Intronic
1122924441 14:104893158-104893180 CGAGGGTGGCTCTGGCACAGGGG - Intronic
1124492833 15:30168600-30168622 TGGGACTGACACTGTCACAGGGG - Intergenic
1124580826 15:30953381-30953403 GGAAGCTGACACTGGGACACTGG - Intronic
1124750701 15:32369725-32369747 TGGGACTGACACTGTCACAGGGG + Intergenic
1124854909 15:33378323-33378345 GGAGGCTGGGACAGGCAGAGGGG - Intronic
1125500651 15:40238731-40238753 GAAGGCTGAGAGTGGCACATGGG - Intergenic
1125758690 15:42083078-42083100 GGAGGCTGACAAGGCCACAGGGG + Intronic
1126834796 15:52650188-52650210 AGAGGCAGACACAGGCAGAGAGG - Intronic
1127081199 15:55381338-55381360 GGAGGCTGAGACTTGAACCGGGG + Intronic
1127632849 15:60842564-60842586 GAAGGCTGACAGTGGGTCAGTGG + Intronic
1127791903 15:62405661-62405683 TGAGGCTGAGACTGGCTCTGGGG + Intronic
1128451232 15:67806960-67806982 AGGCGCTGACACTGGCAGAGAGG + Exonic
1130617585 15:85426979-85427001 GGAGTCTCACACTGTCACCGGGG + Intronic
1132947630 16:2540688-2540710 GGAGGCTGAAACAGGCCCCGGGG - Intronic
1132968109 16:2670935-2670957 GGAGGCTGAAACAGGCCCCGGGG + Intergenic
1132981836 16:2742326-2742348 GGAGGCAGACACCGGCAGTGGGG + Intergenic
1133272603 16:4617834-4617856 GGAGGCCGGCACTGGCCCTGGGG + Intronic
1133758251 16:8778435-8778457 GGAGACAGACACAGGCACAGTGG - Intronic
1136103271 16:28010912-28010934 AAAGGCTGAGGCTGGCACAGGGG - Intronic
1136550354 16:30979515-30979537 GGAGGCTGAGCCAGGGACAGAGG + Exonic
1136584219 16:31173562-31173584 GGAGGCTGAGTCTGGGGCAGGGG - Intergenic
1138392433 16:56680004-56680026 GGACACTAACTCTGGCACAGAGG - Intronic
1139794088 16:69468068-69468090 GGAGGCTGAGACTTGAGCAGAGG - Intergenic
1141940806 16:87274744-87274766 TGTGGCTGACACTGGCTGAGAGG - Intronic
1142107753 16:88315447-88315469 TGACGCTCACCCTGGCACAGGGG + Intergenic
1142291439 16:89195243-89195265 GGAGGCTGCCCCAGGCCCAGGGG - Exonic
1142382018 16:89738286-89738308 TGAGGCTGACACAGCCACTGCGG - Exonic
1142596042 17:1030508-1030530 GGAGGCTGAAGGTGACACAGGGG + Intronic
1143415840 17:6749261-6749283 GGAGTCTTACTCTGCCACAGAGG - Intergenic
1143697277 17:8630187-8630209 GGAGGCAGACACTGGCTCGCGGG + Intronic
1144191060 17:12846326-12846348 GGGGGCTGCCTATGGCACAGGGG - Intronic
1144923635 17:18784539-18784561 GGAGGCTGAGGCTGACGCAGGGG + Intronic
1146516239 17:33491790-33491812 GCAGGCTGACCATGGCAGAGAGG - Intronic
1147306613 17:39568616-39568638 GGAGGGTGAGACAGGCACAAGGG + Intergenic
1147369866 17:39984911-39984933 GGAGGCTGAGGCGGGCACAGTGG + Intronic
1148471938 17:47899739-47899761 TGAGGCTGCCACTGGCACAGGGG + Intronic
1150614881 17:66762737-66762759 TGAGGCTCAAAGTGGCACAGTGG - Intronic
1150698660 17:67428145-67428167 GAAGACTGAGCCTGGCACAGTGG - Intronic
1150733837 17:67718452-67718474 AGAGGATGACACTGACAGAGTGG + Intronic
1151745935 17:76011817-76011839 GGGGGCTGACACTGCCAGGGTGG + Exonic
