ID: 930694707

View in Genome Browser
Species Human (GRCh38)
Location 2:54399756-54399778
Sequence TAGCACTCTTATTCTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930694700_930694707 16 Left 930694700 2:54399717-54399739 CCCCTCAAGAAACCTTCTGTGTG No data
Right 930694707 2:54399756-54399778 TAGCACTCTTATTCTGTTCAAGG No data
930694701_930694707 15 Left 930694701 2:54399718-54399740 CCCTCAAGAAACCTTCTGTGTGA No data
Right 930694707 2:54399756-54399778 TAGCACTCTTATTCTGTTCAAGG No data
930694702_930694707 14 Left 930694702 2:54399719-54399741 CCTCAAGAAACCTTCTGTGTGAT No data
Right 930694707 2:54399756-54399778 TAGCACTCTTATTCTGTTCAAGG No data
930694705_930694707 4 Left 930694705 2:54399729-54399751 CCTTCTGTGTGATGGGTCATATA No data
Right 930694707 2:54399756-54399778 TAGCACTCTTATTCTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930694707 Original CRISPR TAGCACTCTTATTCTGTTCA AGG Intergenic