ID: 930705722

View in Genome Browser
Species Human (GRCh38)
Location 2:54502965-54502987
Sequence TCATGACCACAGAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930705722_930705731 8 Left 930705722 2:54502965-54502987 CCATGTTCCCTCTGTGGTCATGA 0: 1
1: 0
2: 1
3: 19
4: 265
Right 930705731 2:54502996-54503018 GAACTACCTGTGTGGCTTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
930705722_930705729 6 Left 930705722 2:54502965-54502987 CCATGTTCCCTCTGTGGTCATGA 0: 1
1: 0
2: 1
3: 19
4: 265
Right 930705729 2:54502994-54503016 GAGAACTACCTGTGTGGCTTGGG 0: 1
1: 0
2: 1
3: 12
4: 182
930705722_930705728 5 Left 930705722 2:54502965-54502987 CCATGTTCCCTCTGTGGTCATGA 0: 1
1: 0
2: 1
3: 19
4: 265
Right 930705728 2:54502993-54503015 GGAGAACTACCTGTGTGGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 123
930705722_930705730 7 Left 930705722 2:54502965-54502987 CCATGTTCCCTCTGTGGTCATGA 0: 1
1: 0
2: 1
3: 19
4: 265
Right 930705730 2:54502995-54503017 AGAACTACCTGTGTGGCTTGGGG 0: 1
1: 0
2: 3
3: 20
4: 182
930705722_930705727 0 Left 930705722 2:54502965-54502987 CCATGTTCCCTCTGTGGTCATGA 0: 1
1: 0
2: 1
3: 19
4: 265
Right 930705727 2:54502988-54503010 GGAAAGGAGAACTACCTGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930705722 Original CRISPR TCATGACCACAGAGGGAACA TGG (reversed) Intronic
902220018 1:14958791-14958813 TCCAGATCACAGAGGGACCAGGG - Intronic
905234444 1:36536277-36536299 TCTTGAGCAGACAGGGAACAGGG + Intergenic
911829796 1:102536386-102536408 TCATGAGAACAGAGGGAAGGGGG + Intergenic
913662710 1:121018937-121018959 TGATGAGCATAGAGGGAAGAAGG - Intergenic
914652711 1:149710757-149710779 TGATGAGCATAGAGGGAAGAAGG - Intergenic
915148383 1:153809294-153809316 TCCTGACCCCATTGGGAACACGG - Exonic
915725141 1:158011861-158011883 TGCTGACCACAGAGGGGACCCGG - Intronic
916254787 1:162775862-162775884 TCATGACCACAGGGAGGAGAAGG - Intronic
917601473 1:176578479-176578501 TCAGGAGCAGAGTGGGAACAAGG + Intronic
917649960 1:177066580-177066602 GAATGCCCAAAGAGGGAACAGGG - Intronic
920280927 1:204843052-204843074 TCAGGAACACAGAGGAATCATGG - Intronic
920770348 1:208878879-208878901 GAATGACTACAGAGGGAGCATGG - Intergenic
920775352 1:208931332-208931354 TAATGAGCACAGAGGGATTAAGG + Intergenic
920952978 1:210590272-210590294 TCATGAAAAGAGAGGGAAGAAGG - Intronic
921377403 1:214488726-214488748 TCAGGATCACAGAGGGCAAATGG + Intronic
923775422 1:236974168-236974190 TCATGCACAGAGAGGGAAGAAGG + Intergenic
924702297 1:246466362-246466384 TCATGTCCTCAGCAGGAACATGG + Intronic
1063231999 10:4074681-4074703 TCATGACCACTTAGTGCACATGG + Intergenic
1067088262 10:43254042-43254064 TCAGGCCCACAGAGGGCAGACGG + Intronic
1067164564 10:43855143-43855165 ACATCACCACCAAGGGAACATGG + Intergenic
1068316412 10:55349133-55349155 CCATGACTACAGAAGAAACATGG - Intronic
1070679238 10:78437112-78437134 CGAAGACCACAGAGGGAGCAGGG - Intergenic
1072463034 10:95637766-95637788 TCAAGACCACCCAGGCAACATGG + Intronic
1073537446 10:104290704-104290726 TCATGAACACAGAGAGTAGAAGG + Intronic
