ID: 930715357

View in Genome Browser
Species Human (GRCh38)
Location 2:54588717-54588739
Sequence CTGTAGAGATGGAGAGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930715349_930715357 14 Left 930715349 2:54588680-54588702 CCCTAACTGATCAGTCACCCTGA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG 0: 1
1: 0
2: 2
3: 32
4: 291
930715352_930715357 -4 Left 930715352 2:54588698-54588720 CCTGACTGCAGTTCCCATCCTGT 0: 1
1: 0
2: 0
3: 16
4: 271
Right 930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG 0: 1
1: 0
2: 2
3: 32
4: 291
930715351_930715357 -3 Left 930715351 2:54588697-54588719 CCCTGACTGCAGTTCCCATCCTG 0: 1
1: 0
2: 0
3: 18
4: 287
Right 930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG 0: 1
1: 0
2: 2
3: 32
4: 291
930715348_930715357 20 Left 930715348 2:54588674-54588696 CCTTTGCCCTAACTGATCAGTCA 0: 1
1: 0
2: 0
3: 3
4: 105
Right 930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG 0: 1
1: 0
2: 2
3: 32
4: 291
930715350_930715357 13 Left 930715350 2:54588681-54588703 CCTAACTGATCAGTCACCCTGAC 0: 1
1: 0
2: 0
3: 3
4: 107
Right 930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG 0: 1
1: 0
2: 2
3: 32
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930715357 Original CRISPR CTGTAGAGATGGAGAGTAGC AGG Intronic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
901009095 1:6188726-6188748 CTGAAGAGATGGTTAGTAGCAGG - Intronic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
902231413 1:15029983-15030005 CTGGCGGGCTGGAGAGTAGCAGG - Intronic
902412754 1:16221014-16221036 CTGCAGAGCTGGTGAGTAGGTGG + Intergenic
903670243 1:25031156-25031178 CTGGAGAGATGGAGACTGGAGGG + Intergenic
903670272 1:25031262-25031284 CTGGAGGGATGGAGACTAGAGGG + Intergenic
905218305 1:36426000-36426022 CTTCAGAGATGGAGATGAGCAGG + Intronic
906343094 1:44997981-44998003 CCATAGAGATAGAGAGTAGAAGG + Intergenic
907809023 1:57850122-57850144 CTGAAGAGAAGGAGAGAACCAGG + Intronic
907861188 1:58355248-58355270 CTTTACAGATGGAGACTGGCTGG - Intronic
907944819 1:59125978-59126000 CTGAAGAGATTGGGAGTTGCTGG - Intergenic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912546479 1:110455032-110455054 CTCCAGAGAGGGAGAGCAGCAGG - Intronic
913239535 1:116817935-116817957 CTGCAGAGATGGAGCCCAGCTGG + Intergenic
919087185 1:192934218-192934240 CTGAAGAGATGGAGTGGAGGTGG - Intergenic
919423203 1:197397773-197397795 GTGAAGAGATGGAGTGTTGCTGG + Intronic
919614273 1:199785734-199785756 CTGTAGAGATGGGGATTGGAGGG + Intergenic
920052870 1:203174095-203174117 CTGGAGAGATTGAGATTAGATGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
924837589 1:247668195-247668217 GCGTAGAGAGGGAGAGTATCAGG - Intergenic
1064372408 10:14764009-14764031 CAGTAGAGATGGGAAGTTGCAGG - Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065094833 10:22270350-22270372 CTGTAGAATAGGAGACTAGCCGG + Intergenic
1067035791 10:42915606-42915628 CTGTAGAATTTGAGAGTGGCGGG + Intergenic
1069706263 10:70460575-70460597 CAGAAGAGATGGGGAGGAGCAGG - Intergenic
1069932219 10:71890486-71890508 CTGAAGAAATGCATAGTAGCGGG + Intergenic
1071102112 10:82050793-82050815 CTGGAGAGACAGAGAGTAGGAGG - Intronic
1071845198 10:89514780-89514802 TTGTAGAGATGAAAAGGAGCGGG + Intronic
