ID: 930707456

View in Genome Browser
Species Human (GRCh38)
Location 2:54518948-54518970
Sequence TCTAAATTTTATTATGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 551}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930707456 Original CRISPR TCTAAATTTTATTATGTGTA TGG Intronic
900881454 1:5384477-5384499 TTTGAATTTTATTATTTTTATGG - Intergenic
903589724 1:24445594-24445616 TCTAGCTTTTATTAGGAGTAAGG - Intronic
906849393 1:49231698-49231720 TCTGTATTTTGTTCTGTGTATGG - Intronic
907362626 1:53931782-53931804 CCTAAAGTTGATTATTTGTAAGG - Intronic
907612583 1:55887675-55887697 TCTCAGTTTTATCATTTGTAAGG - Intergenic
908137847 1:61151396-61151418 TCTTAATTTTATCATAGGTAAGG + Intronic
908827326 1:68146339-68146361 TCTCAAATTTATTGTGTATACGG - Intronic
908838355 1:68251642-68251664 CCTATATTTTATTATTTTTAAGG + Intergenic
908951031 1:69563159-69563181 TCTGAAATTGATTATTTGTATGG - Intergenic
909653242 1:77999397-77999419 TATAAATGTTATTATGGGGAAGG + Intronic
909812612 1:79949933-79949955 TATAGATTTTAGTATGTGCAAGG - Intergenic
909959708 1:81824763-81824785 TCTGAAGTTTATTAGGTGGAGGG + Intronic
910461852 1:87455910-87455932 TAAAGATTTTTTTATGTGTAAGG + Intergenic
911430500 1:97779855-97779877 TCTAACTTTTACTAGCTGTAGGG + Intronic
912065219 1:105730475-105730497 TGTTAATTTGATTAAGTGTAAGG - Intergenic
912277155 1:108272108-108272130 TCTGATTTTTATTATCTATAGGG - Intergenic
912291073 1:108422248-108422270 TCTGATTTTTATTATCTATAGGG + Intronic
912434147 1:109647325-109647347 TCTAAGTTTTTTTTTGTGTGTGG + Intergenic
912527326 1:110293102-110293124 TCTGAATTTTATCATGTGGGGGG - Intergenic
912600239 1:110923446-110923468 ACCAAATTTTATCATGTGCAAGG + Intergenic
915776418 1:158492658-158492680 TCTAAATTCTAATATATGGAAGG + Intergenic
915877306 1:159625050-159625072 TCTAAATTTTATTCTTATTAAGG - Intergenic
916255644 1:162785074-162785096 TCTAAATTTTCTGATTTGTTTGG + Exonic
916393359 1:164357695-164357717 TCTTTTTTTTATTATTTGTAAGG + Intergenic
917130036 1:171732066-171732088 TCTAGATTTTTTTGTGTGTTTGG - Intronic
917346424 1:174032811-174032833 CCAAAACTTTATTATGTGGAGGG + Intergenic
917933186 1:179838198-179838220 TCTCATTTTTAGTGTGTGTATGG + Intergenic
918179638 1:182075492-182075514 TCTAAGTTATAAAATGTGTAGGG - Intergenic
918804963 1:189028523-189028545 TCTAAATTTTTTATTCTGTATGG + Intergenic
918994868 1:191744314-191744336 ACTAAATTTTAATGTGAGTATGG + Intergenic
919184186 1:194122362-194122384 TCTAAGTTGTTTTCTGTGTATGG + Intergenic
919282781 1:195512553-195512575 TCTTAATTGTATTATTTCTATGG - Intergenic
919376588 1:196801930-196801952 TCTAGATTTTATTATCTACAAGG + Intergenic
919386287 1:196926842-196926864 TCTAGATTTTATTATCTACAAGG + Intronic
919565875 1:199187205-199187227 TCAGAATTTTACTATGTGTGTGG - Intergenic
919622158 1:199875054-199875076 TCTAAACTTAAATATGTGTTGGG + Intergenic
921539061 1:216390510-216390532 TTTAAATTTTATAATGTTTTGGG + Intronic
921632107 1:217447483-217447505 TCTTCATTTTATGATCTGTAAGG + Intronic
922298277 1:224271529-224271551 TATAAATTTTTTTATGTTTCTGG + Intronic
923293186 1:232567411-232567433 TCTTGATTATATTATGAGTAAGG - Intergenic
923487641 1:234450196-234450218 TCTAAATTATTTTATGTTTAAGG - Intronic
923642702 1:235781453-235781475 TCTGAATGCTATTATGTGTGAGG + Intronic
923964878 1:239126381-239126403 TGTAAATTTCATAATGTGTCAGG + Intergenic
924786675 1:247205835-247205857 TTTATTTTTTATTTTGTGTAGGG - Intergenic
1063254387 10:4310137-4310159 TCTAATTTTTATTATTTGGTAGG - Intergenic
1063412053 10:5843756-5843778 TTTAAAATTTAATATATGTAAGG - Intergenic
1063530220 10:6823832-6823854 TTTAAAATTTTTTATGTGTTTGG + Intergenic
1064418590 10:15170814-15170836 TCTAAAGTTTATTTGGTGGATGG + Intergenic
1065073915 10:22057228-22057250 TGTAAACATTATTATGTGTTAGG + Intergenic
1065280082 10:24128081-24128103 GCTGAATTTTATTCTGTGTTTGG + Intronic
1066073719 10:31849474-31849496 ACTAAATTTTAATATCTGCATGG + Intronic
1066525082 10:36269149-36269171 ACAAAAATTTATTATTTGTAGGG + Intergenic
1066752632 10:38674216-38674238 TTTAACATTTATTATGTTTAAGG - Intergenic
1067046267 10:42986973-42986995 TCTCCTTTTTTTTATGTGTACGG + Intergenic
1068254787 10:54495593-54495615 TCTAACTTTTATTATCTCTATGG - Intronic
1069206408 10:65693141-65693163 TTTAATTTGTATAATGTGTAAGG + Intergenic
1069281654 10:66662000-66662022 TTTTAATTTTATAATGTGTATGG - Intronic
1070291001 10:75113610-75113632 TTTAAATTAGTTTATGTGTATGG + Intronic
1071100024 10:82025629-82025651 TCTTAATTTTAGTATTGGTAAGG - Intronic
1071322412 10:84476212-84476234 TTTAGATTTTATTTTGTATAAGG + Intronic
1071770072 10:88719266-88719288 ACTTAATTTTCTTATCTGTATGG - Intergenic
1072073548 10:91945248-91945270 TCTAAATTTTATTACTGTTAAGG + Intronic
1072302980 10:94079725-94079747 TCTGAATTTTTTTATGTGACAGG + Intronic
1072419323 10:95276443-95276465 TGTAAATTTTATAATGGGTGGGG - Intronic
1073327830 10:102652484-102652506 TGCAAATTTTAGTTTGTGTATGG + Intronic
1073864724 10:107788507-107788529 TCAAAATTCTAAAATGTGTATGG + Intergenic
1073881999 10:107992690-107992712 TCTAAATATTATTATGACAATGG - Intergenic
1074137522 10:110640896-110640918 TTTGAATTTTCTTATTTGTAAGG + Intergenic
1074333591 10:112544929-112544951 TCTGGATTTTATTCTGAGTAGGG + Intronic
1074657794 10:115615106-115615128 TCTTACTTTTATTATTTGTGTGG + Intronic
1075480404 10:122776564-122776586 TCTAAATATTGTTATATTTATGG + Intergenic
