ID: 930688974

View in Genome Browser
Species Human (GRCh38)
Location 2:54339618-54339640
Sequence CACAAACACTAGGGCAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930688974 Original CRISPR CACAAACACTAGGGCAGCTA AGG (reversed) Intronic
903847331 1:26286085-26286107 CACAGAGGCTAGGGCTGCTAGGG - Intronic
918433209 1:184483885-184483907 CACACACACAAAGGCAGCAAAGG - Intronic
918716947 1:187801634-187801656 CCAAAACACTAGAGCAACTAGGG + Intergenic
919823701 1:201489109-201489131 CACAAAGGCTAGGGCCTCTAGGG + Intronic
921149293 1:212386804-212386826 CACAAATACAACGGCAGCTCAGG + Intronic
922764265 1:228149369-228149391 CACAGCCCCTGGGGCAGCTAGGG - Intergenic
923028940 1:230231378-230231400 CAAAAACACTAGGTCACCTGGGG + Intronic
924003468 1:239580027-239580049 CACATAAATGAGGGCAGCTAAGG - Intronic
1083278594 11:61611467-61611489 CACACACACAAGGGCAGCTTGGG + Intergenic
1084505924 11:69568009-69568031 CACAAACCCTTGGGCAGCCTGGG - Intergenic
1086659801 11:89401344-89401366 CACAAATATTAGGGCAGGTATGG - Intronic
1088556881 11:111070879-111070901 CACAAACATTATGGCAGGGAAGG - Intergenic
1090115934 11:123973625-123973647 CACAAACTGTAGCACAGCTATGG - Intergenic
1092148561 12:6231625-6231647 CACAAACAGTAGAGCAGCACTGG - Intronic
1092164670 12:6335703-6335725 CAGAAACCCTAGGGCAGGGAAGG + Intronic
1093234582 12:16591199-16591221 CACAGATACTAGTGCAGCTGGGG - Intronic
1094163988 12:27423108-27423130 CACAAACCTTAGGAGAGCTACGG - Intronic
1095579353 12:43779146-43779168 TCCAGACACTAGGGCAGCTGAGG + Intronic
1095775343 12:46003962-46003984 CCCAAAAACTAGGGCAGCAATGG + Intergenic
1096129991 12:49150687-49150709 CCCAGACACTCGGGAAGCTAAGG + Intergenic
1096395041 12:51259565-51259587 CACAAAGAATGGGGAAGCTATGG + Intronic
1096763810 12:53866487-53866509 CACAAAAATTTGGGAAGCTAGGG - Intergenic
1102330170 12:112022256-112022278 CCCATACACTGGGGCAGTTAAGG + Exonic
1106224508 13:27774833-27774855 CACATCCACTGGTGCAGCTATGG - Intergenic
1109584128 13:64375554-64375576 CACTTACTCTAGGGCAGCTTGGG + Intergenic
1112188433 13:97150762-97150784 CCCAAATACTCGGGAAGCTAAGG - Intergenic
1115146477 14:30232174-30232196 AACATACACTAAGGTAGCTAGGG + Intergenic
1118291714 14:64531309-64531331 CAGAATCACTAGGGCAGATTAGG + Intronic
1119240613 14:73056518-73056540 CACAAACTCTTGGGCGGCCATGG + Intergenic
1122137376 14:99642347-99642369 AACAAACACTAGAGCATCCAAGG - Intergenic
1126077931 15:44931454-44931476 CACAGACCCTAGCGCAGGTATGG + Intergenic
1128658597 15:69481215-69481237 CACATACACTAGGGTAGCTGTGG - Intergenic
1130776869 15:86993496-86993518 CACAAACATGAGAGCAGTTATGG + Intronic
1131308737 15:91268761-91268783 CACAGCCACTAGGGGAGCTATGG - Intronic
1134748883 16:16609858-16609880 CTGAAAAGCTAGGGCAGCTAAGG - Intergenic
1134996580 16:18743760-18743782 CTGAAAAGCTAGGGCAGCTAAGG + Intergenic
1135261212 16:20982771-20982793 CACCAACTCTAGGGCATCTGTGG + Exonic
1135579278 16:23611572-23611594 CCCAACTACTAGGGAAGCTAAGG - Intronic
1135979508 16:27136367-27136389 CACAACCCCTGGGGCAGGTAAGG + Intergenic
1137401969 16:48161106-48161128 CACAGATACTAGGGAAGCTGAGG - Intergenic
1146629999 17:34463018-34463040 CACCAACACTAGGGGTGCTAGGG - Intergenic