1152068793 17:78125211-78125233 AGAGCCTGGCAGTGGCACAGCGG - Exonic
1152471149 17:80490713-80490735 GGAGGCTGGCAGGGGCCCAGGGG + Intergenic
1155176041 18:23302191-23302213 GGAGCCAGACACAGACACAGAGG + Intronic
1157064074 18:44326658-44326680 GGAGGCAAACCCTTGCACAGGGG + Intergenic
1157764550 18:50286697-50286719 CGGGGCTGACACTGGCAGGGTGG - Intronic
1157942322 18:51942770-51942792 GGAGTCTCACACTGTCACTGGGG + Intergenic
1158140819 18:54253598-54253620 GGAGGCTGAGGCGGGCACTGAGG + Intergenic
1160060046 18:75521658-75521680 GGAGGCTAACAGGGACACAGGGG + Intergenic
1160231364 18:77052100-77052122 GGAGGAAGACTCTGGCTCAGAGG - Intronic
1160708837 19:541522-541544 TGAGGATGACTCTGGCACGGAGG + Exonic
1160819672 19:1052210-1052232 GCAGGCTGACACTGACATGGAGG + Exonic
1161028920 19:2049081-2049103 GGAGGCTGTGGCTGGCACAGGGG - Intronic
1161666870 19:5582442-5582464 GGAGGCTGAGACCCGCCCAGAGG - Intergenic
1161937255 19:7379651-7379673 GCAGGCTGCCACTGGCATAGGGG + Intronic
1162289620 19:9768978-9769000 GGAGGCGGGGACTGGCGCAGCGG + Intronic
1162550099 19:11353880-11353902 GGAGGCTGAGAATTGCTCAGGGG + Intronic
1163306538 19:16483205-16483227 GGAGAGGGACACTGGGACAGGGG - Intronic
1163398317 19:17076663-17076685 AGACGAGGACACTGGCACAGAGG - Intronic
1165128691 19:33619067-33619089 GGAGGCTGAAGGTGGCACAGTGG - Intergenic
1165352642 19:35284518-35284540 GGAGGCTGGCACTGGCATCCAGG + Intronic
1166569384 19:43784233-43784255 GGAGACAGAGACTGACACAGAGG + Intergenic
1166799431 19:45447067-45447089 GCAGGTTGGCACAGGCACAGAGG + Intronic
1167403737 19:49290317-49290339 GGAGGATGACAATGGCAAAAAGG + Exonic
1167494682 19:49810651-49810673 AGAGTCTTACACTGTCACAGGGG - Intronic
1167553772 19:50179712-50179734 GGAGGCTGAGGCTAGGACAGAGG + Intergenic
1168534006 19:57154111-57154133 GGAGGCAGAGACGGGTACAGGGG - Exonic
924964211 2:60248-60270 GGAGGCTGACCCCAGGACAGAGG + Intergenic
925718046 2:6803010-6803032 GGAGACTGGCACTGGGTCAGGGG + Intergenic
926109374 2:10172276-10172298 GGAGGCTGGGGCTGGCACCGTGG + Intronic
926431816 2:12794855-12794877 GGAGTCTTACACTGTCACACAGG + Intergenic
926775714 2:16420559-16420581 GGAGGCTGTCAGTGGGAAAGAGG + Intergenic
927050053 2:19319426-19319448 GGAGGCTGTGAATAGCACAGGGG - Intergenic
927423508 2:22956662-22956684 GGGGGCTGAGACTCGCGCAGGGG - Intergenic
927908724 2:26881194-26881216 TGAGGATGAGACGGGCACAGAGG - Intronic
928422899 2:31153459-31153481 GGTGGCTGACACTGTCCAAGGGG + Intronic
928689165 2:33781421-33781443 GGAGGCTCACACTGACAGAAGGG + Intergenic
929376663 2:41295625-41295647 GCAGGCAGACTCTTGCACAGTGG + Intergenic
929891233 2:45919933-45919955 GAAGGCAGACACTGGGACAGTGG + Intronic
930172482 2:48265865-48265887 GGAGGCTGACCCAGGCACTGTGG - Intergenic
930527010 2:52542834-52542856 GGAGGTAGAGTCTGGCACAGGGG - Intergenic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