1075770308 10:124929011-124929033 TTTTAATTTTATTCTGTGTAAGG + Intergenic
1076025125 10:127105690-127105712 TAATAATTTTATTATGTGTCAGG + Intronic
1078678035 11:13444647-13444669 TCTATATATTATCCTGTGTAAGG + Intronic
1079716879 11:23758164-23758186 TTTTAAATTTATTATGTGCATGG + Intergenic
1079783242 11:24636785-24636807 TCTATATTTTCTTATGTCTCTGG - Intronic
1080046657 11:27815858-27815880 TCTAGCATTTATTATGTGTCAGG + Intergenic
1080630430 11:34070014-34070036 TCACAATTTTATTATTGGTAAGG + Intronic
1082914103 11:58412223-58412245 TTTAAATTTATTTTTGTGTATGG + Intergenic
1083013287 11:59424691-59424713 GCTGTATTTTATTATTTGTATGG + Intergenic
1085169610 11:74437877-74437899 ACTGAATTCTATTATGTGTAGGG + Intergenic
1085330368 11:75644427-75644449 TATTAATTTTGTTATGTGTCAGG + Intronic
1085841035 11:80012227-80012249 TTCAAAGTTTATTATATGTAGGG - Intergenic
1085857642 11:80193563-80193585 TTTTAATTTTATCATCTGTAAGG + Intergenic
1086167748 11:83798985-83799007 TGTAAATTTAATTATTTCTATGG + Intronic
1086276819 11:85139828-85139850 TTTAAATTTTATTTTGTATATGG + Intronic
1087117499 11:94541396-94541418 TCTTATTTTTATTACGTATAAGG - Intergenic
1087273268 11:96134364-96134386 TCAAAAATGTATTATGTGCAAGG - Intronic
1087417839 11:97881004-97881026 TTTAAATTATATTCTGTGTATGG - Intergenic
1087986215 11:104683620-104683642 TCTCAAATTAATTTTGTGTATGG + Intergenic
1088642129 11:111882780-111882802 TGAATATTTTATTATCTGTAAGG + Intronic
1089144953 11:116321234-116321256 TCCAAAATTGATTCTGTGTATGG - Intergenic
1089413901 11:118270838-118270860 TCAAAATTTTATTCTTTGTAAGG - Intergenic
1089482204 11:118815192-118815214 ACTTAATTTTATTTTTTGTAGGG - Intergenic
1090369873 11:126242079-126242101 TTTAATTTTTATAAAGTGTATGG - Intronic
1090538069 11:127667930-127667952 TCTAAATTTTTAAATTTGTAGGG - Intergenic
1091165825 11:133475169-133475191 TTTATTTTTTATTGTGTGTAGGG + Intronic
1093278926 12:17166589-17166611 TCAAAATATGAATATGTGTATGG + Intergenic
1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG + Intergenic
1093794185 12:23291566-23291588 TTTAAATTTTAATATTTTTAAGG + Intergenic
1093805391 12:23426314-23426336 TTTAACTTTTATTATGTGCCAGG - Intergenic
1093859268 12:24143157-24143179 TCTTACTTTTATTATTTGTTAGG - Intergenic
1094001954 12:25705282-25705304 TGTAAGGTTTATTATATGTAAGG - Intergenic
1095549666 12:43419102-43419124 TATAATTTTTATTTTGTGAATGG - Intronic
1097140087 12:56894807-56894829 TCAAAATTTTACTATATGAAAGG + Intergenic
1097388755 12:58983199-58983221 TATAAATTTTATTATTTGTATGG - Intergenic
1098016719 12:66112743-66112765 TCCAAATGTTATTATTTGTGTGG + Intergenic
1098334604 12:69389856-69389878 TTTCAATCTTAATATGTGTATGG + Intronic
1098661894 12:73105038-73105060 TCTAAATTAAATTATTTGTTTGG + Intergenic
1099488030 12:83252124-83252146 TTTAAATTTTCATATGGGTAAGG + Intergenic
1099494670 12:83332165-83332187 TCTACATTTTTCTATGTTTATGG - Intergenic
1099671031 12:85693062-85693084 TCAAAATTCTAGTATTTGTAGGG - Intergenic
1099698048 12:86045687-86045709 TCTATATTTGTCTATGTGTAAGG + Intronic
1099718198 12:86325528-86325550 TCTATAGCTTATTATCTGTAAGG + Intronic
1099935697 12:89122457-89122479 TCTATATTATATTTTATGTAGGG - Intergenic
1100814247 12:98370510-98370532 CCTAAATTGTATTATTTGTCAGG - Intergenic
1101261689 12:103038567-103038589 TCTAAATTTTATTATGTAGTTGG + Intergenic
1103084440 12:118051669-118051691 TCTAAAATTGATTATGTGCCAGG + Intronic
1103752653 12:123176152-123176174 TCTGAATTTTATTATGATTTGGG - Intronic
1103996814 12:124835440-124835462 TGTAGATTTTATTTTTTGTAGGG + Intronic
1105053116 12:133072643-133072665 GCTAATTTTTATTTTTTGTAGGG - Intergenic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1106353548 13:28957251-28957273 TATTAATTTTTTTATGTGTAAGG - Intronic
1106403661 13:29454649-29454671 TCTAAAATTGATCAAGTGTAGGG - Intronic
1106814592 13:33393203-33393225 TTTAATTTTTCTTATGTGTTAGG - Intergenic
1106896661 13:34310188-34310210 TTTAAATTTTGTTAAGGGTAAGG - Intergenic
1107009473 13:35653715-35653737 TGTAAATGGTATTTTGTGTATGG - Intronic
1107216635 13:37928476-37928498 CCTACATTCTATTATGTTTATGG + Intergenic
1107640725 13:42440696-42440718 TCTAAATTTTATGGTGGGTTTGG + Intergenic
1108856234 13:54796944-54796966 GTTAAATTTGATAATGTGTAAGG + Intergenic
1109000851 13:56803097-56803119 TATAAATTTTATTAAGTGCCTGG - Intergenic
1109023189 13:57125461-57125483 TATTAATTATATAATGTGTAAGG - Intergenic
1109241473 13:59895050-59895072 TATAAATTTTAATTTGTTTAAGG - Intronic
1109401941 13:61844107-61844129 TGTAAATATTATTATGTTTTTGG + Intergenic
1109418266 13:62073306-62073328 TTTAAATTTCATTAGGTCTATGG + Intergenic
1109475051 13:62869890-62869912 TTTAAATTTTATTTTGTAAAAGG - Intergenic
1109530715 13:63642566-63642588 TCTTAATTTTTTCATGGGTAAGG - Intergenic
1109758251 13:66790572-66790594 TCTATAATTGATTTTGTGTATGG + Intronic
1109828838 13:67758932-67758954 TATAAATTATATTATTTATAAGG - Intergenic
1109880171 13:68462720-68462742 ACTACATTTTACTATATGTATGG + Intergenic
1110553754 13:76835505-76835527 AATATATTTTATTATGTATATGG - Intergenic
1110615390 13:77535889-77535911 TCTAATTTTAATCATTTGTAAGG - Intronic
1110649318 13:77925225-77925247 GCTAAATTATATTATTTTTAAGG + Intergenic
1110672327 13:78195289-78195311 TGTAAATATTTTTATGTATATGG - Intergenic
1111155229 13:84312803-84312825 TAAATATTTTATTATTTGTATGG + Intergenic
1111894608 13:94125984-94126006 TATACATTATTTTATGTGTATGG + Intronic