1148932745 17:51140400-51140422 CCCAAACACTAGGGAGGCTGAGG + Intergenic
1151422019 17:74005002-74005024 CACAAAAGCTAGGGCTTCTAAGG - Intergenic
1151971593 17:77460274-77460296 CACAAACACCAGGGCCCCTCGGG - Intronic
1158044462 18:53139019-53139041 CACAAATACAAGGGCAGAAAAGG - Intronic
1161796986 19:6392975-6392997 CACACTCACTAGGGCCGCCATGG + Exonic
1165243397 19:34483844-34483866 CACAAACCCCAGGACAGCCACGG - Intronic
1165292437 19:34898337-34898359 TACAAAAACTAGGCCAGGTATGG + Intergenic
925184832 2:1839977-1839999 GACACACACCAGGGCAGCAAAGG + Intronic
926478452 2:13357484-13357506 CACCACCACTAGGACAGCTCTGG - Intergenic
927436484 2:23070956-23070978 CCAAAACACTAGGGCATCTCTGG - Intergenic
927957431 2:27217550-27217572 CTCCAACACTAGGGCCGCCATGG - Exonic
930143968 2:47982256-47982278 CACAATCACAAAGGCAGCTTAGG + Intergenic
930274358 2:49294397-49294419 GACAAACCCTAGAGAAGCTATGG - Intergenic
930688974 2:54339618-54339640 CACAAACACTAGGGCAGCTAAGG - Intronic
935335229 2:102009645-102009667 CACAACCAGTAGGGCACCTGGGG - Exonic
937706471 2:124926556-124926578 CACAGCTACTAGGGAAGCTAAGG + Intergenic
939312641 2:140503969-140503991 AAGAAATACTAGGGTAGCTAAGG - Intronic
939516354 2:143173090-143173112 CACAAACACTTAGGTAACTATGG + Intronic
942352433 2:175066168-175066190 CACAAACACTAGGACTGCACTGG - Intergenic
946854183 2:223936544-223936566 GACAAACACTAGGGTAATTATGG + Intronic
1169760906 20:9092900-9092922 CCCAGATACTATGGCAGCTAGGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1173285026 20:41662588-41662610 CATAAGCACTAGGGGAGCTCAGG + Intergenic
1178769839 21:35492957-35492979 CATAGACACTTGGTCAGCTATGG + Intronic
1180230528 21:46424382-46424404 CACAATCACTAGGGCTGAGAAGG - Intronic
1181323849 22:22029777-22029799 TAAAAAGACTAGGGCAGCTCAGG + Intergenic
1182499078 22:30732522-30732544 CACAACCACTTGGCCACCTACGG - Intronic
950747132 3:15099466-15099488 CACAAAGAATAAGGCAGCCAAGG + Intergenic
950833510 3:15898199-15898221 CAGAACCACAAGGGCAGGTAGGG - Intergenic
951328017 3:21328749-21328771 CACAAACCCCAGGGGAACTATGG - Intergenic
951707899 3:25562132-25562154 CAGATACACGAGGGCAGCTTGGG + Intronic
953790834 3:45946702-45946724 GACAAACACCAGGTCAGCCAGGG - Exonic
955633559 3:61000857-61000879 CTCTACCACTAGGGCAGCGATGG + Intronic
961001382 3:123376361-123376383 AAGAATCACTAGGACAGCTAAGG + Intronic
965621293 3:170644665-170644687 CACAAACACAAGGGCCGGCAGGG + Intronic
967057375 3:185841351-185841373 CAGAAACAGTAGGGCAGGAAGGG + Intergenic
967169840 3:186814423-186814445 TGCCAACACTAGGGCAGCTGAGG - Intergenic
967226607 3:187298071-187298093 AACAAACACTGGGTCAGTTAAGG + Intergenic
971146462 4:23981840-23981862 CACAAGGAATAGGGAAGCTAAGG + Intergenic
972451235 4:39200738-39200760 CACAAAAAGTAGGGCAGGGATGG + Intronic
973771305 4:54209446-54209468 CTCAACTACTAGGGAAGCTAAGG + Intronic
976373402 4:84316330-84316352 CACCAAGACTAAGCCAGCTATGG + Intergenic
977880114 4:102194504-102194526 GAAAAATATTAGGGCAGCTATGG + Intergenic
977989973 4:103429714-103429736 CACACACACTGTGGCAGCCATGG - Intergenic
978593502 4:110351930-110351952 CCCAACCACTTGGGGAGCTAAGG + Intergenic
978682408 4:111397417-111397439 CATAAAAACAAGGCCAGCTACGG + Intergenic
979075188 4:116261780-116261802 CACAAACAATATTGCATCTAGGG + Intergenic
982373751 4:154663607-154663629 CCCAACTACTTGGGCAGCTAAGG - Intronic
986567984 5:9134542-9134564 CACAAACACTAGAGCACAGAGGG + Intronic
992279432 5:75158674-75158696 CCCAACCACTCAGGCAGCTAAGG + Intronic
993135807 5:83962106-83962128 CAGAAACACTAGGGCTGTAATGG - Intronic
993419326 5:87681154-87681176 CACAAACTTAAGGGCAGCTAGGG + Intergenic
995988006 5:118203524-118203546 CAGAAACACTAGAACAGCCAAGG + Intergenic
1000886251 5:166751137-166751159 CACAAACACAATTCCAGCTAGGG - Intergenic
1003598837 6:7500129-7500151 CACACACACTTGGGGAGCTGAGG - Intergenic
1005493112 6:26365040-26365062 CACAAACACTAAGGGAGGTAGGG + Intergenic
1005502352 6:26440342-26440364 CACAAACACTAAGGGAGGTACGG + Intergenic
1009165169 6:60331953-60331975 CTCAAACACTAGGACAGGCACGG - Intergenic
1010716039 6:79231779-79231801 CACAAGCAGTAGGACAGATAAGG - Intronic
1011888065 6:92122678-92122700 AACACTCACTAAGGCAGCTAAGG + Intergenic
1014180421 6:118378176-118378198 CACACACACTAGTGCTGCTTGGG + Intergenic
1014415955 6:121184862-121184884 AGCAAGCACTAGGGCAGCTGAGG + Intronic
1014913659 6:127120283-127120305 CACAGACACTAGAGCAGCGAGGG - Intronic
1015349475 6:132200210-132200232 CACTAACACTAGATCAGCAAGGG + Intergenic
1016607299 6:145944943-145944965 CACAACTACTTGGGAAGCTAAGG + Intronic
1017146846 6:151241878-151241900 AAAAGAGACTAGGGCAGCTAAGG - Intronic
1020420233 7:7995392-7995414 CCCAAATACTCGGGAAGCTAAGG + Intronic
1022896950 7:34759798-34759820 CACAAAGACTGGGGCAGCAGGGG + Intronic
1028954171 7:96670568-96670590 CACAAACACTAGGTCACACAGGG - Intronic
1030350875 7:108484811-108484833 CACAAACAATATGCCAACTATGG + Intronic
1030892342 7:115014272-115014294 AACAAACACCAGGGTACCTACGG - Intronic
1031962784 7:128004931-128004953 AACAAAGATTACGGCAGCTAGGG - Intronic
1034544397 7:151780561-151780583 CACAAACACTAATGAACCTACGG + Intronic
1035938274 8:3867317-3867339 CACAAACAGTAGGGTAGCCTAGG + Intronic
1035976476 8:4317486-4317508 CACAATCACTATGCCTGCTAAGG + Intronic
1039690161 8:39855140-39855162 CATAAACAATAGGGCAGAGAAGG + Intergenic
1042336761 8:67638156-67638178 CTCAAACTCTAGGGCATCCAAGG - Intronic
1044321695 8:90809059-90809081 AACAAACACTAGTGCAGCTCTGG - Intronic
1045871755 8:106935075-106935097 CAGAAACACATGGGCAACTATGG + Intergenic
1046552959 8:115739573-115739595 CACAAACACAGGGACAGCGAAGG + Intronic
1059148849 9:111928613-111928635 CACAAACACTAGGGCTTCACTGG + Intronic
1186231611 X:7461288-7461310 CACAGATACTTGGGCAGATAAGG - Intergenic
1189201980 X:39204305-39204327 CACAAACACTAAGAGAGCTTTGG - Intergenic
1189508399 X:41636605-41636627 CAGAAACAGTAGAGCAGCTGAGG - Exonic
1190585895 X:51941583-51941605 CACAAACAACAGGGAAGCTGAGG + Intergenic
1191197280 X:57737692-57737714 CACAACCACTAGGACAGCACAGG - Intergenic
1193638606 X:83984360-83984382 CACAAACACTTGGGCTGGCAGGG + Intergenic
1194378535 X:93165743-93165765 GACAAAAGCTAGGGCATCTAAGG + Intergenic
1194573384 X:95580613-95580635 CATAAACAATAGGGCAGAGAAGG - Intergenic
1197777086 X:130125533-130125555 AACAATCTCTAGGGCAGCAAGGG + Intergenic