ID: 930703929

View in Genome Browser
Species Human (GRCh38)
Location 2:54485874-54485896
Sequence CCTCCCAGACGGGTCGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 5, 2: 9, 3: 16, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930703929_930703935 -3 Left 930703929 2:54485874-54485896 CCGGCCGCGACCCGTCTGGGAGG 0: 1
1: 5
2: 9
3: 16
4: 157
Right 930703935 2:54485894-54485916 AGGTGAGGAGCGTCTCTGCCCGG 0: 806
1: 3903
2: 7547
3: 9606
4: 4570
930703929_930703938 19 Left 930703929 2:54485874-54485896 CCGGCCGCGACCCGTCTGGGAGG 0: 1
1: 5
2: 9
3: 16
4: 157
Right 930703938 2:54485916-54485938 GCCGCCCCGTCTGAGAAGTGAGG 0: 1343
1: 2046
2: 5102
3: 9439
4: 6078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930703929 Original CRISPR CCTCCCAGACGGGTCGCGGC CGG (reversed) Intronic