1073559318 10:104483248-104483270 TTGTGGAGATGGAGTGTCGCTGG + Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1076043774 10:127274352-127274374 ATTTAGAGATGGAAAGTTGCTGG + Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1080605685 11:33863032-33863054 CGGTAGAGATAGGGAGAAGCTGG + Intronic
1081993795 11:47351163-47351185 CTGGATGGATGGAGAGTCGCTGG + Intronic
1082747595 11:56982299-56982321 CTGGAAAGATGCAGAGTAACTGG - Intergenic
1082998817 11:59273451-59273473 AGGTAGAGATGGAGAGTCTCTGG + Intergenic
1083052302 11:59788165-59788187 CTCTAAAGATGGAGATGAGCAGG - Intronic
1085950026 11:81319274-81319296 CTGAATAGATGGGGAGGAGCAGG - Intergenic
1086743390 11:90395765-90395787 CTTTAGGGATGGAGAACAGCTGG + Intergenic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089918245 11:122180737-122180759 CTGGAGAGAGGGAGAGAAACAGG - Intergenic
1091871358 12:3893824-3893846 GTGTAGAGAAGGAGAGAAACGGG - Intergenic
1092488998 12:8927603-8927625 CTGAAGAGGTGAAGAGTAGGAGG + Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1094257552 12:28450091-28450113 CTGTCAACAAGGAGAGTAGCTGG - Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095582144 12:43812830-43812852 TTGTAGAGATGGGGAGTGGGAGG - Intergenic
1096467647 12:51856182-51856204 CTGTAGGCATGGAGGCTAGCTGG - Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097052842 12:56233821-56233843 CTGTTGAGAGGGAGATTAGATGG + Intronic
1097499516 12:60384516-60384538 CTGTTGGGAGGGAGAGTATCAGG + Intergenic
1097530868 12:60798443-60798465 CTGAAGAGATTGAAAGTAGGGGG + Intergenic
1100588299 12:95999701-95999723 CAGTAAAGCTGGAGAGTGGCCGG + Intergenic
1100729903 12:97453440-97453462 CTGTAGAGATGGATAGTCTGTGG - Intergenic
1100865604 12:98853657-98853679 GTGCAGTGATAGAGAGTAGCAGG - Intronic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101947538 12:109149425-109149447 AGATAGAGAAGGAGAGTAGCTGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1106858472 13:33878625-33878647 CTGAAGAGATGGAATGTAGCGGG + Intronic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111965322 13:94856296-94856318 CTGTAGAGTTGGGGAGTATGTGG - Intergenic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1112381883 13:98899162-98899184 CTGTAGAAATGCAGAGTCTCAGG + Intronic
1113239660 13:108322725-108322747 CTGTAGAGAGGGAGGTTAGAGGG + Intergenic
1113366426 13:109680930-109680952 CTGTTCAGATGATGAGTAGCTGG + Intergenic
1113406563 13:110046316-110046338 CTGTGGAGAGGGGGAGTAGGAGG + Intergenic
1114402067 14:22419227-22419249 CTGGAGAGATGGAGATTATGGGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115135000 14:30097246-30097268 CTATATAGATAGAGAGTAGAAGG + Intronic
1115349222 14:32375433-32375455 TTGTAGATATGGAGTGTATCAGG + Intronic
1117261365 14:54037401-54037423 GTGGAGAGAGGGAGAGAAGCAGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117781552 14:59238198-59238220 CAGTAGAGATAGGGAGTGGCTGG + Intronic
1118608623 14:67522252-67522274 CAGTAGAGTGGGAGAGGAGCGGG - Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119286230 14:73457807-73457829 CTGGAGAGATGAGGAGCAGCAGG - Intronic
1119727159 14:76928497-76928519 CTGCAGAGCAGGAGAGGAGCTGG - Intergenic
1119911437 14:78353138-78353160 CTGGAGAGAGGCTGAGTAGCTGG + Intronic
1120255005 14:82107378-82107400 CTGGAGAGATGGAAAGTGGGAGG + Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125316982 15:38442005-38442027 CAGCAGAGATGAAGAGTTGCGGG + Intergenic