1075783912 10:125035276-125035298 TCACGACCACAGAGGATAAAAGG - Intronic
1078056091 11:8010086-8010108 CCATGAACGCAGCGGGAACAAGG - Intergenic
1078094125 11:8286035-8286057 AGAGGACCGCAGAGGGAACAAGG + Intergenic
1078545228 11:12242210-12242232 TCACGACCACAGAGGGGAACTGG - Exonic
1079722668 11:23838034-23838056 TCATAACCACATAGGTAACTTGG + Intergenic
1080030422 11:27655105-27655127 TCTTTACCATAGAGAGAACAAGG + Exonic
1080040280 11:27752952-27752974 TCAGGACCACAGCTGGAAAATGG - Intergenic
1080657111 11:34266780-34266802 ACATGTCTACAGAGGGCACAGGG - Intronic
1080982395 11:37424068-37424090 TCATGACTTCAGAGGGTGCAAGG - Intergenic
1081157407 11:39711457-39711479 TCATTGTCACAAAGGGAACATGG - Intergenic
1081346455 11:41993101-41993123 TCATGATCTTAGAGGGAATAAGG + Intergenic
1081993831 11:47351342-47351364 GCCTGGCCACAGAGGGCACACGG - Exonic
1083222755 11:61264364-61264386 CCATGTTCAGAGAGGGAACACGG - Intronic
1085744012 11:79099418-79099440 TCAGGACCACAGAGGCAAAGAGG - Intronic
1089013631 11:115149221-115149243 TCAAGACCAGAGAGGCAACTGGG - Intergenic
1089611579 11:119672358-119672380 TCATTACCCCAGAGGGAGAAGGG + Intronic
1090876926 11:130798470-130798492 TTATGACCACAGAGGACACAAGG - Intergenic
1090988060 11:131790510-131790532 TCATGGCCTCAGAGGCAAGAAGG + Intronic
1091028542 11:132162933-132162955 TGAAGACCACAGAGGGAAAAGGG + Intronic
1091314660 11:134605073-134605095 ACATGGCCAGAGAAGGAACAAGG + Intergenic
1091681504 12:2530845-2530867 TGATGGCCCCAGAGGGAACACGG + Intronic
1093193948 12:16108122-16108144 TCATGTCCACACTGGGAACTAGG - Intergenic
1093759589 12:22892934-22892956 TCTTGAAGACAGAGGGAAAAAGG - Intergenic
1094810406 12:34131751-34131773 TCATGAACATAGAGTGTACAAGG + Intergenic
1095289359 12:40459565-40459587 TCATGACCACAGAATGTAGAAGG - Intronic
1096680981 12:53255165-53255187 TCATAGCCACAGAGGCAAAAGGG - Intergenic
1097311578 12:58124639-58124661 TCATGTCCTCTGCGGGAACATGG - Intergenic
1097505900 12:60469399-60469421 TCATGTCCACTGAAAGAACATGG - Intergenic
1099215407 12:79847045-79847067 ACACGTCCACAGAGGGAAAAAGG + Intronic
1099451551 12:82813930-82813952 TGATACCCTCAGAGGGAACAGGG + Intronic
1099622137 12:85016620-85016642 TCATGTCCCAGGAGGGAACAGGG + Intronic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1103223994 12:119270954-119270976 TCATGACAAAAGAGGTAACGGGG - Intergenic
1104221689 12:126790760-126790782 TCATGTCCTCTGAAGGAACACGG + Intergenic
1104718902 12:131033762-131033784 AAATGACCACAGAGGACACACGG - Intronic
1105410647 13:20168551-20168573 TCATGTCCACACAGGGACCTGGG - Intergenic
1105811250 13:23997716-23997738 ACATGGCAAGAGAGGGAACAAGG + Intronic
1106353497 13:28956885-28956907 TGATGGCGACAGAGGGAAGAAGG + Intronic
1106409720 13:29502877-29502899 TGATGACCGCAGGGAGAACAGGG - Intronic
1108715686 13:53075718-53075740 TCATCACCATAGAGGGGGCAGGG - Intergenic
1110707038 13:78608363-78608385 TCATGTCCACGGAGAGATCAGGG - Intergenic
1111356266 13:87107487-87107509 ATATGACCACAGAGGGGAGAAGG - Intergenic
1112196042 13:97227338-97227360 ACATGACCTCAGAGGAAAAAGGG + Intronic
1112683357 13:101793202-101793224 TCATGAAAACAGAGGGTAGATGG - Intronic
