ID: 930708361

View in Genome Browser
Species Human (GRCh38)
Location 2:54526290-54526312
Sequence CTGCTCACTCTTATCCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930708357_930708361 26 Left 930708357 2:54526241-54526263 CCAGCATTGCTCCAGAAGACCTA 0: 1
1: 1
2: 1
3: 8
4: 101
Right 930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 129
930708359_930708361 15 Left 930708359 2:54526252-54526274 CCAGAAGACCTATTCTTGGCAAG 0: 1
1: 0
2: 0
3: 14
4: 84
Right 930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 129
930708360_930708361 7 Left 930708360 2:54526260-54526282 CCTATTCTTGGCAAGCACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 242
Right 930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930708361 Original CRISPR CTGCTCACTCTTATCCCAGT TGG Intronic
900836351 1:5007470-5007492 CTGCTCATTCATAACCCAGGAGG + Intergenic
904318711 1:29682663-29682685 CTGCTCCCTCTGACCCCACTGGG + Intergenic
905373324 1:37499417-37499439 CTGCTGACTGATATCTCAGTAGG - Intronic
909248456 1:73321336-73321358 CTTCTCACCCTTCCCCCAGTTGG + Intergenic
909696797 1:78476464-78476486 CTGCTCACTCTACTGCCAGAAGG - Intronic
917509252 1:175656581-175656603 GTGCTCTCTCCTATCCCAATTGG + Intronic
917628209 1:176867049-176867071 CTGCACACTCTCCTCCCAGGAGG - Intronic
920127218 1:203702966-203702988 CTGCTTTCTCTTATTCCAGGAGG + Intronic
1062768158 10:80835-80857 CTGCTCACTTGTGGCCCAGTGGG - Intergenic
1063150191 10:3329797-3329819 CTGCACATTTTTATTCCAGTGGG + Intergenic
1065349370 10:24781939-24781961 CTGTTCCCTCTTCTCCCAGAAGG + Intergenic
1068613972 10:59091356-59091378 CTACTCAATCCTAGCCCAGTTGG + Intergenic
1068684554 10:59856250-59856272 CAGCTCCCTCTTTTTCCAGTTGG + Intronic
1069261055 10:66397814-66397836 GTGATCAGTCTGATCCCAGTGGG - Intronic
1071150227 10:82625694-82625716 CTCCTCAATCTTATCTGAGTTGG + Intronic
1071503670 10:86220501-86220523 CTTCTCACTCTTCTTGCAGTGGG - Intronic
1073127847 10:101163037-101163059 CTGGTCACTCTTGGCCCAGGAGG - Intergenic
1076805024 10:132851183-132851205 CTGCTCACTCTGCTGCCCGTGGG + Exonic
1077240308 11:1507263-1507285 CTGATCACCCTTACCCCAGGAGG - Intergenic
1079191376 11:18279864-18279886 CTGCTGAATCTTCTCCCACTAGG + Exonic
1082895614 11:58187076-58187098 CTTCTAATTCTTTTCCCAGTAGG + Intergenic
1089677937 11:120102713-120102735 GTGCTCACTCTTGCCTCAGTGGG - Intergenic
1091126503 11:133104075-133104097 CTGCTCAGTCACAGCCCAGTGGG + Intronic
1091556768 12:1579828-1579850 CTGCTCATTCTAATCCCAGCTGG - Intronic
1091818691 12:3458400-3458422 CTCCTCACTCTTAACCCAAGTGG + Intronic
1092531721 12:9350621-9350643 CTTCTCACTCTTAACCCAAGTGG - Intergenic
1098322478 12:69259961-69259983 CTTATCACTCTTATCCCAAGTGG + Intronic
1100756690 12:97758986-97759008 CTTCTCATTAGTATCCCAGTAGG + Intergenic
1102575254 12:113852182-113852204 CTTCTCACTCTGATCTCTGTAGG + Intronic
1105827180 13:24133156-24133178 CTGCACAGTCTAATCCCACTGGG - Intronic
1106281292 13:28274519-28274541 CTCCTCATTCTTTTCTCAGTAGG + Intronic
1107173150 13:37367303-37367325 CTGCTCACTCTGCTCCCAGGAGG - Intergenic
1111367147 13:87263353-87263375 CTGCTCATTTTTACCCCACTGGG + Intergenic
1111455811 13:88482385-88482407 CTGTACACTCTTTTCCCAGAGGG - Intergenic
1113005364 13:105695874-105695896 ATACTCCCTCTTATCCTAGTGGG - Intergenic
1117132847 14:52703449-52703471 CTGCTCACTCATATGGCTGTTGG + Intergenic
1117218197 14:53573866-53573888 CTGCTCCCTCTTATTCAAGGAGG + Intergenic