1126059318 15:44764325-44764347 CTGTATAGAGGGAGAGTATATGG - Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1131651971 15:94409932-94409954 CTGGAGAGAGGCAGAGTAGAGGG - Intronic
1132212784 15:100036771-100036793 CGGTAGAGATGGAAGGTAGATGG - Intronic
1133116067 16:3578674-3578696 TTGTAGAGCAGGAGAGTAGTGGG + Intergenic
1133859628 16:9582110-9582132 CAGTAGAGAAGGAGTGTGGCTGG - Intergenic
1135717519 16:24784503-24784525 TTGTAGAGATGGGGTGTTGCAGG + Intronic
1136003784 16:27314708-27314730 ATTGAGAGATGGAGAGCAGCTGG - Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1138734618 16:59236153-59236175 TGGAAGAGATGGTGAGTAGCAGG - Intergenic
1139696435 16:68678586-68678608 CTGTAGAGAAGGAGACAGGCTGG + Exonic
1140055489 16:71522016-71522038 GAGTAGAGTTGGAGAGTGGCAGG - Intronic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1141674138 16:85508739-85508761 CTGTAGAGACTGAAATTAGCAGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142834947 17:2578202-2578224 ATGAAGAGATGGAGAGTAGCTGG - Intergenic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1144495228 17:15741564-15741586 CTGTAGGGAGGGAGGGTGGCTGG - Intronic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144698132 17:17319670-17319692 CTGTACTGATGGAAAGTAGATGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147357254 17:39907785-39907807 CTGTAGAGCTAGTGAGTGGCAGG + Intronic
1147449492 17:40495307-40495329 CTGGAGACATGTGGAGTAGCAGG - Intronic
1148353163 17:46956061-46956083 CCATAGAGATGGAGAGTGGGAGG + Intronic
1149142366 17:53447798-53447820 CTGAATAGATGGAAAGTAGTAGG + Intergenic
1150274562 17:63888087-63888109 CTCTATAGATTAAGAGTAGCTGG + Intergenic
1150530972 17:65981142-65981164 ATGTAGAGATGGAGAGTGCAAGG - Intronic
1150825811 17:68473852-68473874 CTGGAAAGATGGAGAGAAACTGG + Intergenic
1151162407 17:72176462-72176484 CTGCACAGTTGGAGAGAAGCAGG - Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1155234278 18:23803878-23803900 CTGTAGATGTGGAATGTAGCAGG + Intronic
1155528467 18:26741870-26741892 GTGGAGAGATGGAAAGAAGCCGG + Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1156044835 18:32866274-32866296 ACGTAGAGATGGAGAGTATGGGG + Intergenic
1157545345 18:48542579-48542601 TTGTAGAGAAGCAGAGTATCTGG - Intronic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1157953810 18:52071862-52071884 TCATAGAGATGGAGAGTAGTAGG - Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1159793655 18:72816111-72816133 CTGGAGAGATAGAGAATTGCAGG - Intronic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162914614 19:13867444-13867466 TTGTAGAGATGGAGTTTTGCCGG + Intronic
1164989460 19:32673962-32673984 TTGTAGAGATGGAGTCTAGCAGG - Intronic
1167034842 19:46988957-46988979 CTCTACAGATGGACAGTACCAGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
925744534 2:7033079-7033101 CTGTAGAGAAGGTGAGTTCCAGG + Intronic
926590194 2:14732583-14732605 AGGAAGAGATGGAGAGTAGGGGG - Intergenic
926663680 2:15496319-15496341 CTGGGGAGATGGAGTGTTGCAGG + Intronic
926893305 2:17657690-17657712 CTGGAGAGATGGCCAGCAGCGGG + Intergenic
928450557 2:31374711-31374733 CTGCAGAGATGGAGTGTGGAGGG - Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
