ID: 930709939

View in Genome Browser
Species Human (GRCh38)
Location 2:54541241-54541263
Sequence TTTTATGCCTAGAACTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930709935_930709939 24 Left 930709935 2:54541194-54541216 CCAAATCTATTAGCCCCATTATA 0: 1
1: 0
2: 0
3: 7
4: 119
Right 930709939 2:54541241-54541263 TTTTATGCCTAGAACTGCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 145
930709936_930709939 11 Left 930709936 2:54541207-54541229 CCCCATTATATGTCTCTACTATG 0: 1
1: 0
2: 1
3: 15
4: 167
Right 930709939 2:54541241-54541263 TTTTATGCCTAGAACTGCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 145
930709937_930709939 10 Left 930709937 2:54541208-54541230 CCCATTATATGTCTCTACTATGA 0: 1
1: 0
2: 0
3: 11
4: 218
Right 930709939 2:54541241-54541263 TTTTATGCCTAGAACTGCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 145
930709938_930709939 9 Left 930709938 2:54541209-54541231 CCATTATATGTCTCTACTATGAA 0: 1
1: 0
2: 1
3: 13
4: 235
Right 930709939 2:54541241-54541263 TTTTATGCCTAGAACTGCAGAGG 0: 1
1: 0
2: 1
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930709939 Original CRISPR TTTTATGCCTAGAACTGCAG AGG Intronic
900385275 1:2407760-2407782 TTTTGTCCCTAGAGCTGCACTGG - Intronic
904117161 1:28171378-28171400 CTATATGCCTAGCACTGTAGAGG - Intronic
906559681 1:46747254-46747276 TTTCATCCCTAAAAGTGCAGAGG - Intergenic
907551356 1:55307913-55307935 TTTTCAGACTAGCACTGCAGCGG - Intergenic
908608298 1:65825262-65825284 TATTATACCTGGAACTGTAGTGG + Intronic
908824993 1:68124600-68124622 TTTGATTCCTGGCACTGCAGTGG + Intronic
909119028 1:71576841-71576863 TTTGATGCTTTGAACTGAAGTGG + Intronic
909277198 1:73702023-73702045 CTTTATGGCTAAAACTGCATGGG + Intergenic
911220223 1:95237508-95237530 TTTTATGCTGAGAATTTCAGGGG + Intronic
914388893 1:147200100-147200122 TTTTCTGCTTAGAATTTCAGAGG + Intronic
914827132 1:151144617-151144639 CTTTATGCCCAGAGATGCAGGGG + Intronic
915407456 1:155671642-155671664 TTTTGTCTCTAGAAATGCAGAGG - Intronic
915420106 1:155773776-155773798 TTTTGTCTCTAGAAATGCAGAGG - Intronic
915775436 1:158479929-158479951 TTTTCTGCCAAGATCTGCAAAGG - Exonic
917376775 1:174356787-174356809 TTTTATGCCTATCACTTCAAAGG - Intronic
1065352810 10:24810860-24810882 TTTTTTTCCTTGGACTGCAGTGG - Intergenic
1066206014 10:33189939-33189961 TTGTGTTTCTAGAACTGCAGGGG + Intronic
1074874515 10:117603436-117603458 TTTTATGCAGAAAACTTCAGTGG - Intergenic
1092988235 12:13868080-13868102 TTTTCTGCCAAGAACTGGATTGG - Intronic
1095129502 12:38522589-38522611 TTTTATTCCAAGAAATGGAGAGG + Intergenic
1098521171 12:71436657-71436679 AGTCATGGCTAGAACTGCAGTGG + Intronic
1099193061 12:79580815-79580837 CTTTATTCCAAGCACTGCAGAGG + Intronic
1101180857 12:102216415-102216437 TTATATGACTGGGACTGCAGTGG + Intergenic
1102700086 12:114831618-114831640 TTTTATCCCTAGTACTGCGCAGG + Intergenic
1103081623 12:118028533-118028555 TTTAATATCTAGAACTGCTGGGG + Intronic
1104073623 12:125370321-125370343 TGTGATGACTACAACTGCAGCGG - Intronic
1107659316 13:42623070-42623092 TTTGATGGCTGGAACTGCTGGGG - Intergenic
1108557972 13:51614422-51614444 TTTTATACCAAGAAGTCCAGAGG + Intronic