1128887551 15:71302660-71302682 CTGCCCATGCTTAGCCCAGTGGG + Intronic
1131771722 15:95745205-95745227 CTGCTCCCTCTCATCTCAATGGG + Intergenic
1133102811 16:3489490-3489512 CTGCTGACTCCTGTCCCAGCTGG - Intergenic
1137448761 16:48550949-48550971 CAGCTTACTCCTATCACAGTAGG + Intronic
1137725756 16:50655502-50655524 CCCCTCACAGTTATCCCAGTGGG - Intergenic
1138183622 16:54960011-54960033 CTGCTTACTCTTTTCCCATTGGG - Intergenic
1140647262 16:77046124-77046146 CTGCTAAGTCGTTTCCCAGTTGG + Intergenic
1141942457 16:87286550-87286572 CTGCTCATTCTGATCCAAGCAGG + Intronic
1142612196 17:1115200-1115222 CTGCTCACTCTATGCCCAGCAGG + Intronic
1144362282 17:14506939-14506961 CTGATCACTCTTATCCAAAGTGG - Intergenic
1146762092 17:35487742-35487764 CTGCGCACTCTTCACCAAGTAGG + Exonic
1151514548 17:74584248-74584270 CTGCAAACTCTTTTCCCAGGTGG + Intronic
1151687953 17:75660672-75660694 CTGTTCACTCACATCTCAGTAGG - Intronic
1151903560 17:77033568-77033590 CTGCTCTATCTGTTCCCAGTGGG - Intergenic
1154177806 18:12097406-12097428 CTGCTATGTCATATCCCAGTGGG + Intronic
1156705016 18:39870773-39870795 CTGCTCACTCTGATCCCATTGGG + Intergenic
1157484176 18:48075333-48075355 CTGCTCATTCTTATCCAAAGAGG + Intronic
1158855717 18:61541913-61541935 CTGCTCTCTGTTCTCCCAGCAGG - Intronic
1162146678 19:8616620-8616642 GGGCTGACTCTTTTCCCAGTGGG + Intergenic
1162259148 19:9518379-9518401 CTTCTCAATGTCATCCCAGTTGG - Intergenic
1164531025 19:29048340-29048362 CTGCTCACTCGTACCCCAAGCGG - Intergenic
1164873588 19:31667508-31667530 CCACTCACTCTTATCTCATTAGG - Intergenic
1165867236 19:38946250-38946272 CTGCCCACCCTCATCCCAGCAGG - Intronic
928102085 2:28444687-28444709 CTGCTCACTCTTCTCAGTGTTGG - Intergenic
930546938 2:52780032-52780054 ATGCTCACTTTTATCCATGTAGG - Intergenic
930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG + Intronic
934131934 2:88956596-88956618 ATGCTCACTGTCATCCAAGTGGG + Intergenic
934133451 2:88971248-88971270 ATGCTCACTGTCATCCAAGTGGG + Intergenic
936013974 2:108943944-108943966 CTGCTCACTCATTTCTCAGAGGG + Intronic
939429315 2:142082547-142082569 CTGCTGACTCGTGTCCCAGGTGG + Intronic
946691885 2:222315442-222315464 CTGGCCACTCTATTCCCAGTGGG - Intergenic
947907397 2:233775417-233775439 CTTCTCACTCCTGTCCCTGTTGG + Intergenic
948595987 2:239079537-239079559 CTGCTCACTCTTCTCTAACTGGG - Intronic
1169810609 20:9605621-9605643 CTCTTCACTTTTAACCCAGTGGG - Intronic
1172509555 20:35490924-35490946 CTGCTCACTGTTAGCAAAGTGGG - Intronic
1172939048 20:38642167-38642189 CTGCATACTCTAATCCCACTTGG - Intronic
1173012322 20:39193296-39193318 TTGCTCCCTCTTATCCAAGGGGG + Intergenic
1175838868 20:62014275-62014297 CTGCTCACTTTGACCCCACTCGG + Intronic
1178380829 21:32106519-32106541 CTGCTCACTCTGTCCCCAGATGG - Intergenic
1179355639 21:40656132-40656154 CTGCTCAGTCCTATCACATTGGG + Intronic
1183381197 22:37491393-37491415 CTGCTCACTCTTCTCTCGGCAGG - Exonic
1183808926 22:40237702-40237724 CTGGTCACTCATCTCCCAGATGG + Intronic
953068635 3:39498299-39498321 CTCCTAACTCTTTTCCCAGGTGG - Intronic
953348817 3:42198926-42198948 CTGCTGACTCATATGCCATTAGG - Intronic
954710427 3:52502713-52502735 CTGCTCACCTTGATCACAGTGGG - Exonic
954985233 3:54784731-54784753 CTGCTCCCTCTTCTCTCAGGAGG - Intronic
958507879 3:95004445-95004467 GTGCCCATTCATATCCCAGTAGG - Intergenic
960654999 3:119993563-119993585 CTGCTAACTCATATCCCTGGGGG - Intronic
961718052 3:128872405-128872427 CCCCTCACTCTTCTCCCTGTAGG - Intergenic