932809768 2:74815044-74815066 CTGTAGAGAGGGAGAAAAGCGGG - Intergenic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933803782 2:85983344-85983366 CTGTAAAGAAGGAGTGAAGCTGG - Intergenic
934139204 2:89029424-89029446 CTCTAGAGATGGACAGATGCTGG + Intergenic
934230040 2:90171135-90171157 CTCTAGAGATGGACAGATGCTGG - Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
934656955 2:96121378-96121400 CTACAGAGATGGACAGGAGCAGG - Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936906210 2:117537746-117537768 CTTTAGAGATGGAGGGTATTTGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
942750568 2:179282323-179282345 CCATAGAGATAGAGAGTAGAAGG + Intergenic
946243308 2:218370210-218370232 CTGCAGTGATGGAGAGTTGAGGG + Intergenic
946247874 2:218397693-218397715 CTGTAGAGACAGAGGGCAGCTGG + Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948751943 2:240138028-240138050 CTGTAGAGAAGGGGAGTGGGGGG + Intergenic
1169146397 20:3255285-3255307 CTGCAGAGATGGGGAGTGGAGGG + Intronic
1169705244 20:8496194-8496216 CTCTAGAAATGTGGAGTAGCTGG + Intronic
1170038267 20:12012914-12012936 CTGGAAAGATCGAGAGTGGCTGG + Intergenic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171400967 20:24872820-24872842 CTTTAGAGCTGGTGAGCAGCTGG + Intergenic
1171960037 20:31486664-31486686 ATGGAGAGATGGAGGGGAGCGGG - Intergenic
1172330707 20:34074463-34074485 CTGGACAGAGGGAGAGAAGCAGG - Intronic
1172736908 20:37133410-37133432 CTTCAGAGATGGAGAGGAGGAGG - Intronic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1174100672 20:48124091-48124113 CTGTAGACCTGGGGAGGAGCTGG - Intergenic
1178779081 21:35582355-35582377 TTGTGGAGATGCAGAGTTGCTGG - Intronic
1181049472 22:20231769-20231791 ATGGAGAGCTGGAGAGCAGCTGG + Intergenic
1181965266 22:26652175-26652197 CTGTAGAGATGCGGTGGAGCCGG + Intergenic
1182132626 22:27868282-27868304 CTTTTGAGATAGAGAGTGGCAGG - Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183695788 22:39421411-39421433 CTGTACACATGGAGAGTATCTGG + Intronic
1183912304 22:41089131-41089153 TTGTAGAGATGGGGAATAGGGGG + Intergenic
1184330623 22:43824875-43824897 CTGAAGCGATGGAGAGTCGGGGG - Exonic
1185177426 22:49336074-49336096 GTGCAGTGATGGAGAGCAGCTGG - Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950634678 3:14306555-14306577 CTGCAGGGAGGGAGAGTAGAAGG - Intergenic
952254303 3:31682278-31682300 CTTTTGAGCTGGAGAGTACCAGG - Intronic
953087808 3:39689189-39689211 TTATAGACATGGAGAGTAGAAGG + Intergenic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954225305 3:49177338-49177360 CTGTAGAGAGGAAGATTAGAGGG - Intergenic
954258057 3:49419852-49419874 CTGCAGAGCTGGACAGTAGTAGG + Intronic
954396421 3:50295704-50295726 CTGTAAGGATGGGGAGGAGCTGG - Intronic
954984741 3:54779696-54779718 CAGTAGAGAAGCAGAGCAGCAGG - Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956520057 3:70094196-70094218 CGATAGGGATGGAGAGCAGCAGG - Intergenic
958177589 3:90016235-90016257 CTGCAGAGCTGGGGAGAAGCGGG + Intergenic
958740171 3:98059614-98059636 TTGTTGAGATGGAGACTAGATGG + Intergenic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962454410 3:135551989-135552011 CTGTAGAGATGGACATAAACAGG - Intergenic
962976781 3:140452618-140452640 CTGGGGAGCTGGACAGTAGCTGG + Intronic
963371583 3:144407815-144407837 CAGTAGAGATGAAGAACAGCTGG + Intergenic
963544345 3:146636524-146636546 CTATAGAGCTGGAAAATAGCAGG + Intergenic