1112176516 13:97030750-97030772 TTTAAATTTTATTTAGTATATGG + Intergenic
1112459556 13:99591475-99591497 TCTGAATATTCTCATGTGTATGG + Intergenic
1113090447 13:106612543-106612565 TCTCCATTTTATTATGGCTAAGG - Intergenic
1114346551 14:21801787-21801809 TCTAATTTTTTTCATGTGGAAGG + Intergenic
1114857266 14:26464041-26464063 TCCGAATTTTATAATGTGTGAGG - Intronic
1115153346 14:30310814-30310836 TCTAAATTTTATTAATTGAAAGG + Intergenic
1115413076 14:33098135-33098157 TCTAGAATTAATTTTGTGTATGG + Intronic
1115860954 14:37685846-37685868 TTTATATTTTTTTAAGTGTAAGG + Intronic
1115953328 14:38746808-38746830 TCTACATTTTAGTATCTGTTGGG + Intergenic
1116236772 14:42288364-42288386 TCTAAATTTTATTCTTTGTTTGG - Intergenic
1116246735 14:42424917-42424939 TCTAGCTGTTATTATGTGTATGG + Intergenic
1116351169 14:43865284-43865306 GCTAAAATTTTTTATGTGCAAGG + Intergenic
1116382059 14:44281962-44281984 TCTTCAGTTTATTTTGTGTATGG + Intergenic
1116651458 14:47598491-47598513 TCAAAATTTCATTATTTTTATGG - Intronic
1117048999 14:51842104-51842126 TCTCAATTTTATTATGATTTAGG - Intronic
1117211552 14:53506054-53506076 TATGATTTTTATTATGTGTTTGG + Intergenic
1117633363 14:57716708-57716730 TCAAATATTTATTATTTGTATGG + Intronic
1118270829 14:64340484-64340506 TTTAAATTTTATTATTTTTTTGG - Intergenic
1118414409 14:65518859-65518881 GATACATTTTATTATGTGCAAGG - Intronic
1118850532 14:69579734-69579756 CCTAATTGTTATTATCTGTAAGG - Intergenic
1120260475 14:82178267-82178289 TCTATATTTTAGGATGTCTATGG + Intergenic
1120318085 14:82921748-82921770 TCCAAATTTTATTCTGTTTAAGG - Intergenic
1120343864 14:83258633-83258655 TATAAATTATTTTATGTGCATGG + Intergenic
1120385534 14:83840973-83840995 CCTGGATTTTATTATTTGTAAGG - Intergenic
1120590216 14:86365301-86365323 TTTAATTTTTATTGTCTGTAGGG - Intergenic
1120849801 14:89159674-89159696 TCTGAATTTTATCATCTGTGGGG + Exonic
1120951857 14:90048947-90048969 TCTTAATTTTATTATATAGAGGG + Intergenic
1121531276 14:94655834-94655856 TCTAAATTCTACTATGTATCTGG - Intergenic
1123912457 15:24981658-24981680 ACTAAGCATTATTATGTGTATGG - Intergenic
1124789288 15:32712264-32712286 TCTAAATTTTTTTTGGTGGAGGG - Intergenic
1124793806 15:32756055-32756077 TCTAAATTTTAAAATATGTTGGG + Intergenic
1125058887 15:35395046-35395068 TCTGAAATTAAATATGTGTAAGG + Intronic
1125118309 15:36121521-36121543 ACTAGATTTTGTTATGTGAAAGG - Intergenic
1125193505 15:37020434-37020456 TCTTATTTTGATTATGTGTAAGG - Intronic
1125778204 15:42238265-42238287 CCTAATTTTTATTTTTTGTAGGG - Intronic
1126266487 15:46760337-46760359 TATTAATTCTATTATGTTTATGG + Intergenic
1126277425 15:46900529-46900551 CCTAAATTTTCTTATGAGGATGG - Intergenic
1126485244 15:49172980-49173002 TCTAAATTTGATTATGGTGATGG - Intronic
1127206512 15:56725840-56725862 TCGAACATTAATTATGTGTAAGG + Intronic
1127365279 15:58283910-58283932 TCTAGGTCTTATTATGTGTGGGG - Intronic
1129570430 15:76677559-76677581 TTAAAATTTTATTGTGTGTGTGG - Intronic
1130792350 15:87168914-87168936 TTTAGATTGTATTATGAGTAAGG + Intergenic
1131722304 15:95183554-95183576 TTTAAATTTTTTTTTGTGTATGG + Intergenic
1132304202 15:100798900-100798922 TTTAATTCTTATTATCTGTAAGG - Intergenic
1134368329 16:13600119-13600141 TCCAAATTATATAATGGGTATGG + Intergenic
1136376461 16:29868438-29868460 TCAAAATTTTTTTGTGTGTGTGG + Intergenic
1136730088 16:32402816-32402838 TTTAACAGTTATTATGTGTAAGG + Intergenic
1136901412 16:34042369-34042391 TCTTGAGTTTATTATGTATAGGG + Intergenic
1138971777 16:62153150-62153172 TCTAACTTTTTTTGTGTGTGTGG + Intergenic
1140598783 16:76449580-76449602 TCTTAATTTTTGTGTGTGTAGGG + Intronic
1140938039 16:79693632-79693654 TCTAAACTATCTTATGTGTGTGG + Intergenic
1141302099 16:82826346-82826368 TCTAATTTTTATAATGAGTAGGG + Intronic
1141313925 16:82942191-82942213 TCTTAAGTTAATTTTGTGTATGG + Intronic
1142309005 16:89301293-89301315 TCTACTTTTTTATATGTGTAAGG - Intronic
1202996309 16_KI270728v1_random:114487-114509 TTTAACAGTTATTATGTGTAAGG - Intergenic
1203022996 16_KI270728v1_random:426829-426851 TTTAACAGTTATTATGTGTAAGG - Intergenic
1143938356 17:10511134-10511156 TCTAAACTTTTATCTGTGTACGG - Intronic
1144073652 17:11697449-11697471 TTTAAATTTTATTCTCTATAGGG - Intronic
1144530521 17:16034420-16034442 TTTAATTTTTATTTTTTGTAGGG - Intronic
1147522320 17:41186109-41186131 TTTAAATTCTATTGTGTTTACGG + Intergenic
1148936639 17:51168420-51168442 TCTAAATTTTATTTTATGAATGG + Intronic
1149185037 17:53987944-53987966 TCTAGATTTTATTATTTCTGTGG - Intergenic
1151301242 17:73228496-73228518 TCTAACTTTAATAATGAGTATGG + Intronic
1154302440 18:13206204-13206226 TCTAAATTTATTTATTTGGAGGG - Intergenic
1155076403 18:22360181-22360203 TCTGTATTTTATTCTGTGTCTGG + Intergenic
1155458255 18:26045267-26045289 TTTAGATTTTATTCTGTGGAAGG - Intronic
1155747024 18:29367598-29367620 ATTATATTTTATTATGTGAATGG + Intergenic
1156418304 18:36922288-36922310 TCTTCCTTTTATTTTGTGTATGG + Intronic
1156718292 18:40039167-40039189 TCTAAACTTTTTTTTTTGTATGG + Intergenic
1156754303 18:40502829-40502851 TCTAAATTTTTTTTAGTGTTCGG - Intergenic
1156936736 18:42718366-42718388 TTTAAATTTTATTTTGTGACAGG + Intergenic
1157236789 18:45972025-45972047 ACTAAATTTTAGAATGTGTATGG + Intergenic
1157639093 18:49194665-49194687 TCTAAAATTTATTCTGGGTGGGG + Intronic
1157803627 18:50641308-50641330 TCTCAGTTTTCTTATCTGTAGGG + Intronic
