ID: 930698057

View in Genome Browser
Species Human (GRCh38)
Location 2:54431396-54431418
Sequence CAGGATGAAGAATGGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930698052_930698057 -1 Left 930698052 2:54431374-54431396 CCTAGGGATAACTGTTTGCAGAC No data
Right 930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG No data
930698048_930698057 16 Left 930698048 2:54431357-54431379 CCTAGAGTTCAGGGTGCCCTAGG No data
Right 930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG No data
930698051_930698057 0 Left 930698051 2:54431373-54431395 CCCTAGGGATAACTGTTTGCAGA No data
Right 930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG No data
930698047_930698057 17 Left 930698047 2:54431356-54431378 CCCTAGAGTTCAGGGTGCCCTAG No data
Right 930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930698057 Original CRISPR CAGGATGAAGAATGGGTGGA CGG Intergenic
No off target data available for this crispr