965396631 3:168166915-168166937 ATGTAGAAATGGAGAGTGGGAGG + Intergenic
965992419 3:174836288-174836310 TTATAGAGATAGAGAGTAGAAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969599987 4:8170602-8170624 CTGCAGAGATGGTGGGCAGCTGG + Intergenic
970083738 4:12321265-12321287 CTGGAGACATGGAAATTAGCAGG + Intergenic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
974031611 4:56781417-56781439 ATGGAGAGGTGGAGAGTAACAGG + Intergenic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
976351445 4:84064530-84064552 CTGGAGAGGTGGACAGCAGCAGG + Intergenic
976787168 4:88835121-88835143 CTGTAGAGGAGGAGAATACCAGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978898685 4:113923217-113923239 CTGTAGAGAAAGAGAACAGCAGG - Intronic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980484370 4:133436330-133436352 CTGAAAAGATGGACAGCAGCAGG + Intergenic
981450711 4:144894638-144894660 CTATACAGATGGATAGTGGCTGG + Intergenic
982435812 4:155383025-155383047 CTGCAGAGAGGGAGAGGAGGAGG - Intergenic
983538962 4:168888447-168888469 CTGAAAAGATGGAGAATACCTGG - Intronic
984498083 4:180523834-180523856 TTATAGAGAAAGAGAGTAGCAGG + Intergenic
985164418 4:187077731-187077753 CTGCATAGGTGGAGAGAAGCTGG + Intergenic
985506092 5:281294-281316 CTGAAGACCTGGAGAGGAGCTGG + Intronic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
987055786 5:14190108-14190130 CTATAGAGATGGAAAGTTACAGG + Intronic
988065451 5:26225459-26225481 CTGGAGAAATGGGGAGGAGCTGG - Intergenic
988287786 5:29242763-29242785 CTGAAGAGTTTGAGACTAGCTGG - Intergenic
988509102 5:31850983-31851005 CTGTAGAGATGATGAACAGCTGG + Intronic
990087425 5:51995836-51995858 CTGTAGAGCTGGGGAATAACGGG + Intergenic
990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG + Intergenic
990602080 5:57369253-57369275 CTGTAGAGTGGGAGAGAAGGGGG + Intergenic
990858505 5:60299532-60299554 TTGTGGAGAGGGAGAGTATCAGG - Intronic
991288990 5:65012756-65012778 CTTCAGAGATGGAGAACAGCTGG - Intronic
991631834 5:68664394-68664416 CCGTAGAGGTGGGTAGTAGCCGG - Intergenic
993354734 5:86892047-86892069 GTGTAGAGATGGAGTGTATAGGG - Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
995932121 5:117458540-117458562 AAGTAGAGACGAAGAGTAGCTGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
998052987 5:139051911-139051933 CTGTAGGGATGGAGAATTTCAGG + Intronic
998182839 5:139957259-139957281 CAGTAGAGATGGGAACTAGCTGG + Intronic
998478068 5:142438064-142438086 GTGTTGAGATGGAGAGTGACTGG - Intergenic
998830137 5:146148777-146148799 TGTTAGAGATGGAGATTAGCCGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
1000818294 5:165951632-165951654 CAGTAAAGATGAAGTGTAGCTGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002706974 5:181168018-181168040 CAGTAGAGGTGGGGAGTAGGGGG - Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007738915 6:43999326-43999348 CTGTAGAGATGGAGTGTTGCTGG - Intergenic
1007781050 6:44254960-44254982 CGGAGCAGATGGAGAGTAGCAGG + Exonic
1011385472 6:86792974-86792996 TCATAGAGATGGAGAGTAGAAGG - Intergenic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013876036 6:114829883-114829905 CTGGAGAGTTGGACAGCAGCTGG - Intergenic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1018536204 6:164822741-164822763 CCACAGAGATGGAGAGTAGAAGG + Intergenic