1113670521 13:112172581-112172603 TCAGGACTTCAGAGTGAACATGG + Intergenic
1114053491 14:18943882-18943904 TCATGCCCTCAGTAGGAACATGG - Intergenic
1114109068 14:19458043-19458065 TCATGCCCTCAGTAGGAACATGG + Intergenic
1120975480 14:90244424-90244446 TAATGAACAAAGAGGGAAAAAGG - Intergenic
1121181869 14:91935176-91935198 GCATGACGTCAGAGGGACCAGGG + Intronic
1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG + Intronic
1126645482 15:50871033-50871055 TCATGTACAAAGAGGGAAAAAGG + Intergenic
1127003500 15:54538681-54538703 TCATGACCTCTGCGGCAACATGG + Intronic
1127672756 15:61211666-61211688 TGATGGCCACAGAGGGCAGAGGG + Intronic
1128760267 15:70212056-70212078 TCATGGCCACACAGGGTGCATGG - Intergenic
1129908398 15:79206176-79206198 GCTTGACCACAGAGGGCAGAGGG + Intergenic
1130851781 15:87802050-87802072 TCCTGACCACAGAGTAAGCAGGG - Intergenic
1130941049 15:88509439-88509461 TCATGACCACAGACTTAAAATGG - Intergenic
1131177220 15:90217638-90217660 AGAGGACCACAGAGGGAAGATGG + Intronic
1133482926 16:6189123-6189145 GCATGACAACAGATGGAAAATGG - Intronic
1133547504 16:6822005-6822027 ACATGACCAAATAGGGAGCATGG + Intronic
1134796588 16:17043039-17043061 TCATGTCCACTGCAGGAACATGG + Intergenic
1137540817 16:49360413-49360435 TCATCACCACAGCTGGAGCAGGG - Intergenic
1140061130 16:71570608-71570630 TCATGAGCACAGTGGGGACAAGG - Intronic
1140449780 16:75061333-75061355 TCATGGACACAGAGGGTAGAAGG - Intronic
1140777572 16:78264160-78264182 TCATCACCACAGAGGGCCCCAGG + Intronic
1141436238 16:84001400-84001422 TCAGGACCCCAGTGGGAACAGGG + Intronic
1143308761 17:5971008-5971030 TCAGGACCACAGACAGAATAGGG + Intronic
1143633845 17:8153221-8153243 CCAGGACTACAGAGGGACCAAGG + Intronic
1143677637 17:8447490-8447512 TTAAGAGCACAGAGGGAAGATGG - Intronic
1146505519 17:33401326-33401348 TGATGATCAGAGAGGGAAGAGGG - Intronic
1147175348 17:38652662-38652684 TCGTGACCACAGAGGGCAGCTGG + Intergenic
1147819443 17:43232939-43232961 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147820536 17:43239085-43239107 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147821558 17:43244819-43244841 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147822652 17:43250977-43250999 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147825169 17:43265773-43265795 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147826008 17:43270507-43270529 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147826289 17:43272285-43272307 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147828289 17:43283293-43283315 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147829399 17:43289457-43289479 TCATGACCTCTGCGGGAACGTGG + Intergenic
1147830490 17:43295592-43295614 TCATGACCTCTGCGGGAACGTGG + Intergenic
1148740057 17:49887636-49887658 TCACTACCACAAAGGGAAGAAGG - Intergenic
1150241736 17:63639516-63639538 TTATGAACAAAGAAGGAACATGG + Intronic
1150925008 17:69523711-69523733 GGATGGCCACAGAGGGAAAATGG + Intronic
1152439449 17:80296880-80296902 TCAAGACCACCGTGGCAACATGG - Intronic