1157841648 18:50964829-50964851 TTTAAATTTTTTTATTTTTATGG - Intergenic
1158296331 18:56001011-56001033 TCTTAATTTTTTTAAGTGAAGGG + Intergenic
1158334757 18:56403945-56403967 TCTAAATTTTATGATGAACAGGG - Intergenic
1158577809 18:58654606-58654628 TTTAAATTATATTATGTTTTTGG + Intergenic
1158684320 18:59599257-59599279 TATAAATTATATTATGTGCCAGG + Intronic
1159063130 18:63538277-63538299 TCTAAAATTTATTGTGGTTATGG - Intergenic
1159204241 18:65229837-65229859 TCACATTTTTATTATTTGTATGG - Intergenic
1159220558 18:65458276-65458298 TCTATATTTTATGCTATGTATGG - Intergenic
1159271532 18:66159137-66159159 TCTAAATATCATTATATCTAAGG - Intergenic
1159281341 18:66290088-66290110 TCTTATTTTTATGATGTTTAAGG + Intergenic
1159301867 18:66583341-66583363 TTTAACTTTTATTTTGTGTTTGG + Intronic
1159512737 18:69416927-69416949 TTTAAATTTTTTTATGTTTATGG + Intronic
1159563510 18:70022011-70022033 TTTAAATTTTATTAAATTTATGG - Intronic
1160335690 18:78036832-78036854 TCAAAATTATATTATATGGAAGG - Intergenic
1163227012 19:15970159-15970181 TCTAGATTTTCTTTTGTGTGTGG - Intergenic
1165179844 19:33958081-33958103 ACTATTTTTTATTATGTGTGTGG - Intergenic
1165500953 19:36188855-36188877 TCTGAATTTTATTCTTTTTATGG - Intronic
1166314226 19:41979759-41979781 TCTAAAATTGACTATGTGGATGG + Intronic
1168375492 19:55875673-55875695 AGTAAATTTTAAAATGTGTATGG + Intronic
1168462558 19:56571423-56571445 TTTAAATTTTATTATTTTTATGG + Intronic
925404029 2:3594344-3594366 CCTTAATTTTATTATGTGTGTGG + Intergenic
925557674 2:5149888-5149910 TTTTAATATTATTATTTGTATGG + Intergenic
926535945 2:14112711-14112733 TCTAAATTTTATTTATTATATGG - Intergenic
926665004 2:15511915-15511937 TCTAACTTTTAGTATATGTTAGG - Intronic
926981964 2:18582412-18582434 TGTAAATTATTTTATGTGTGGGG + Intronic
927074301 2:19561775-19561797 GGTAAATTTTATAATTTGTATGG - Intergenic
927735583 2:25518162-25518184 TCTTAATTCTTTTAAGTGTACGG - Intronic
928145577 2:28771711-28771733 TCTCAAATTAATTTTGTGTATGG - Intronic
928583242 2:32729893-32729915 TCTAAATTTCATTAATTTTAGGG - Intronic
928757021 2:34538891-34538913 TCTAATCTTTATTATTTCTATGG + Intergenic
929278127 2:40047429-40047451 TCCAGATTTGATTATGTCTAAGG - Intergenic
930209847 2:48624416-48624438 TTTACATTTTATTGTATGTAAGG + Intronic
930500148 2:52204734-52204756 TCTAATTTTTATTCTATTTATGG + Intergenic
930707456 2:54518948-54518970 TCTAAATTTTATTATGTGTATGG + Intronic
930846493 2:55911030-55911052 TCTAATTTTTATTCTGGCTATGG - Intronic
931033306 2:58209166-58209188 TAAAAAGTTTATTATGTGTTTGG - Intronic
931120800 2:59217293-59217315 GCCAATTTTTATTATGTTTAAGG + Intergenic
931355186 2:61531351-61531373 TCTAAATTTTTTTGTTTGTAAGG - Intronic
931473054 2:62559068-62559090 TCTCAATTATTTTATATGTATGG + Intergenic
932633923 2:73371352-73371374 TCTGAATTTTATTGTGAGTGTGG + Intergenic
933384711 2:81595546-81595568 TATAGTTTTTATTATGTGAAAGG + Intergenic
934157013 2:89212335-89212357 TCAAACTTTTATTATATCTAGGG - Intergenic
934186395 2:89680868-89680890 TTTAATATTTATTATGTGTAAGG + Intergenic
934210302 2:89970411-89970433 TCAAACTTTTATTATATCTAGGG + Intergenic
934315621 2:91916360-91916382 TTTAACATTTATTATATGTAAGG - Intergenic
936073917 2:109389665-109389687 TTTAATTTCTATTTTGTGTATGG + Intronic
936725291 2:115307195-115307217 TATATATATTATTATGTGTCTGG - Intronic
936752442 2:115661450-115661472 TCTAAGTTTTGTTAGGTGAATGG + Intronic
936844905 2:116819348-116819370 TCTAACTTTAATAATGTGTTTGG - Intergenic
936847304 2:116852827-116852849 TCTAATCTTTATTTTGTGTGTGG + Intergenic
937549513 2:123069687-123069709 TATTAATTTTATTATGTTTGAGG + Intergenic
938175142 2:129119051-129119073 TCTAAATTTTAATAGCTTTAAGG + Intergenic
938222571 2:129582778-129582800 TCTAAATTGTATTAATTGCATGG + Intergenic
938286546 2:130122260-130122282 TATAAATACTTTTATGTGTAAGG + Intronic
938876640 2:135538115-135538137 TCTAAGTTATATGATATGTATGG + Intronic
939056276 2:137368430-137368452 TGAAAATTATATTATGAGTAAGG + Intronic
939657385 2:144845188-144845210 GCTAACATTTATTATGTGTCAGG + Intergenic
939747269 2:145990686-145990708 TCCAAATATTATTATGTGCGTGG + Intergenic
939932294 2:148250555-148250577 TCTAAATTTCATAATCTCTATGG - Intronic
940204152 2:151184098-151184120 TCTAAATTATATTCAGTTTAGGG - Intergenic
940714318 2:157202308-157202330 TTTAAAATTTTTTATGTGTCTGG - Intergenic
941146382 2:161851651-161851673 TATAAATTTTATTATAAGAAAGG + Intronic
941189854 2:162368019-162368041 TCAAATTTTTAGTGTGTGTAAGG + Intronic
941606219 2:167600455-167600477 TCTAAATTTGATTGTGTTGATGG - Intergenic
942387091 2:175453911-175453933 TCTAAAGATTCTTATCTGTATGG - Intergenic
942820997 2:180115148-180115170 GCTGAATTTTATAATGTCTATGG + Intergenic
942937869 2:181579881-181579903 ACTAAATTTTTGTATGTGTTTGG + Intronic
943190380 2:184670646-184670668 TCAATATTTTCTTATTTGTATGG + Intronic
943783328 2:191848525-191848547 ACTAAATTTTATTAAATATAAGG - Intergenic
943849689 2:192702350-192702372 GCTAAATATAATTATGTGGAGGG + Intergenic
944425145 2:199573549-199573571 AGAAAATTTTATTATGTGGAAGG - Intergenic
944602599 2:201319087-201319109 TTTAAATTTTTTTATTTCTATGG - Intronic
945018411 2:205545501-205545523 TCTTAATCTTATGATGTGTCTGG + Intronic
945092724 2:206190948-206190970 TCTAACTTGTATAATCTGTATGG + Intronic
946043209 2:216800279-216800301 TATAAATTATCTTGTGTGTAAGG - Intergenic
946992944 2:225356132-225356154 TCTATAATTTAGTATGTGGATGG + Intergenic