931535451 2:63271133-63271155 GGAGGCTGCCTCTGGGACAATGG + Intronic
932215967 2:69966115-69966137 GGAGGCTTGCAATGGCACTGGGG - Intergenic
932342445 2:70974831-70974853 GGAAGCTGACACTTTCACTGTGG - Intronic
935553379 2:104481414-104481436 GGTGGCTGGCACCGGAACAGAGG + Intergenic
936076434 2:109404589-109404611 AGAGGCTGCCACGGGCACACAGG + Intronic
936346129 2:111676778-111676800 GGAGGCTGCCTCTGGGGCAGGGG + Intergenic
937361345 2:121232006-121232028 GGAGGCTCACACTGACAGAATGG - Intronic
937905082 2:127049207-127049229 CCAGGCTGACAATGACACAGAGG - Intronic
938138357 2:128777058-128777080 AGAGGCGGTCACAGGCACAGAGG - Intergenic
938279057 2:130051840-130051862 GCTGGCTGACACTGGAAAAGTGG + Intergenic
938330041 2:130442716-130442738 GCTGGCTGACACTGGAAAAGTGG + Intergenic
938359904 2:130678787-130678809 GCTGGCTGACACTGGAAAAGTGG - Intergenic
938436313 2:131285508-131285530 GCTGGCTGACACTGGAAAAGTGG - Intronic
942555666 2:177170213-177170235 TGAGGCAGGCAGTGGCACAGTGG + Intergenic
942641917 2:178069601-178069623 GGAAGCTGACATTGGGAAAGAGG - Intronic
943903847 2:193473481-193473503 GGAGACTGACACTGATAGAGAGG + Intergenic
946782415 2:223205287-223205309 GGAGGCTGCCCCTGGGACAAAGG + Intergenic
947524994 2:230872287-230872309 GGAGGCAGAGACTGGCCCCGGGG + Intronic
947534975 2:230934617-230934639 GGAGGCTGACTCCTGCCCAGAGG - Intronic
947913508 2:233817834-233817856 GGAGGCTGATGCTTGGACAGGGG + Intronic
948464261 2:238144746-238144768 GCAGGGTGACACTGGTACGGGGG - Intronic
1168810182 20:699926-699948 AGGAGCTGACACTGGCCCAGAGG - Intergenic
1168974095 20:1951219-1951241 GGATGCTGACTAAGGCACAGGGG + Intergenic
1169526704 20:6435965-6435987 GGAGGCTGACATTTTCTCAGAGG + Intergenic
1170332070 20:15224099-15224121 GGTGGCTGGCACTGGAGCAGTGG - Intronic
1170608147 20:17889135-17889157 GGAGGCTGAGACTGGATCACTGG + Intergenic
1171411527 20:24951390-24951412 GGGGGCTGTCACCAGCACAGTGG - Intronic
1172495054 20:35375710-35375732 GGAGGCTGAGACAGGCAGATCGG + Intronic
1173143171 20:40502596-40502618 GGGGGCTGAAACTGGCCCAATGG - Intergenic
1174088397 20:48026957-48026979 GAGGGCTGACTCTGGCTCAGAGG - Intergenic
1175141727 20:56865594-56865616 GGATGGGGACAGTGGCACAGAGG + Intergenic
1175777662 20:61663332-61663354 GGAGGGTGACGCTGGGGCAGGGG + Intronic
1175992774 20:62797635-62797657 GGAGGCTGACAATGGCCTAAGGG - Intronic
1179862038 21:44194965-44194987 TGAGCCAGACACTGGCCCAGTGG - Intergenic
1179950087 21:44704370-44704392 GGAGGCTGATAATGTCACAGAGG - Intronic
1180184355 21:46132074-46132096 GGCGGCTGACGCTGGCCCGGAGG + Exonic
1180246869 21:46554407-46554429 GGAGGCAGACACATGCAGAGAGG - Intronic
1181492868 22:23271633-23271655 GGAGGCTGCTGCTGGCAGAGGGG + Intronic
1181876583 22:25945303-25945325 AGAGGGTGACACTGGCACAGTGG - Intronic
1183429294 22:37756037-37756059 GGAGGCTGCCACGGGCACTGGGG + Intronic