1112123849 13:96442848-96442870 TGTTATTCCTAGAATTTCAGTGG - Intronic
1114147101 14:19990693-19990715 TTTTTTGCTTAGAATTGCATTGG - Intergenic
1114279163 14:21175027-21175049 TTTTTTGCTTAGAACTGCCTTGG - Intergenic
1116543206 14:46126487-46126509 TTTTATGCCTTGAAATGAGGTGG + Intergenic
1125147145 15:36484952-36484974 TTTTATGCCAAGCATTGCATAGG - Intergenic
1127909433 15:63404062-63404084 TTTTATGCATAGAACGGCTCTGG + Intergenic
1131222727 15:90598510-90598532 TTTCCTGCACAGAACTGCAGAGG + Intronic
1133653827 16:7839773-7839795 TTTTAGGACTAGTACAGCAGAGG - Intergenic
1134147647 16:11779431-11779453 TTTTATACCTAAAACTTCACAGG + Intronic
1136853858 16:33636869-33636891 TTTGTTGCCTAGGAGTGCAGTGG + Intergenic
1137584955 16:49658773-49658795 CTTGATGCCTAGGACTTCAGGGG - Intronic
1137940585 16:52679952-52679974 GATTAGGCCTAGACCTGCAGAGG - Intergenic
1138781474 16:59793524-59793546 TTTTATGCTTAGGACAGCAGAGG - Intergenic
1138877294 16:60967492-60967514 TTTTATAGCTAGAAATGCTGAGG - Intergenic
1139016097 16:62690556-62690578 TTTTATGGCTGGGACTCCAGGGG - Intergenic
1141365746 16:83440990-83441012 TTGGTTTCCTAGAACTGCAGTGG - Intronic
1203115442 16_KI270728v1_random:1485313-1485335 TTTGTTGCCTAGGAGTGCAGTGG + Intergenic
1144296137 17:13876729-13876751 TTTTATGCTTAAAACAGCAGAGG - Intergenic
1146156300 17:30526998-30527020 TTTTAGCCCTAGAAGTGAAGGGG + Exonic
1153557627 18:6332624-6332646 ATGTAAGCCTAGATCTGCAGGGG + Intronic
1154171611 18:12056810-12056832 TTTTTGGCCTAGAAGTGCTGGGG + Intergenic
1156207404 18:34900984-34901006 TTTTATGCATCAAACAGCAGGGG - Intergenic
1158310960 18:56157778-56157800 TTGTGAGGCTAGAACTGCAGGGG - Intergenic
1159049507 18:63406270-63406292 TTAGATGCCAAGAACTTCAGTGG - Intronic
1162214147 19:9118638-9118660 TTTTATGACAAGAACTTCAGGGG - Intergenic
1162897709 19:13775232-13775254 TTGTAAACCTAGAACAGCAGAGG + Intronic
1164881247 19:31734424-31734446 TTTTATGCCTAACACCCCAGTGG + Intergenic
1165142821 19:33712667-33712689 CTTTAGGCCTTGCACTGCAGCGG + Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
926762710 2:16293145-16293167 TTTTATGTGTGGCACTGCAGAGG + Intergenic
927930742 2:27041934-27041956 TTTTACGCTTAGAAAAGCAGGGG + Intergenic
929677357 2:43950587-43950609 TTATATTCATAGACCTGCAGAGG + Exonic
930055249 2:47247001-47247023 TTCCATGTCTAGAACTGCTGTGG - Intergenic
930543213 2:52733926-52733948 TTTTGTGCATAGACATGCAGTGG - Intergenic
930660116 2:54044789-54044811 TTTTATGCTAGAAACTGCAGTGG + Intronic
930709939 2:54541241-54541263 TTTTATGCCTAGAACTGCAGAGG + Intronic
932395299 2:71441578-71441600 TTTCTTGCCTAGAATTGCAGTGG - Intergenic
934933829 2:98450461-98450483 TTTTATCCCTAGAACTATTGTGG + Intronic
937125743 2:119474088-119474110 TATTATGCAGAGAAATGCAGAGG - Intronic
937728767 2:125200636-125200658 TTTTATGCCAAGAACTGTAGTGG + Intergenic
939761306 2:146183896-146183918 ATTTATTCCTAGAAATGCATAGG + Intergenic
940479364 2:154208682-154208704 TTTTATGCCTAGAACAGTGCTGG + Intronic
940806490 2:158193269-158193291 TTTTATGCATAGAATTGGGGCGG - Intronic
940843075 2:158607497-158607519 TATCATCCCTAGGACTGCAGAGG + Intronic