947057537 2:226123483-226123505 TTTAAATTTTATTGTGTGGCTGG - Intergenic
947121199 2:226817001-226817023 TATACATTTTCTTATGTTTAAGG - Intergenic
947125761 2:226866644-226866666 TCTAAATATTAGAATGTGAAGGG + Intronic
948956060 2:241292514-241292536 TCTAATATTTATTCTGTGTTTGG - Intronic
1169453114 20:5729088-5729110 ACTAATTTTTTTTATTTGTAAGG + Intergenic
1172813177 20:37665679-37665701 TCTATTTTTTATTTTTTGTAGGG + Intergenic
1173913707 20:46690039-46690061 TCTCAATTTTCTTTTCTGTAAGG - Intergenic
1174726343 20:52866367-52866389 TCTAAATTTTGTTAATTTTAGGG - Intergenic
1174921766 20:54710786-54710808 TCTTAATTTTAATCTGTTTAAGG + Intergenic
1174942682 20:54947970-54947992 TTTACATTTTATTATGGGAAGGG + Intergenic
1174967690 20:55237296-55237318 TCAAAATCTAAATATGTGTAAGG + Intergenic
1175078505 20:56396849-56396871 TCCAAATTTTAATATTTTTAGGG - Intronic
1175370888 20:58489957-58489979 TCTGAATTTTATTGTGTTTGTGG - Intronic
1175565816 20:59975972-59975994 TTTCAATTTTTTTCTGTGTATGG + Intronic
1177418050 21:20819724-20819746 TCTTAATTTTTTTATTTTTAGGG - Intergenic
1178054760 21:28785739-28785761 TTTGAATTTGTTTATGTGTAGGG - Intergenic
1178105225 21:29310992-29311014 GCAAAATTTTATTATGTGCGTGG + Intronic
1178702148 21:34842761-34842783 TCTGTATGTTTTTATGTGTATGG - Intronic
1179306256 21:40156051-40156073 TATAAATTATATTATATATAGGG - Intronic
1179578762 21:42324725-42324747 TCCACATTTTCTTATGTGTATGG - Intergenic
1180542392 22:16462247-16462269 TTTAACATTTATTATGTGTAAGG - Intergenic
1181997697 22:26895885-26895907 TTTAAATTTGATTTAGTGTATGG + Intergenic
1182440063 22:30357821-30357843 TTTAAATTTTTTTTTTTGTAGGG + Intronic
1182783636 22:32888244-32888266 TCTAGATGTTATTATTTTTAAGG + Intronic
1185096829 22:48812503-48812525 ACTAAATATTATTTTGTATACGG + Intronic
950161721 3:10765395-10765417 TCCAAGTTTTGTTATCTGTAAGG + Intergenic
950345876 3:12292617-12292639 TTTAAAATTTATTATTTGGATGG - Intronic
950372392 3:12542157-12542179 TCTAAATCTCATTAGGTGGATGG - Intronic
950826854 3:15832334-15832356 TTTAAAATTCCTTATGTGTAGGG + Intronic
951266638 3:20575663-20575685 TCCAACTTTGAATATGTGTAAGG + Intergenic
951391807 3:22113970-22113992 TCTCAATTTAATTATGTTAAAGG - Intronic
951830704 3:26923581-26923603 TCTAAATTTGTATAAGTGTAAGG + Intergenic
951944246 3:28116135-28116157 TCTAAATTATATAATGAGTCTGG + Intergenic
954229218 3:49203408-49203430 TCTGGCTTTTATTTTGTGTAGGG + Intronic
954695285 3:52421250-52421272 TCTAAATCTTATCATGTGTGAGG - Intronic
956461167 3:69474000-69474022 TCTAATTTTTGTATTGTGTAGGG - Intronic
956494067 3:69805594-69805616 TCTAATATTTAATATGTGCATGG + Intronic
956555939 3:70522481-70522503 TCTAGGTTTTATTGTGTGTTAGG + Intergenic
956967622 3:74480641-74480663 TCTATATTTTTTTATTTTTAAGG - Intronic
957137641 3:76309721-76309743 TCTACATGTTAGTATATGTATGG - Intronic
957240315 3:77652333-77652355 ACTAGATTTTATGATGGGTATGG - Intergenic
957482768 3:80819826-80819848 TTTAAATTTTGTTATCTGTGGGG + Intergenic
958463624 3:94430146-94430168 ACTAAAATTTATTATCTGGAGGG - Intergenic
958633820 3:96716197-96716219 TTTTGATTTTATTTTGTGTATGG - Intergenic
959218808 3:103487898-103487920 TAAATATTTTATTATTTGTATGG + Intergenic
960526369 3:118715551-118715573 TCTAAATTTCCTTGTGTATATGG + Intergenic
960654942 3:119992656-119992678 TGTAATTTTTACTTTGTGTATGG - Intronic
960885850 3:122393789-122393811 TCTAGAATGTAATATGTGTAAGG + Intronic
961762526 3:129182488-129182510 TGTTGATTTTATTATGGGTAAGG - Intronic
962097988 3:132311916-132311938 CATAAAATTTATCATGTGTAAGG - Intergenic
962948074 3:140190738-140190760 TACAATTTTTTTTATGTGTATGG + Intronic
963836720 3:150065335-150065357 TCTAAATTTTGTTCTTTATAGGG + Intergenic
963997304 3:151724907-151724929 TGTAAATTTTATTATAATTATGG + Intergenic
964366314 3:155954269-155954291 TCTAAATTTTATTTTAGGTTTGG + Intergenic
964416723 3:156455561-156455583 TTTACATTTTTTTATCTGTAAGG + Intronic
964829423 3:160867004-160867026 GCTAATTTTTATTTTTTGTAGGG + Intronic
964899300 3:161638566-161638588 ACTAAAATTTATTATGTGGCTGG + Intergenic
964976880 3:162632694-162632716 TTTGATTTTTATTATCTGTAAGG + Intergenic
965068162 3:163879232-163879254 TTTAAATTTTATTATATTGATGG + Intergenic
965078474 3:164007630-164007652 TCTAATTTTTACTTTGTTTAGGG + Intergenic
965351158 3:167613186-167613208 TTTAAATTTTCTTGTGTGTGTGG - Intronic
965982305 3:174707955-174707977 ACTAAATATTAGTATGTTTATGG - Intronic
966124055 3:176554802-176554824 TCTCAATGTTCTTCTGTGTAAGG + Intergenic
966277652 3:178194895-178194917 TCTAAATTTTATTTGCTGTCTGG - Intergenic
966481563 3:180414581-180414603 TCTAGAGTTTGTTATCTGTAAGG - Intergenic
967449380 3:189606002-189606024 TTTAAATTTTCTATTGTGTATGG - Intergenic
967587908 3:191236910-191236932 TCCACATTTTATTATGTTTTCGG + Intronic
970882327 4:20946681-20946703 TCAAATTCTTATTATGTGTCAGG + Intronic
970959473 4:21856230-21856252 TCTATATCTTATTAGATGTAGGG + Intronic
971499867 4:27307120-27307142 TGAATATTTTATTATATGTATGG + Intergenic
972062589 4:34895794-34895816 TCTTCATTTTATTCTGTTTATGG - Intergenic
972669229 4:41197881-41197903 TTTGCATTTTATTAAGTGTAGGG - Intronic
972691247 4:41400532-41400554 TCTCTCTCTTATTATGTGTAGGG + Intronic
973192107 4:47397413-47397435 TCTAAATTTTCCTATGTATTTGG + Intronic
973282286 4:48372111-48372133 TGTAAATTATATTATTTCTAAGG - Intronic
975246748 4:72129208-72129230 AATAAGATTTATTATGTGTAGGG + Intronic