1018624295 6:165762901-165762923 ATGTAGAGATAGAGAATAGGAGG + Intronic
1020069564 7:5217476-5217498 TTGTAGAGATGGAGTCTTGCTGG + Intronic
1021094474 7:16519979-16520001 CTTCAGGGATGGAGAGTAGGAGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023023079 7:36028095-36028117 CTGCAGAGAGGGTGAGTAGGTGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025233753 7:57219922-57219944 CTGTAGACCTGGGGAGGAGCCGG + Intergenic
1026055460 7:66979868-66979890 CAGAAGAGATGGAGAGTGGATGG - Intergenic
1026722239 7:72841958-72841980 CAGAAGAGATGGAGAGTGGATGG + Intergenic
1026965075 7:74434318-74434340 TTGTAGAGATGGAGAGTCACTGG - Intergenic
1027142001 7:75664920-75664942 CTGTTGAAATGGAAAGTATCTGG - Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030557394 7:111043715-111043737 CTGTAGAGATGGCAGGAAGCAGG - Intronic
1033044429 7:137948436-137948458 TTGTAGAGTTGGAGAGTTGGAGG - Intronic
1034238538 7:149591854-149591876 CTCTAGAGAAGGAGTGAAGCTGG + Intergenic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1034351012 7:150414760-150414782 TTCTAGAGAGGGAGAGTGGCCGG - Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1039332458 8:36553492-36553514 CTGTAGAAATGGAAAGTTGCAGG + Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039906296 8:41788880-41788902 ATGAAGAGATAGAGAGGAGCTGG - Intronic
1042483191 8:69325749-69325771 CTGAAGAGCTGTAGAGGAGCCGG + Intergenic
1043529977 8:81138780-81138802 AAGTAGGGATGGAGAGTGGCAGG + Intergenic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1045165008 8:99593926-99593948 GTGGAGAGATGGAGAATATCAGG + Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1053423610 9:37996878-37996900 CGGTAGATATGGAGAGTCACAGG - Intronic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1058119173 9:101119566-101119588 CTGTAGAGATATTGAGGAGCTGG + Intronic
1059208077 9:112485529-112485551 CTCTAGAGATGGAGAGGGGTTGG + Intronic
1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG + Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1062486288 9:136778035-136778057 CTGGAGACTTGGAGAGGAGCTGG - Intergenic
1062666311 9:137674810-137674832 CTGCATAGTTGGAGAGTCGCGGG + Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188248598 X:27863886-27863908 CTTTAGATATGGAGAGTACTTGG + Intergenic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1189291338 X:39887987-39888009 CTGTAGGGATGGTGGGTGGCTGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1191841695 X:65517894-65517916 AGGAAGAGATGGAAAGTAGCAGG - Intronic
1192298810 X:69879279-69879301 CTGTAGAGAGGGAGAAGATCAGG - Intronic
1195134604 X:101892061-101892083 GTGAAGAGAAGGAGTGTAGCGGG + Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195252414 X:103062138-103062160 CTGTAGGGGTGGAGAGTGGGAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196407699 X:115382397-115382419 CCATAGAGATAGAGAGTAGAAGG + Intergenic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1196798389 X:119520898-119520920 ATGGAGAGAGAGAGAGTAGCAGG + Intergenic
1197197769 X:123720262-123720284 TTGTAGAGATGGAGTCTTGCTGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198773927 X:140159579-140159601 CTGTAATGATGGAGGGAAGCTGG + Intergenic
1200143773 X:153915191-153915213 CTGTAGAGACGGACAGTGGAAGG + Intronic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic