ID: 930708361

View in Genome Browser
Species Human (GRCh38)
Location 2:54526290-54526312
Sequence CTGCTCACTCTTATCCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930708357_930708361 26 Left 930708357 2:54526241-54526263 CCAGCATTGCTCCAGAAGACCTA 0: 1
1: 1
2: 1
3: 8
4: 101
Right 930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 129
930708359_930708361 15 Left 930708359 2:54526252-54526274 CCAGAAGACCTATTCTTGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 84
Right 930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 129
930708360_930708361 7 Left 930708360 2:54526260-54526282 CCTATTCTTGGCAAGCACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 242
Right 930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930708361 Original CRISPR CTGCTCACTCTTATCCCAGT TGG Intronic