975431562 4:74297583-74297605 TATTAATCCTATTATGTGTAGGG - Intronic
975444687 4:74448903-74448925 TCTAACTTTTATATTGTGTTAGG + Intronic
975885017 4:78954601-78954623 TCTAAGTTTAATTTTTTGTAAGG - Intergenic
976055138 4:81055783-81055805 TGTAAATTTTATTATGTAGTGGG - Exonic
976110580 4:81669063-81669085 TCTATGTTCTATTATGAGTAGGG + Intronic
976190796 4:82484826-82484848 TCCAAATGTGAATATGTGTAGGG - Exonic
976521228 4:86029868-86029890 ACTAAATTTTTTAATGTGTTTGG - Intronic
977061881 4:92269992-92270014 TCAAAATATTGTTATGTGTTTGG - Intergenic
977081356 4:92532738-92532760 TCTACATTTCATGATGTCTAGGG + Intronic
977947865 4:102934457-102934479 TTTAACATTTATTATGTGTAAGG - Intronic
978057411 4:104288970-104288992 TCAAAATTTTTTTGTGTGTATGG - Intergenic
978615436 4:110589052-110589074 TCTAATTTTTCTTAGGTATATGG + Intergenic
978823776 4:112995749-112995771 TCTCAATTTCATTTTGTGTATGG + Intronic
978974704 4:114855433-114855455 TTTTAATTTTATTTTGTGTACGG + Intronic
979089248 4:116458791-116458813 TATAAATTTTATAATATGTTTGG - Intergenic
979182151 4:117743517-117743539 ACTAAATTTTATTATCTTGATGG + Intergenic
979680322 4:123452527-123452549 TCTAAATCTTATCATGGGTTAGG + Intergenic
980032519 4:127846483-127846505 TCTATAATGTATTTTGTGTAGGG - Intergenic
980498569 4:133617430-133617452 TATAAATTCTAGTAAGTGTAGGG - Intergenic
980833727 4:138163661-138163683 TATATATTTTATTTTGTGGATGG - Intergenic
980905148 4:138941050-138941072 TCTAATTTTTGTGATGTTTATGG - Intergenic
980965802 4:139519665-139519687 TCTGACTTATATTACGTGTATGG - Intronic
981397937 4:144276137-144276159 TTTAAATTTTACTATCTGAAGGG - Intergenic
981657892 4:147132650-147132672 ACTCAATTTTACTATCTGTAAGG + Intergenic
981731119 4:147899832-147899854 CCTACATTTTATTATGAGAAGGG - Intronic
981776535 4:148374633-148374655 CCTAAATTTTCATTTGTGTAAGG + Intronic
981846978 4:149180815-149180837 TCTGAAGTTAATTTTGTGTAAGG - Intergenic
982141213 4:152320570-152320592 TCTAAATTTTATGATGTAAGGGG - Intergenic
982863077 4:160478808-160478830 TCATAATTTGATTTTGTGTATGG - Intergenic
982978375 4:162097670-162097692 TATAAATTTTCTTTTGTGAAGGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984310044 4:178046426-178046448 TCTCAATTATATTATGAGGATGG - Intergenic
984405373 4:179322407-179322429 TCTAGATTTTATCCTTTGTATGG - Intergenic
985921083 5:2975101-2975123 TTAACATTTTATTATGTATATGG + Intergenic
987015887 5:13819024-13819046 TCTAAATTATGTAATCTGTATGG - Intronic
987482972 5:18482432-18482454 TATAAATTTTAGTATATTTAAGG - Intergenic
987595486 5:19992146-19992168 TCTAATTATTATTATGAGTAAGG - Intronic
988126766 5:27049825-27049847 ACTAAATTTCCTTATCTGTAGGG - Intronic
990101479 5:52195005-52195027 TCTAAATTTTAAAATATGAAAGG - Intergenic
990626331 5:57615990-57616012 TCTAAACAATATTATGTCTATGG - Intergenic
990842340 5:60096392-60096414 TTAAAATTCTATTATGTATAAGG - Intronic
991563067 5:67974898-67974920 TCTAAAGTTTATAAAGTGCAAGG - Intergenic
991582372 5:68169649-68169671 TCTCACTTTTCTTATGTTTAAGG + Intergenic
992301764 5:75389325-75389347 TCTAAATTTTATTTTCTTCATGG + Intronic
992537422 5:77722283-77722305 TCTAACTTGTATTATGTATGAGG + Intronic
992742540 5:79788715-79788737 TCTGAATTTTTTTAAGTGTCTGG + Intronic
993049215 5:82906977-82906999 TCTATATTTTATCATGAGAAAGG + Intergenic
993163093 5:84314915-84314937 TTTGAATTTTATTATTTTTATGG + Intronic
993652749 5:90542014-90542036 TCTAAGATTTATGATGTGGATGG + Intronic
993869721 5:93238154-93238176 TTTAAAATTTATTATATGTGTGG - Intergenic
994042083 5:95270426-95270448 TGTAACATTTATTATGTATAAGG - Intronic
994110172 5:95993651-95993673 TTAAAATTTTATTTTGTGAAAGG + Intergenic
994511317 5:100707760-100707782 TCCAAATTTTATTTTCAGTATGG - Intergenic
994587743 5:101731515-101731537 TCATAATTTTATTATATTTATGG - Intergenic
995142171 5:108747623-108747645 TTTATGTTTTTTTATGTGTAGGG + Intergenic
995259657 5:110087648-110087670 CTTAAATTATATTATGTGGATGG + Intergenic
995694108 5:114860484-114860506 TCTTAATTTTAGGATGGGTATGG - Intergenic
995885614 5:116891002-116891024 TCTAATTTTTATTATTTTTGTGG + Intergenic
995997254 5:118316651-118316673 TTTAAATTTTTTTAATTGTAAGG + Intergenic
996081388 5:119261891-119261913 TCTAAATTTTAGAATCTCTATGG - Intergenic
996775053 5:127123642-127123664 TATAATTTCTATAATGTGTAAGG - Intergenic
997221230 5:132167017-132167039 TATATATTTAATAATGTGTAAGG - Intergenic
997231739 5:132250363-132250385 TCTAACTTTTATCGTGTGAATGG + Intronic
997342441 5:133155359-133155381 TGTAAATGTGATTATGGGTAAGG + Intergenic
997559808 5:134836507-134836529 TTAAAATTTTACTTTGTGTAAGG + Intronic
998705955 5:144760866-144760888 TTTCCATTTAATTATGTGTAGGG - Intergenic
999511131 5:152253059-152253081 TTTAAATTTTATTATTATTATGG + Intergenic
999578509 5:153007769-153007791 TTTACATTCTATTATATGTATGG + Intergenic
999619668 5:153459896-153459918 TTTATACTTTAATATGTGTATGG - Intergenic
999694562 5:154177469-154177491 TCTAAAATTGATTATGTTGATGG + Intronic
999945312 5:156589489-156589511 TCATAAGTTTAATATGTGTACGG - Intronic
1000252623 5:159510097-159510119 TTTAAATTTGACTATGGGTATGG + Intergenic
1001657984 5:173368301-173368323 TGTAAATTTGGTTATGTATAAGG - Intergenic
1002436821 5:179236624-179236646 GCTAATTTTTTTTATGTGTATGG - Intronic
1002798685 6:499561-499583 TGTAAATTTGATTATTTCTATGG - Intronic
1004779097 6:18885825-18885847 TCTCAATTTCATTATGTATAAGG - Intergenic