1156746295 18:40395505-40395527 TCATTACCACAGGTTGAACAGGG + Intergenic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1157346200 18:46836559-46836581 GAATGAGCTCAGAGGGAACATGG + Intronic
1158587627 18:58755408-58755430 TTATGAGCACAAAAGGAACACGG + Intergenic
1159420185 18:68208445-68208467 ACATGGCCAGAGAGGGATCAAGG + Intergenic
1160499992 18:79396671-79396693 TCAGGACCACAGAGGGCACGTGG + Intronic
1161041049 19:2110968-2110990 TAATGACCACAGAGGCAGCAGGG + Intronic
1162247383 19:9413227-9413249 TCATGTCTTCAGAGAGAACAGGG + Exonic
1163561553 19:18022259-18022281 ACATGACCACACAGGAAACCAGG - Intergenic
1164671476 19:30074493-30074515 TCCTCAGCACAGTGGGAACAAGG + Intergenic
1165312026 19:35034218-35034240 TCATCACCACAGAGGGCAGCAGG - Exonic
1166695555 19:44849454-44849476 TGATGAACACAGAAGGGACAGGG + Intronic
1166975825 19:46604467-46604489 TGATGATCACAGAGGGGAGAGGG - Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
1168412410 19:56147960-56147982 TGATGACCACAGAGGGCCCGAGG + Intronic
925338294 2:3114818-3114840 CCAGGGCCACAGAGGGATCAAGG - Intergenic
927197563 2:20558825-20558847 CCATGACCACAGAGGGGGTAGGG + Intergenic
929928908 2:46237087-46237109 TCATGAGGACAGAGGGGACCTGG - Intergenic
930090744 2:47529697-47529719 TCATGACTACAGAGAAACCATGG + Intronic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
930733435 2:54750726-54750748 TCAAGACCTCAGAGGAAACAGGG + Intronic
932731994 2:74227955-74227977 TCCTGACCACAGAGGCAGCTAGG + Intronic
937579113 2:123461782-123461804 TCAAGACCAGGCAGGGAACATGG - Intergenic
944604655 2:201341646-201341668 TTCTCACCACAGAGGGAAAATGG - Intronic
945367204 2:208969381-208969403 TCATTACAACAGAGTGATCAAGG + Intergenic
945509191 2:210679687-210679709 TCTTGACCACAGGAAGAACAAGG - Intergenic
945863428 2:215149783-215149805 TCATCAACCCAGAGTGAACATGG - Intergenic
947669597 2:231927803-231927825 TCACTACCACGGAGGGAAGAGGG - Intergenic
948484389 2:238271269-238271291 TCCCGACCCCAGAGGGAACAAGG + Intronic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1170281046 20:14649459-14649481 TCATGACCACAGTTCTAACAGGG + Intronic
1171286809 20:23946383-23946405 TCATAACAACAGAGGGGCCAAGG - Intergenic
1172789669 20:37494245-37494267 TCATGACCACAAAGAGATCGAGG - Intronic
1172880509 20:38196686-38196708 GTCTGACCACAGAGGGCACAGGG - Intergenic
1173842619 20:46168045-46168067 CCATGCACCCAGAGGGAACATGG + Intergenic
1174780235 20:53382780-53382802 TCATGACCAAAGAGACAACCTGG + Intronic
1174872159 20:54192880-54192902 TAATGCCCCCAGAGAGAACAAGG + Intergenic
1175020701 20:55845877-55845899 CCATGACCTTAGAGGGAAGATGG + Intergenic
1175183529 20:57165000-57165022 TGAGGACCACAGAGGGACCCTGG - Intergenic
1175185784 20:57178925-57178947 TCATGAGCACAGAAGGGACAAGG + Intronic
1176074586 20:63242753-63242775 ACATGACAGCAGAGGGAACATGG + Intronic
1176637789 21:9264746-9264768 TCATCACCACAGCTGAAACAAGG + Intergenic
1177685686 21:24434709-24434731 TCATGACTTTTGAGGGAACATGG - Intergenic
1177874546 21:26615376-26615398 TCAAGACCACCTAGGTAACATGG + Intergenic
1177886528 21:26752930-26752952 TTATAACCTCAGAGTGAACAAGG + Intergenic
1180421829 22:12872243-12872265 TCATCACCACAGCTGAAACAAGG + Intergenic
1180471960 22:15666263-15666285 TCATGCCCTCAGTAGGAACATGG - Intergenic
1182115359 22:27753361-27753383 TGAGGTCCAGAGAGGGAACATGG - Intronic
1182621067 22:31618875-31618897 TCATGGCACCAGAGTGAACAGGG - Exonic
1182681234 22:32081616-32081638 TCATCCCCAGGGAGGGAACACGG - Intronic
1183551691 22:38491093-38491115 ACATGACCTCAGAGGGCAGAGGG + Intronic
1184775111 22:46619223-46619245 TCAGGACCCCAGAGGGCCCAGGG + Intronic
1184802144 22:46767913-46767935 TCATGACCACAGTGAAGACATGG + Intronic
949113904 3:296540-296562 TCATGACCACAGAGGAAAAGAGG + Intronic
950096150 3:10331806-10331828 TCGTCAGCACAAAGGGAACAGGG + Intronic
952215366 3:31272636-31272658 TCAAGACCAAAGAGAGAAAATGG - Intergenic
953480199 3:43244826-43244848 TAATGACCAGAGCAGGAACATGG - Intergenic
953857152 3:46508139-46508161 TGATAAACACAGAGAGAACATGG + Intergenic
954155853 3:48684659-48684681 TTCTGACCACAGGGGGAAGAAGG - Intronic
954995995 3:54882187-54882209 TGATGTCCACAGAGCCAACATGG - Intronic
956518070 3:70072531-70072553 TCCTGACCACGGAGAGAAGAGGG + Intergenic
960459800 3:117919744-117919766 TCATAGCCACAGAAGGAATAAGG - Intergenic
961100244 3:124192335-124192357 TCATGAACATAGAGAGTACAAGG + Intronic
961471226 3:127114409-127114431 TCAAGCCCACAAATGGAACAGGG - Intergenic
962162684 3:133015624-133015646 TCATGAACATAGAGGGTAGAAGG - Intergenic
962689183 3:137876661-137876683 TCATGGACACAGAGAGTACAAGG + Intergenic
962895438 3:139709787-139709809 TCATTTCCACAGGGAGAACATGG + Intergenic
963858516 3:150281156-150281178 TCCTGCCCACAGAGGGGTCAGGG + Intergenic
963962598 3:151326110-151326132 TCATGACAACAGGAGGATCATGG - Intronic
967126377 3:186428074-186428096 GCAGGTCCACAGAGTGAACAGGG - Intergenic
967715345 3:192756282-192756304 TCATGAACATAGAGGGTAGAAGG + Intronic
1202749106 3_GL000221v1_random:140275-140297 TCATCACCACAGCTGAAACAAGG - Intergenic
968884115 4:3318162-3318184 TGATGGCCACAGAGGCCACAGGG - Intronic
969579127 4:8053807-8053829 TCATGAACAAAGAGGAAAAAGGG - Intronic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
970284983 4:14502034-14502056 TCATGACAACAAAGACAACATGG - Intergenic
971178302 4:24302975-24302997 TCAAGACCAGAGAAGGAAAAGGG + Intergenic
973709687 4:53616078-53616100 TCATGAACACAGAGAGCAGAAGG - Intronic
974411353 4:61545227-61545249 TGATAACCTCAGTGGGAACATGG - Intronic
974625820 4:64428216-64428238 TCATGACAGAAGACGGAACAAGG - Intergenic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
977482277 4:97593577-97593599 TCATGCCCACAGTGGCAGCAGGG - Intronic
978358770 4:107906240-107906262 TCATGACAACAGAGCAAACAAGG - Intronic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
980930696 4:139179613-139179635 TCTTGAACACAGAGGAAACCTGG + Intergenic
1202752687 4_GL000008v2_random:23162-23184 TCATCACCACAGCTGAAACAAGG + Intergenic
985840540 5:2301970-2301992 ACAGGCCCCCAGAGGGAACATGG - Intergenic
990502525 5:56410664-56410686 TCATGACTACAGAGGGACTTGGG + Intergenic
990997404 5:61746178-61746200 TCTTGGGCACAGAGGGAGCATGG + Intronic
991427474 5:66506493-66506515 TGATGAGAACAAAGGGAACATGG - Intergenic
996195457 5:120600881-120600903 TCATGACCTCTGATGCAACACGG - Intronic
997098354 5:130939463-130939485 CACTGACCACAGAGGGTACAAGG + Intergenic
997447061 5:133948252-133948274 ACATGACAAGAGAGGGAACAAGG + Intergenic
998761856 5:145440878-145440900 TTGTGACCACAGGAGGAACATGG - Intergenic
1000221992 5:159223202-159223224 TAAAGACTTCAGAGGGAACAAGG - Intergenic
1000663754 5:163969392-163969414 TGATCAACACAGAGGGAAAAGGG - Intergenic
1001178222 5:169493034-169493056 TCATGAAGACAGAGGGCAGAAGG + Intergenic
1001258122 5:170200805-170200827 TCATTATCACAGAGCAAACAGGG + Intergenic
1003393297 6:5731801-5731823 TGAGGACCTCAGAGGGACCAAGG - Intronic
1004418272 6:15445128-15445150 TGATGACCCCAGAGGAAACCTGG + Intronic
1005327712 6:24719551-24719573 TCATGACGGCAGAAGGAAAAGGG + Exonic
1005908935 6:30290835-30290857 TCTGGACCTCAGAGGGAACAAGG + Intergenic
1006392795 6:33768689-33768711 TTCTGACCACAGAGGGGACCAGG - Intergenic
1007904143 6:45442432-45442454 CCAAGTCCACAGATGGAACAAGG - Intronic
1010631107 6:78199383-78199405 TCATGGCCAGAGAGGAAACAAGG - Intergenic
1013368973 6:109454462-109454484 TCTTGGGCACAGAGGGCACATGG + Intronic
1014083100 6:117310693-117310715 TCATGTCCTTTGAGGGAACATGG - Intronic
1015548569 6:134388085-134388107 TAAGGCCCACAGAGGTAACATGG + Intergenic
1016053097 6:139550691-139550713 TTATTACCCCAGAGGGAAAAGGG - Intergenic
1016496252 6:144665926-144665948 TCATGTGCACAGAGGGGCCATGG - Intronic
1016721241 6:147301346-147301368 CCATAATCACAAAGGGAACATGG - Intronic
1017165603 6:151405711-151405733 TCATTACCATAGAGGTAAGATGG - Exonic
1017493317 6:154962882-154962904 GGATCACCACAGAGGGCACATGG + Intronic
1018371283 6:163170497-163170519 TCCTGACCCCAGCGGGAGCAGGG - Intronic
1018595052 6:165470185-165470207 ACATGACCAGAGAGGAAGCAAGG + Intronic
1018606850 6:165606630-165606652 TAATGACTATAGTGGGAACAGGG + Intronic
1018850072 6:167580991-167581013 ACAGGACGACAGAGGGGACAAGG + Intergenic
1018908061 6:168086650-168086672 CCATGTCCACAGTGGGAACATGG - Intergenic
1019076855 6:169394841-169394863 TCTTCAGCAGAGAGGGAACATGG + Intergenic
1019758585 7:2791528-2791550 GCAAGACGGCAGAGGGAACAGGG + Intronic
1020246785 7:6435546-6435568 TAAAGGCCACAGAAGGAACAGGG + Intronic
1025782205 7:64611801-64611823 TCATGCCCACAGAAGAAAGATGG + Intergenic
1026279994 7:68913770-68913792 TCATGGTAAGAGAGGGAACAAGG - Intergenic
1026528637 7:71177397-71177419 TCAGGACCACCCAGGGAAAATGG - Intronic
1028295813 7:89130147-89130169 TCCTGGCCACAGAGTGAAGAGGG + Intronic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1029574211 7:101392327-101392349 TCATAACAACAGATGGAAAAAGG - Intronic
1029907658 7:104107688-104107710 TCATGTCCACAGCAGGGACATGG - Intergenic
1030539049 7:110806094-110806116 TATTGATCACAGAGGGAACCTGG + Intronic
1030834754 7:114268206-114268228 TCATGTCCACAGAGGATAAATGG - Intronic
1032662977 7:134006110-134006132 TCAAGAGCACAGAGGAAACTCGG - Intronic
1032856029 7:135834315-135834337 TCATGAGCAGAGAAGGAAGAAGG + Intergenic
1033908450 7:146235622-146235644 TCATGACCACTTGGGGAAAAGGG - Intronic
1034509752 7:151524053-151524075 TAGTGACTTCAGAGGGAACACGG + Intergenic
1035956154 8:4082212-4082234 TTATGACCACACAGGTAAAATGG + Intronic
1036975393 8:13405298-13405320 TGAGGACCACAGAGGGGAGAAGG - Intronic
1037818361 8:22123815-22123837 TGCTGACCACGGAGAGAACAGGG + Intronic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1038520684 8:28229765-28229787 GCATGACAACAGAAGGAACCTGG + Intergenic
1039070988 8:33649159-33649181 TCACCACCACAAAGTGAACATGG - Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1039988253 8:42466107-42466129 TCCTCAACACAGAGGGGACAGGG + Intronic
1040671603 8:49698073-49698095 GCATGACCATAGAGGCACCAGGG + Intergenic
1045327588 8:101127978-101128000 TCAGGACCACAGTGGACACAAGG + Intergenic
1046061426 8:109144493-109144515 CCACAACCACAGAGTGAACATGG + Intergenic
1046451811 8:114402611-114402633 TGAGGACCACAGAACGAACAAGG + Intergenic
1048813433 8:138309196-138309218 TGATGTCCACAGAGAGAGCAGGG - Intronic
1049068088 8:140335321-140335343 TCATGACCACGATGGGAAGAGGG + Intronic
1050024640 9:1321134-1321156 TCATGACAGCAGTGGGAAGAAGG - Intergenic
1050150064 9:2610655-2610677 TCAAAACAACAGAGGGAAAAAGG + Intergenic
1050193914 9:3059971-3059993 GCTTGAAGACAGAGGGAACAAGG + Intergenic
1051686547 9:19664035-19664057 TCATGACCGTGTAGGGAACATGG + Intronic
1052747469 9:32454443-32454465 CCAGGACCACAGAGATAACAAGG + Exonic
1055328114 9:75153300-75153322 ACATGCCCACAGTGGGAAAATGG - Intergenic
1055394631 9:75861032-75861054 ACATGTCCACAGAGAGAAGAGGG - Intergenic
1056175731 9:84033456-84033478 TCATGGACATAGAGGGTACAGGG - Intergenic
1056296685 9:85200369-85200391 TCTTTCCCACAGAGAGAACAGGG - Intergenic
1057309240 9:93931439-93931461 TCATCACCACAGAGGAAAGGGGG + Intergenic
1059519614 9:114928357-114928379 TGAGGAGCAGAGAGGGAACAGGG - Intronic
1062297377 9:135839838-135839860 TGACGACCACAGATGGAAAAGGG + Intronic
1062576197 9:137209537-137209559 TAATGCCCACAGCGGGAACTGGG + Intronic
1203717746 Un_KI270742v1:170365-170387 TCATCACCACAGCTGAAACAAGG - Intergenic
1187216270 X:17280148-17280170 TCATAACCATAGGGGGGACATGG - Intergenic
1189267289 X:39726502-39726524 TCCTGACCACAAAAGGAAAAAGG - Intergenic
1189998927 X:46665924-46665946 ACATGACCACAGAGTGGAGAAGG + Intronic
1190362566 X:49662848-49662870 TCATGACCCCCCTGGGAACAGGG + Intergenic
1191200156 X:57772056-57772078 TTTAGACCACAGAGTGAACATGG - Intergenic
1193579173 X:83241813-83241835 TCATGGACACAGAGGGTAGAAGG + Intergenic
1194694712 X:97031762-97031784 GCAGGACCACAGAGGGGAGAAGG + Intronic
1194832071 X:98635621-98635643 TCATGAACACAGAGAGTAGAAGG + Intergenic
1195715620 X:107815737-107815759 GGATGAGCACAGAGGGATCAAGG + Intergenic
1199171956 X:144743157-144743179 TCATGTACAGAGAGGGAAAAGGG - Intergenic
1199796034 X:151198167-151198189 TCATGTCCTTTGAGGGAACATGG + Intergenic
1200132461 X:153858319-153858341 TCAGCATCACAGAGGGAAGAAGG + Intergenic
1201785194 Y:17768746-17768768 TCTGTACCACAGAGGGAAAAGGG + Intergenic
1201816359 Y:18137241-18137263 TCTGTACCACAGAGGGAAAAGGG - Intergenic