943600813 2:189919104-189919126 GTGGATGCCTAAAACTGCAGAGG - Intronic
944500833 2:200358430-200358452 TTCTATGGCTAGAAATACAGTGG + Intronic
946098948 2:217302283-217302305 TTTTAAGCCCAAAACAGCAGGGG + Intronic
946236431 2:218327198-218327220 TTCTATGCCTAGGAATGGAGAGG - Intronic
947119754 2:226801300-226801322 TTTCAAGCCTTGCACTGCAGAGG + Intergenic
1175083233 20:56438326-56438348 TTTTATTTCTAGAACTGCTATGG + Intronic
1177687004 21:24450051-24450073 TTCTCTGCCTAAAATTGCAGTGG - Intergenic
1179933599 21:44589496-44589518 GTAGATGCCTAGAACTGGAGTGG + Intronic
1180043787 21:45293615-45293637 TTTTGTGCCTGGAAGTGCACAGG + Intergenic
1182726768 22:32453190-32453212 TTTGATGGCTGGAACCGCAGTGG + Intronic
1183389130 22:37534308-37534330 TTTTATACCTAGGAGTGAAGTGG - Intergenic
953945651 3:47145069-47145091 TTTCATGCCTACATCTACAGAGG + Intronic
954588161 3:51754933-51754955 TTTTATGCTAAGAACTGAAATGG + Intergenic
957380685 3:79425019-79425041 CTTCATGCCTAGAACTGCCTGGG + Intronic
958073725 3:88649267-88649289 TTTTTTGCTTAGAACTGCTTTGG - Intergenic
959242539 3:103815855-103815877 AATTATGCCTAGAACTACTGTGG + Intergenic
960204631 3:114880428-114880450 TTTTATGCCAAGAACTGATGAGG + Intronic
964240535 3:154588104-154588126 TTTTATCCTTAGAATTACAGTGG - Intergenic
965746922 3:171935665-171935687 TTTTCTGCCTCGAACAGCAGTGG - Intronic
966047884 3:175575182-175575204 TTATATGCCAACAACTACAGTGG - Intronic
968259452 3:197308112-197308134 TTTTAGGCCAATTACTGCAGTGG - Intergenic
972682818 4:41323409-41323431 GTATATACCTAGAAATGCAGTGG + Intergenic
973042008 4:45480216-45480238 TTTTAAACCTTGAACTGGAGAGG - Intergenic
976831525 4:89320245-89320267 TTTCATGCCTAGAAGTGCTCAGG + Intergenic
981270023 4:142835061-142835083 CTTTCTGCCTAAAACTTCAGGGG - Intronic
981638038 4:146902802-146902824 TTTTGTGACTAGGACTGCATAGG - Intronic
983972414 4:173890977-173890999 TCTTATGCCTAGTACAGCACTGG - Intergenic
984187176 4:176559600-176559622 ATTTATCCCTACAACTCCAGTGG - Intergenic
984828031 4:183945588-183945610 TTTTCTGCGTAGAACTGCTACGG - Intronic
986046571 5:4044020-4044042 TTTTATGCCTACAAGTCCACCGG - Intergenic
988838178 5:35054621-35054643 CTTTATGCATACAACTGCTGTGG - Intronic
991048020 5:62243312-62243334 TTTGCTGCCTAGGAGTGCAGTGG - Intergenic
991392119 5:66156640-66156662 TTGTATGCCTAAAATTCCAGGGG - Intronic
993271437 5:85802488-85802510 TTTGATGACTATAACAGCAGTGG + Intergenic
993575902 5:89600474-89600496 TTTTAGACCTAGAGCTGCATTGG + Intergenic
995623107 5:114049547-114049569 TGTTATGTCTAGAACATCAGAGG + Intergenic
996561968 5:124840549-124840571 TTTTATGCATATAAGTCCAGAGG - Intergenic
999606459 5:153322154-153322176 TTTTATACTTAGTCCTGCAGGGG + Intergenic
999783499 5:154870123-154870145 TTTGAGGCCAAGAACTGGAGGGG - Intronic
1004103910 6:12645503-12645525 TTCTATGCCTGGTACTGCAGGGG + Intergenic
1005164646 6:22905888-22905910 TTTGATGCCAAGAACTTTAGAGG + Intergenic
1005420411 6:25642667-25642689 TTTTCTGCTTGGAACTGAAGGGG - Intergenic
1005675117 6:28146022-28146044 TCTCTTGCCTAGAACTGCAATGG - Intronic
1012131828 6:95504146-95504168 TTTTATTCCTTGCACTGCAAAGG - Intergenic
1012721439 6:102751296-102751318 ATTTATGCCTAGAGCATCAGTGG - Intergenic
1013691613 6:112651462-112651484 TGTTATGACCAGAAGTGCAGAGG + Intergenic
1013819145 6:114134494-114134516 TTTTTTGCATAGAGCTGCACAGG + Intronic
1014588591 6:123232581-123232603 TCTTATGGTAAGAACTGCAGAGG + Intronic
1015583418 6:134751078-134751100 ATTTATGCCTGAAAATGCAGGGG - Intergenic
1016459718 6:144269729-144269751 TTTTATGGTTAGAATTGGAGAGG - Intergenic
1020985235 7:15125354-15125376 GTTTGTGGCTAGAAGTGCAGTGG + Intergenic
1021076355 7:16308877-16308899 TTTTACGCCTAGAACTACTGAGG - Intronic
1021504918 7:21371597-21371619 TTTTATGCTAAGAATTGTAGAGG - Intergenic
1022816136 7:33916340-33916362 TTTAATGGCAAGGACTGCAGAGG - Intronic
1024033473 7:45485152-45485174 TATGATGGCTAGAGCTGCAGGGG - Intergenic
1026609955 7:71849355-71849377 ATTTATGGCTAGTACTGCATAGG + Intronic
1027516087 7:79144151-79144173 TTATGTGCCTAGCACTGCTGTGG - Intronic
1027938091 7:84634826-84634848 CTTTATGCCTAGGACTGCTTTGG + Intergenic
1028147433 7:87333849-87333871 TATTGTGACTAGTACTGCAGTGG + Intergenic
1028765469 7:94552978-94553000 TATTATGCCAAGGGCTGCAGTGG + Intronic
1031152548 7:118071165-118071187 TTTTATTCCTGGAGCTGCACTGG + Intergenic
1034231081 7:149529043-149529065 TTTTATGCTTAGAAATCCATTGG + Intergenic
1038335168 8:26640270-26640292 TATAAGGCCAAGAACTGCAGGGG - Intronic
1040902852 8:52434715-52434737 TTATATGACTAGCAGTGCAGTGG - Intronic
1046446875 8:114332949-114332971 TTTTATGCCTAACACTCAAGTGG + Intergenic
1046493738 8:114986606-114986628 TTTTTTGCAGAGAACTGCAGTGG + Intergenic
1048103246 8:131378498-131378520 TTTTAGGCCTATAACTTCAGAGG + Intergenic
1049870799 8:144974147-144974169 TTTTATGCCTGTACCAGCAGAGG - Intergenic
1050194496 9:3066790-3066812 TTTTCTGCCTTGAATTGCAGGGG - Intergenic
1050523614 9:6526987-6527009 TCTGATGCCTAGAACTGGAAAGG - Intergenic
1050550380 9:6744048-6744070 TTTTTTACATAGAACTGGAGAGG - Intronic
1051526774 9:18054019-18054041 TTTTATAACCAGAACTGCACAGG - Intergenic
1051566906 9:18509917-18509939 TTAGATGCCTAGATCTGGAGTGG - Intronic
1051943582 9:22538505-22538527 TTTTATGTCTAGTAATGCAATGG - Intergenic
1054835991 9:69674726-69674748 TTTCCTTCCTAAAACTGCAGTGG - Intergenic
1055592151 9:77828141-77828163 GTTTCTGTCTATAACTGCAGTGG - Intronic
1057561249 9:96129690-96129712 CTTTGTGCCCAGAACTGCAGTGG - Intergenic
1058694670 9:107549104-107549126 TCTTATGCCTAGAGATGTAGAGG + Intergenic
1059347376 9:113638501-113638523 TTTTATATTTAGATCTGCAGTGG + Intergenic
1059561985 9:115344391-115344413 TTTTCTGCCTTGAACTTTAGAGG + Intronic
1059598818 9:115753496-115753518 TGTTCTGCTTAGAAATGCAGAGG + Intergenic
1059906756 9:118995064-118995086 TTTTAAGCCTAGACCTCAAGAGG - Intergenic
1187090032 X:16086438-16086460 TTTTATGCCTAAAGCTGTGGAGG - Intergenic
1187679679 X:21754662-21754684 TTTCAAGCCAAGAACTTCAGAGG - Intronic
1189227853 X:39428278-39428300 TTCTTTGCCTTGAAATGCAGAGG - Intergenic
1191226899 X:58053755-58053777 TTTTATGCCTAGGATTGCAAGGG - Intergenic
1192788182 X:74354614-74354636 TCTGATGACTAGAGCTGCAGGGG - Intergenic
1195816435 X:108894101-108894123 CTTGATGACTAGGACTGCAGAGG - Intergenic