1005279460 6:24257646-24257668 TCTAAAATGTTTTATATGTAGGG + Intronic
1008260611 6:49361944-49361966 TCTAGAAATTATTATGTATAAGG - Intergenic
1009331623 6:62428873-62428895 TGTAAATTTTATTATATTAAAGG + Intergenic
1009611092 6:65942149-65942171 GCTAATTTTTATTATTTATAGGG - Intergenic
1009682196 6:66910303-66910325 TCCAACTTTTATTAGGTTTAAGG + Intergenic
1010115637 6:72305943-72305965 TCCAAATTTTATTATCTCTTGGG + Intronic
1010519893 6:76819125-76819147 TCTAAATATTATTTTGTATATGG + Intergenic
1010879845 6:81153847-81153869 CCTAGATTTTAGTAGGTGTATGG - Intergenic
1010906986 6:81502808-81502830 TCTAATATTTAGTATCTGTAAGG + Intronic
1011665791 6:89631853-89631875 TCTACATTTTATAATGAATAAGG + Intronic
1011667389 6:89647786-89647808 GCTAATTTTTATTTTTTGTAGGG - Intronic
1011722618 6:90174642-90174664 CCTACATTTTATCATGTATATGG - Intronic
1011806501 6:91078628-91078650 TATAGTATTTATTATGTGTATGG - Intergenic
1011873755 6:91929754-91929776 TCTTATTTTTATTATTTGTTAGG - Intergenic
1012080069 6:94746128-94746150 AGTAAATTTTATTTTGTGTTTGG - Intergenic
1012324401 6:97897394-97897416 TCTACATTTTATTTGCTGTAGGG + Intergenic
1012418373 6:99035019-99035041 TCTAAAATATATTTTGTTTAAGG + Intergenic
1012579934 6:100855028-100855050 TTTAAATTTTCTTATATTTAAGG + Intronic
1012616104 6:101282057-101282079 TCTAAATGTTAGTATGTCTGGGG - Intergenic
1012762085 6:103315432-103315454 TTTAATTTTTATTAGGTGTAAGG + Intergenic
1013380515 6:109565308-109565330 GCTAATTTTTATTTTTTGTAGGG - Intronic
1013787548 6:113798651-113798673 TAGAAATTTTGTTTTGTGTAAGG + Intergenic
1014164672 6:118210204-118210226 TCTAATTTTAATTATGAGGAGGG - Intronic
1014273165 6:119356811-119356833 TCTAAAATTTACTATGGGGATGG + Intergenic
1014284813 6:119485102-119485124 GGCAAATTTTATTATATGTAAGG - Intergenic
1014436143 6:121422997-121423019 TATAAAATTGATTTTGTGTATGG - Intergenic
1014559936 6:122877339-122877361 GCTAATTTTTACTATTTGTAAGG + Intergenic
1014628116 6:123754371-123754393 TAAAATTTTTGTTATGTGTAAGG - Intergenic
1015068693 6:129062315-129062337 TCTAAAGCTTATTATGGGCAGGG + Intronic
1015800544 6:137057857-137057879 TATAAGTCTTGTTATGTGTAAGG - Intergenic
1016716551 6:147238599-147238621 ACTAAATATTATTATTTATAGGG - Intronic
1017428392 6:154345794-154345816 TCTAAAATATATAATGTGTTAGG + Intronic
1019008487 6:168823445-168823467 TCAATATTTTACTATGTGTCTGG + Intergenic
1020160964 7:5771245-5771267 TCTAAAATTGTTTTTGTGTAAGG - Intronic
1020694726 7:11399339-11399361 TCTAAACTTTATTTTATTTATGG + Intronic
1020767819 7:12347473-12347495 ACTACATTTTAGTATCTGTAAGG - Intronic
1021118742 7:16773097-16773119 TCTGAATTTTTTTGTGTGTCAGG + Intronic
1021385354 7:20022961-20022983 AGGAAATTTGATTATGTGTAAGG + Intergenic
1022556390 7:31302330-31302352 TTTAAATTTTAGCATGGGTAGGG - Intergenic
1022890342 7:34690200-34690222 TCTATAGTTTATGTTGTGTAAGG - Intronic
1023271368 7:38466732-38466754 TCTAGTTATTATTATGTGTTTGG + Intronic
1023578649 7:41657675-41657697 TCTACATTTTATTGTGGGGAGGG + Intergenic
1024249768 7:47497120-47497142 TCTAAATTTTCTTCTGAGAATGG - Intronic
1024349156 7:48345778-48345800 TATAAAGTTTATAAAGTGTACGG + Intronic
1024935774 7:54710682-54710704 TCTAAATTTTATTTACTATATGG - Intergenic
1025784789 7:64634444-64634466 TCTAATTTTTTCTTTGTGTAGGG - Intergenic
1026425174 7:70284417-70284439 TCTTCATGTTATTATGTGTTGGG + Intronic
1027512509 7:79100828-79100850 ATTAAATTTTATTCTGTCTATGG + Intronic
1027569253 7:79843072-79843094 TCTAAATTTGATTATAAGTTAGG - Intergenic
1027760653 7:82274957-82274979 GCCAAATTTTATTATCTGCAAGG + Intronic
1028249442 7:88523779-88523801 TCAAAATCTCACTATGTGTAAGG + Intergenic
1028650402 7:93144578-93144600 CCTAAAATTTATTATCTGTAGGG - Intronic
1029236186 7:99121362-99121384 TCTTAATTTTATTTTGGGAATGG - Intronic
1029839958 7:103351720-103351742 TTTAAATTTTATTAAGTTTGTGG - Intronic
1030231742 7:107215002-107215024 TCAAAATATTAAAATGTGTAGGG + Intronic
1030878100 7:114841199-114841221 TCAAAATATTATGTTGTGTATGG - Intergenic
1030947595 7:115743400-115743422 TGTAAATTTTATTTTTTGTATGG - Intergenic
1030958065 7:115879862-115879884 TCAGAATGTTATTATGTGTATGG + Intergenic
1031174533 7:118333182-118333204 TCTAAATTTTATTGTGTAGTTGG - Intergenic
1031324342 7:120373750-120373772 TTAAAAATTTATTTTGTGTATGG + Intronic
1031601723 7:123718141-123718163 TCTAAATTTTGTGAAGTTTATGG + Intronic
1031735030 7:125348203-125348225 TCTAAATATTATTATTTTTTAGG - Intergenic
1031768345 7:125809472-125809494 TGGAATTCTTATTATGTGTATGG - Intergenic
1034655726 7:152728240-152728262 TCTGGAGTTTAGTATGTGTAAGG + Intergenic
1036488140 8:9198684-9198706 TCTAAATTTTCTTGTAGGTAAGG - Intergenic
1037103906 8:15081173-15081195 ACTAAATTTTTTTAGGTCTATGG + Intronic
1037735954 8:21566316-21566338 TCTAAAGTATTTTATGAGTATGG + Intergenic
1038698457 8:29827381-29827403 TCTTATTTTTATTTTTTGTAGGG - Intergenic
1038921505 8:32090331-32090353 ACTAAATTTTAATATGTCTTAGG + Intronic
1039305825 8:36261324-36261346 ACTAAATTTTCTTATTTATATGG - Intergenic
1039634539 8:39148804-39148826 TATAAATTTTATTATAAATAAGG - Intronic
1040655447 8:49502347-49502369 TCTTAATTTTAGTATATTTAAGG - Intergenic
1040811325 8:51456894-51456916 AATAAGTTTTATGATGTGTAAGG - Intronic
1040849435 8:51883556-51883578 TATAAATATTATTAAGTATAAGG + Intronic
1040905430 8:52464988-52465010 GCAAAGTTTTATTTTGTGTAAGG - Intergenic
