ID: 930692438

View in Genome Browser
Species Human (GRCh38)
Location 2:54378336-54378358
Sequence GCAGCCTCCGGAGCTTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930692431_930692438 23 Left 930692431 2:54378290-54378312 CCAGTGCTAGTCTTTCCTGCGAA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 930692438 2:54378336-54378358 GCAGCCTCCGGAGCTTATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
930692435_930692438 -5 Left 930692435 2:54378318-54378340 CCAGCCTCACACGGCTTTGCAGC 0: 1
1: 0
2: 2
3: 15
4: 123
Right 930692438 2:54378336-54378358 GCAGCCTCCGGAGCTTATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
930692432_930692438 8 Left 930692432 2:54378305-54378327 CCTGCGAAAAATCCCAGCCTCAC 0: 1
1: 0
2: 0
3: 14
4: 122
Right 930692438 2:54378336-54378358 GCAGCCTCCGGAGCTTATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
930692434_930692438 -4 Left 930692434 2:54378317-54378339 CCCAGCCTCACACGGCTTTGCAG 0: 1
1: 0
2: 0
3: 15
4: 139
Right 930692438 2:54378336-54378358 GCAGCCTCCGGAGCTTATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113
930692436_930692438 -9 Left 930692436 2:54378322-54378344 CCTCACACGGCTTTGCAGCCTCC 0: 1
1: 0
2: 1
3: 23
4: 210
Right 930692438 2:54378336-54378358 GCAGCCTCCGGAGCTTATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930692438 Original CRISPR GCAGCCTCCGGAGCTTATCC AGG Intronic