ID: 930694701

View in Genome Browser
Species Human (GRCh38)
Location 2:54399718-54399740
Sequence TCACACAGAAGGTTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930694701_930694707 15 Left 930694701 2:54399718-54399740 CCCTCAAGAAACCTTCTGTGTGA No data
Right 930694707 2:54399756-54399778 TAGCACTCTTATTCTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930694701 Original CRISPR TCACACAGAAGGTTTCTTGA GGG (reversed) Intergenic
No off target data available for this crispr