1040954687 8:52968081-52968103 TCTATATTTTATTAACTGTCAGG - Intergenic
1041112853 8:54502962-54502984 TCTTACTTTTATGATGTGTTAGG + Intergenic
1042239752 8:66651216-66651238 TCTCACTTAAATTATGTGTATGG - Intronic
1042485423 8:69341391-69341413 TTTAAAATTAATTATGAGTAAGG - Intergenic
1043167648 8:76924392-76924414 ACTTAATTTTATGATGTGTCTGG - Intergenic
1043723673 8:83580849-83580871 TCTAAAATTATTAATGTGTATGG - Intergenic
1043760917 8:84066952-84066974 TGTAAATGTTTTTATTTGTAAGG + Intergenic
1043873363 8:85459796-85459818 TCTGAATGCTATTATGTGTCAGG - Intergenic
1044042144 8:87383949-87383971 TCTAAATTTTATTGTTTGCCAGG + Intronic
1044491004 8:92814864-92814886 TGAAAGTTTTATTCTGTGTAAGG - Intergenic
1044599601 8:93990726-93990748 ATTAAATTTCATTATGTGTCAGG + Intergenic
1044769160 8:95611191-95611213 TCTAACTTTTATTTTGGGTTGGG + Intergenic
1045990487 8:108300743-108300765 TATTAATGTAATTATGTGTATGG + Intronic
1046549289 8:115693124-115693146 TCAAAATGTTTTTATATGTATGG - Intronic
1046885203 8:119359262-119359284 TTTAAATTTTTTTAAATGTAGGG + Intergenic
1047047594 8:121072356-121072378 TCTAACTTTAATTACGTGTCTGG - Intergenic
1047720468 8:127634462-127634484 TTTAAATTTTTTTATATTTAGGG + Intergenic
1049019942 8:139949268-139949290 TCTCAATTTTATTATATCTAAGG - Intronic
1050133045 9:2432591-2432613 TCTAAAATTTATTATGATGATGG - Intergenic
1050204792 9:3184949-3184971 TGTAAATTTTTTTATGTGTATGG - Intergenic
1050895604 9:10882706-10882728 TGTAAATTTTATTATTTATATGG + Intergenic
1051139791 9:13965977-13965999 TCTCAATTTTCTTATCTGAATGG - Intergenic
1051848044 9:21475068-21475090 TCTATATTTTATTTTGTGTAAGG + Intergenic
1052502540 9:29310446-29310468 TCTAAAAAGTATTATATGTATGG + Intergenic
1052812187 9:33071231-33071253 CCTAAACCTTATTATCTGTATGG - Intronic
1052948817 9:34191180-34191202 TCAAAGTTTTAGTGTGTGTATGG + Intronic
1054904676 9:70404185-70404207 TCTAACATTTATTATATGTCAGG - Intronic
1055047140 9:71939802-71939824 TCAAAAATTAAGTATGTGTAAGG - Intronic
1055267467 9:74512860-74512882 TTCAAATATTATTATGTGCATGG + Intronic
1056160819 9:83890836-83890858 TATAAATTTTAGTTTGTGTGTGG - Intronic
1056931173 9:90879019-90879041 TCTTTATTTTATTATTGGTATGG + Intronic
1057082835 9:92185675-92185697 CATATATTTAATTATGTGTAGGG - Intergenic
1058150091 9:101454088-101454110 ACTAAATTGCATTATATGTAGGG + Intergenic
1058472562 9:105295992-105296014 TCAAAATTTTAGTACGTATAAGG + Intronic
1058558477 9:106197807-106197829 TCTTAAATTAATTTTGTGTATGG + Intergenic
1059542029 9:115140250-115140272 GCAAAATTTTAATAAGTGTATGG - Intergenic
1059858051 9:118423340-118423362 ACTAAATTTTTTTATATGCATGG + Intergenic
1061689403 9:132313859-132313881 TCTAAATGTTCTTATGTTCAGGG - Intronic
1186701918 X:12099608-12099630 TATAAATTTTATAATGAGCATGG + Intergenic
1187041022 X:15595991-15596013 TTTATATTTTGTTATGTATAGGG + Intronic
1187225352 X:17371000-17371022 TGTAAATATATTTATGTGTATGG + Intergenic
1187534505 X:20127183-20127205 GATATATTTTATTATGTGAATGG - Exonic
1187629035 X:21147878-21147900 TTTTAATTTTAGTATGTCTAAGG - Intergenic
1188357418 X:29209285-29209307 TATAAATTTTTTTATTTGAATGG + Intronic
1188364138 X:29294006-29294028 TCTAAATCTAATTTTGTGTGTGG + Intronic
1188412190 X:29886704-29886726 TCTAAATTGTATTCTGTGAATGG - Intronic
1188546739 X:31315685-31315707 GCTAAAATTTAATGTGTGTATGG - Intronic
1188557116 X:31425163-31425185 TCTAAATTTCATTACCTGAAGGG + Intronic
1188859330 X:35238209-35238231 TTTAACTTTAATTATGTTTAGGG - Intergenic
1188914622 X:35894821-35894843 TCTTAATATAATTATGTGTTAGG - Intergenic
1189589906 X:42499813-42499835 GCTATATTTTATTTTGGGTAGGG - Intergenic
1189895452 X:45651003-45651025 TCTACATTTTCTTGTGTGTATGG - Intergenic
1190025871 X:46922362-46922384 TCTAAACTTTATTATATCTGTGG + Intronic
1190371434 X:49745908-49745930 TCTCTAATTTATTTTGTGTATGG - Intergenic
1190914282 X:54798728-54798750 TGTAAGTCTTATTATGTCTATGG - Intergenic
1191137216 X:57078200-57078222 TTTAAATTTTTTTATTTTTATGG + Intergenic
1191210471 X:57879455-57879477 TTTAAATTTTTTTTTGTATATGG - Intergenic
1191895824 X:65992181-65992203 TCTAATTTTTAGTATGTATGTGG - Intergenic
1192104568 X:68301830-68301852 ACTACATTCTATAATGTGTAAGG - Intronic
1192108985 X:68344704-68344726 TTTAATTTTTATTTTTTGTAGGG - Intronic
1193138294 X:77997834-77997856 TTTAAATTTTAATATGTCTGTGG - Intronic
1193842579 X:86425686-86425708 TCTAACCTTTATTATATTTAAGG + Intronic
1194137617 X:90165843-90165865 TCTTGAGTTGATTATGTGTATGG - Intergenic
1194494851 X:94601831-94601853 TTTAAATTTTTTAATGTGTCTGG + Intergenic
1194652840 X:96535957-96535979 TCTAAATTTTATTTGATGGATGG - Intergenic
1194878272 X:99217788-99217810 TTTAATTTTTAGAATGTGTAGGG + Intergenic
1195345523 X:103946733-103946755 TCTGGATTTTATTTTGTATAAGG - Intronic
1195362082 X:104092722-104092744 TCTAGATTTTATTTTATATAAGG + Intergenic
1195837163 X:109129497-109129519 TTTAAGTATTATAATGTGTAAGG + Intergenic
1195852894 X:109302455-109302477 GCAAAATTCTATGATGTGTAGGG + Intergenic
1196998312 X:121408291-121408313 TTTAAATTTTATTTTATGTCAGG + Intergenic
1197961807 X:132014979-132015001 ACTGCATTTTATTATGTGTTTGG - Intergenic
1198672777 X:139099217-139099239 TCTAACTTTTATTCTATGTGAGG - Intronic
1198739982 X:139831940-139831962 TTTAAATTTTGTTAAGTGTTTGG - Intronic
1200483402 Y:3736098-3736120 TCTTGAGTTGATTATGTGTATGG - Intergenic
1201183286 Y:11371180-11371202 TTTAACATTTATTTTGTGTAAGG - Intergenic