1183891081 22:40929215-40929237 GGAGTCTCACACTGTCACCGGGG + Exonic
1183953823 22:41367654-41367676 GGGGGCAGCCACAGGCACAGTGG + Intronic
1184098043 22:42327183-42327205 GGAGGCTGGCACTGATATAGAGG + Intronic
1184152240 22:42645944-42645966 GGAGACAGACACCGGCAGAGAGG + Intronic
1184161418 22:42699644-42699666 TGAGGCTGTCATTGCCACAGGGG + Intronic
1184277671 22:43419483-43419505 GCAGGCTTTCCCTGGCACAGAGG - Intronic
1184565487 22:45289225-45289247 GGAGGCTTTCACAGGGACAGAGG - Intronic
1184659750 22:45960374-45960396 GGAGTCTGCCGCTGACACAGTGG - Intronic
1184857461 22:47154201-47154223 GGAGGGTGACAGGGGCACACAGG - Intronic
1184872529 22:47250007-47250029 GGAGGATGACATGGGGACAGAGG - Intergenic
1185259107 22:49851881-49851903 GGAGCTTGACACTGGCAGAGGGG + Intergenic
949253310 3:2014360-2014382 GGAGGCAGTCAATTGCACAGGGG - Intergenic
949397913 3:3634766-3634788 TGAGGCTGACCCTGAGACAGTGG - Intergenic
950524982 3:13518300-13518322 GGAGGAAGACAGAGGCACAGAGG - Intergenic
951342634 3:21507722-21507744 TGAGTCTGAGCCTGGCACAGTGG - Intronic
951580734 3:24160093-24160115 GCAGGCTGACAGTGGCAAGGTGG + Intronic
951987830 3:28640597-28640619 GGGGTCTGACACTTACACAGTGG - Intergenic
954496817 3:50972280-50972302 GGAGGCTGGCAAAGGCACACTGG - Intronic
954760703 3:52871503-52871525 GGAAGCTGTCCCTGCCACAGGGG - Intronic
960527315 3:118724390-118724412 GGAGTCTCACACTGTCACAGGGG - Intergenic
961420319 3:126797899-126797921 GGAGCCAGACACTGGCACGGAGG - Intronic
961614011 3:128164534-128164556 GGTGGCTGGCACTTGCACACAGG + Intronic
961745636 3:129062072-129062094 CGAGGCTGGGGCTGGCACAGCGG - Exonic
962974824 3:140436930-140436952 AGAGACAGACACTGGCACTGGGG - Intronic
965161955 3:165144422-165144444 GGAGTCTGACACTATCACTGAGG + Intergenic
967313816 3:188131765-188131787 GGAGGCAGACACATGCAAAGAGG + Intergenic
967738771 3:192982610-192982632 GGAAGCTGCCCCTGGCTCAGGGG - Intergenic
967838112 3:193981374-193981396 GAAGGGTGACACTGGCCGAGTGG - Intergenic
968543315 4:1179380-1179402 GGAGGCGGACTGTTGCACAGAGG - Intronic
969210228 4:5681631-5681653 GGAGGCAGACGCTGGGAGAGTGG - Intronic
970380534 4:15502902-15502924 GGAGACTGAATTTGGCACAGAGG + Exonic
973710882 4:53629368-53629390 TTAGGCTGACTCTGGCAAAGAGG + Intronic
977290290 4:95158790-95158812 TGAAGCTGACTGTGGCACAGTGG + Intergenic
980815275 4:137939060-137939082 AGAGTCTCACACTGTCACAGAGG - Intergenic
980933609 4:139205276-139205298 GGAGTCTCACACTGTCACCGAGG - Intergenic
982094834 4:151912256-151912278 GGAGGCTGACTTTTTCACAGAGG - Intergenic
985093895 4:186392611-186392633 AGAGGCTGTTTCTGGCACAGTGG - Intergenic
985516202 5:346015-346037 CCAGGCTGACGCTGGCCCAGCGG + Intronic
985621458 5:958329-958351 GGACACCCACACTGGCACAGGGG + Intergenic
985709581 5:1420752-1420774 GGGAGCAGACACTGGCACAAGGG + Intronic
986559639 5:9047752-9047774 GGCTGCTGGCACTGGCACAATGG - Intronic
987262909 5:16221522-16221544 GGAGGCTGAATGGGGCACAGAGG + Intergenic
988590917 5:32548710-32548732 GGAGTCTCACTCTGTCACAGAGG + Intronic
988855605 5:35225417-35225439 GGAGCCTGACACAAGAACAGAGG + Intronic
988940351 5:36139321-36139343 GGAGGCTGACAGTGGGGCTGAGG + Intronic
989487621 5:42010480-42010502 GGAGGCTCACACTGTCACCCAGG - Intergenic
990538731 5:56750839-56750861 GGAAGCAGACACTGAGACAGAGG - Intergenic
991685581 5:69179521-69179543 GGAGGCTCACACTGTCACCCAGG + Intergenic
993056370 5:82985176-82985198 TGAGGCAGACACTGTCACGGTGG - Intergenic
994253016 5:97559089-97559111 GGAGGCTGAGACTGGCCAGGTGG + Intergenic
994525464 5:100901023-100901045 GGAGGCGGGCACTGGCGCGGCGG - Intronic
994934967 5:106242886-106242908 GCAGCCTGAGACTTGCACAGTGG - Intergenic
995751767 5:115459571-115459593 GGAGGCCGACATTGGCAGTGGGG - Intergenic
1000733155 5:164861554-164861576 AGAGGCTGCAACAGGCACAGAGG - Intergenic
1001592749 5:172877654-172877676 GGAAAATGACACTGTCACAGGGG - Intronic
1002370549 5:178749718-178749740 ATGGGCTGACACTGTCACAGCGG + Intergenic
1002437392 5:179239948-179239970 GGAGGGTGCCTCTGGCAGAGTGG + Intronic
1002482177 5:179509628-179509650 ATGGGCTGACACTGTCACAGTGG - Intergenic
1003030595 6:2597232-2597254 GGAGGCTGACTCTGACATGGGGG - Intergenic
1003234586 6:4284252-4284274 GGCGGCAGAGACTGGGACAGAGG + Intergenic
1003705764 6:8526929-8526951 AGAGGGTGACAGTGGAACAGTGG - Intergenic
1005182763 6:23125295-23125317 GGAGGCTGAGGCTGGCAGATTGG + Intergenic
1008678650 6:53848228-53848250 GGAGGCTCACAATGGGAAAGCGG - Intronic
1010252980 6:73727523-73727545 GGGAGCTGACACTGACTCAGGGG - Intronic
1011558141 6:88589834-88589856 GAAGGCTGACAGTGACCCAGAGG - Intergenic
1012070063 6:94603468-94603490 AGAGTCTGACACTGACAAAGGGG + Intergenic
1015549484 6:134397106-134397128 GGGGGATGACAGTGGCAGAGTGG - Intergenic
1015559424 6:134498459-134498481 GGAGGAGGACACTGGAAGAGGGG + Intergenic
1015866940 6:137736712-137736734 GGGAGCTCACACTGGCTCAGGGG - Intergenic
1019286970 7:228510-228532 AGAGGCTGACACTGCCATGGGGG + Exonic
1019707243 7:2502566-2502588 AGAGGCTGACACTGACCCTGCGG + Intergenic
1021249822 7:18310446-18310468 TGAGGCTGTCACTGACACACAGG - Intronic
1021918186 7:25456185-25456207 GGAGGGGGACAGTGGTACAGTGG + Intergenic
1022456335 7:30561595-30561617 GCACGCTGACACTGGGTCAGAGG - Intergenic
1023869838 7:44257253-44257275 GGAGGCTGGCTGAGGCACAGGGG + Intronic
1023873683 7:44275891-44275913 GAAGGCTGACCCTGGGGCAGGGG + Intronic
1024511941 7:50211668-50211690 GGAGGCAGGCACTGGCACACTGG + Intergenic
1026000747 7:66557843-66557865 GGTGGCTGTCACTAGGACAGGGG + Intergenic
1026852385 7:73733138-73733160 GGAGGCTGACACTGGAAGTCAGG + Intergenic
1031124791 7:117761153-117761175 GGAGGCTGACCCTGACTCTGCGG - Intronic
1032157241 7:129478482-129478504 GGAGTCTGACACTGTCACCCAGG - Intronic