963225748 3:142859887-142859909 CTGATTTCTCTTATCCCAGAAGG - Intronic
968191394 3:196670408-196670430 CTGCACACTGCTACCCCAGTGGG + Intronic
970360089 4:15300513-15300535 CTTCTCACTCCTATCTGAGTTGG - Intergenic
970541422 4:17083731-17083753 CTACTCAGTCTCATCACAGTGGG + Intergenic
972239483 4:37174845-37174867 CTGCTCCCTCTTATCCAAAATGG + Intergenic
973601333 4:52545616-52545638 CTGCTCCCCTTTAGCCCAGTAGG + Intergenic
976315518 4:83655184-83655206 CTGCCCAATCCTTTCCCAGTAGG + Intergenic
977142946 4:93398438-93398460 GTTCTCACACTTATCACAGTAGG - Intronic
977491514 4:97718825-97718847 CTGCTGTCTCTTATTCTAGTAGG - Intronic
978410324 4:108418067-108418089 CTGCTCAATATGCTCCCAGTGGG + Intergenic
981447680 4:144859102-144859124 CTGCCAAATCTTGTCCCAGTAGG + Intergenic
986848152 5:11779949-11779971 CTTCTCTCTTTTATCCCACTAGG + Intronic
987218080 5:15760161-15760183 CAGCTGACTCTTACCCCAATAGG - Intronic
992733675 5:79697404-79697426 CTGATGACTCTTATCCTAGAAGG + Intronic
993763917 5:91831959-91831981 TTGTTGACTTTTATCCCAGTTGG + Intergenic
997817937 5:137035974-137035996 CTCCTCACTCTCATCCTTGTGGG - Intronic
998478409 5:142441045-142441067 TTGCTCACTCTTATCCTCCTAGG + Intergenic
999231825 5:150066195-150066217 CTGCACACTCTTGTCCCAGGAGG - Intronic
1000713808 5:164614596-164614618 CTGCTTACCCTTATCACAGAAGG + Intergenic
1001536716 5:172503238-172503260 CTTCTCTTTCTTCTCCCAGTTGG + Intergenic
1006017708 6:31095442-31095464 CTGCTCTCTCTAATGCAAGTAGG + Intergenic
1014866601 6:126539375-126539397 CTGCTCATAGTTATCCCAGCTGG + Intergenic
1020487838 7:8740581-8740603 TGGCTCTCTCTTAACCCAGTAGG - Intronic
1022872119 7:34490522-34490544 CTGATCACACTTGTCCCATTTGG + Intergenic
1024672841 7:51612432-51612454 CTTCAGCCTCTTATCCCAGTGGG + Intergenic
1024810663 7:53207627-53207649 CTGCCATCTCTTATCCCAGGTGG - Intergenic
1027937305 7:84624609-84624631 CTGCTAACTCTTATCCTCCTTGG - Intergenic
1028151825 7:87382634-87382656 TTGCTCACTTTTTTCCCAGCTGG + Intronic
1029648169 7:101871417-101871439 CTGCTCACTCTTCTACCAACAGG - Intronic
1032017314 7:128388421-128388443 CTTCTCCCTCTTCTGCCAGTGGG - Intergenic
1034144033 7:148852580-148852602 ATGCTCACTCTTCTCCCCTTAGG + Intronic
1038717987 8:30009097-30009119 TTGCCCTCTCTTTTCCCAGTAGG + Intergenic
1040915218 8:52562179-52562201 CTGGGAATTCTTATCCCAGTAGG + Intronic
1044475829 8:92625472-92625494 CTGCTTTCTCTTCTCCCAATCGG - Intergenic
1051591265 9:18778145-18778167 CTACCCACTCCTATCCCTGTAGG + Intronic
1053065215 9:35063689-35063711 CTTCTCAATCTTTTCCTAGTGGG - Intronic
1053306440 9:36987499-36987521 CTGCTCTCTCTGGTGCCAGTAGG + Intronic
1056155974 9:83838050-83838072 CTCTTCACTCTAATTCCAGTGGG - Intronic
1056354562 9:85785514-85785536 CTCTTCACTCTAATTCCAGTGGG + Intergenic
1061925622 9:133804811-133804833 CTGCCCACTCTTAACCCTCTGGG + Intronic
1062168765 9:135122600-135122622 CTGCACACGCCTCTCCCAGTCGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186059768 X:5691394-5691416 CAGCTCACGCTTACCTCAGTTGG - Intergenic
1190931657 X:54953743-54953765 CTTCTCACACTGAGCCCAGTTGG + Intronic
1191755375 X:64586837-64586859 CAGCTCACTCTTATAACTGTGGG + Intergenic
1194071350 X:89329425-89329447 CTGCTTTCTTTTGTCCCAGTGGG + Intergenic
1196157818 X:112450173-112450195 CTGCTGACTCTTCTCCAAATGGG + Intergenic
1199390051 X:147268918-147268940 CTGCTCACTCTTCAGCCATTAGG + Intergenic
1200725582 Y:6665156-6665178 CTGCTTTCTTTTGTCCCAGTGGG + Intergenic