1032323965 7:130909387-130909409 GGAGGGTGACGCAGGCAGAGTGG - Intergenic
1032579718 7:133093045-133093067 GGAGGTAGAGACTGGCTCAGGGG + Intergenic
1033351910 7:140568775-140568797 TGAGTCTGACAGTGACACAGAGG - Exonic
1035025496 7:155822331-155822353 AGAGGCTGCCACTGGACCAGGGG - Intergenic
1038411722 8:27364188-27364210 GGTGGCAGTCAGTGGCACAGAGG - Intronic
1038542383 8:28400862-28400884 GGAGGCTGAGAAAGGCAAAGCGG - Intronic
1040294590 8:46142672-46142694 GGATGTTGACACAGGCAGAGAGG - Intergenic
1040332956 8:46401598-46401620 GGATGTTGACACAGGCAGAGAGG - Intergenic
1040340587 8:46438558-46438580 GGAGGTTGACACAGGCAGAGGGG - Intergenic
1041052953 8:53955540-53955562 GGAGGCCAGCCCTGGCACAGTGG + Intronic
1041409463 8:57537105-57537127 TGAGGCTGAAACTGGCAGGGAGG - Intergenic
1045047673 8:98294411-98294433 GGATGCAGACACTGGCCCAGCGG - Intergenic
1047581885 8:126224780-126224802 GGAGGCAGGCACTGTCACATGGG + Intergenic
1049229208 8:141473408-141473430 GGAGGCTGGCTCTGGCTCAGAGG - Intergenic
1051218671 9:14826116-14826138 GGAGTCTCACACTGTCACACAGG + Intronic
1052880615 9:33599179-33599201 GCTGGCTGACACTGGAAAAGCGG - Intergenic
1054823769 9:69549799-69549821 GAAGGCTTACATTGGGACAGAGG + Intronic
1056207662 9:84335931-84335953 GGATGCAGACACTGGGACGGAGG - Intronic
1056477799 9:86969537-86969559 GGAAGCTGAACCAGGCACAGCGG - Intergenic
1056637956 9:88347042-88347064 GGAGTCTCACTCTGTCACAGAGG - Intergenic
1057675253 9:97132389-97132411 GCTGGCTGACACTGGAAAAGTGG + Intergenic
1058711033 9:107679342-107679364 GGAGTCTCACACTGTCACTGGGG + Intergenic
1059321920 9:113476650-113476672 GGAGGCTGACAAAGGCCCAGGGG - Intronic
1059442677 9:114318376-114318398 GGTGCCTGGTACTGGCACAGTGG - Intergenic
1060671498 9:125473844-125473866 GAAGGCTGACATTTGAACAGAGG - Intronic
1061204131 9:129153222-129153244 GGAGGGTGAGGTTGGCACAGTGG + Intergenic
1062190056 9:135243380-135243402 GGAGGTTGAGACTGGCATTGGGG - Intergenic
1062265892 9:135686304-135686326 GGAGGGTGGCCCTGGAACAGCGG + Intergenic
1062317795 9:135977071-135977093 GGAGGCAGATGCAGGCACAGGGG + Intergenic
1062431297 9:136527926-136527948 GGAGGGTGGGAGTGGCACAGTGG - Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1187261824 X:17691909-17691931 GCTGGCTGTCACTGGCTCAGGGG - Intronic
1190739603 X:53280494-53280516 GGAGGCTGACAAGGTCTCAGTGG + Intronic
1190777480 X:53564618-53564640 GGAGGCTGAAACCGACTCAGTGG - Exonic
1191720614 X:64225548-64225570 GGAGGAGGACACTGACACAGAGG - Exonic
1191858773 X:65648835-65648857 GGAGGCTCACACTGTCACCCAGG - Intronic
1191995392 X:67089586-67089608 GGAGGCTGCCCCTGGGACAAAGG - Intergenic
1193535345 X:82708922-82708944 GTAGGCTGAGACTGGCACCGTGG - Intergenic
1198231798 X:134696926-134696948 GGAGGCTGACACAGGAAGAATGG + Intronic
1199569601 X:149254218-149254240 TGTGTCAGACACTGGCACAGAGG - Intergenic