ID: 930721213

View in Genome Browser
Species Human (GRCh38)
Location 2:54640017-54640039
Sequence CAGCATGTATAGTCTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930721207_930721213 13 Left 930721207 2:54639981-54640003 CCATAGTGTCTGTGGGAGGTGTC 0: 1
1: 0
2: 3
3: 2
4: 132
Right 930721213 2:54640017-54640039 CAGCATGTATAGTCTCTGCATGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930721213 Original CRISPR CAGCATGTATAGTCTCTGCA TGG Intronic
902218891 1:14952107-14952129 CAGCAGCCATGGTCTCTGCAAGG + Intronic
903078817 1:20792429-20792451 CAGAATGTATGGTCTTGGCAGGG + Intergenic
904773110 1:32892087-32892109 CAGCATTTACAGTCTTTGCCTGG - Intronic
910464964 1:87488957-87488979 TAGCATGTATAGTCTTTGAAAGG - Intergenic
912336055 1:108863947-108863969 CAGCATTTATTGTATCTCCAGGG + Intronic
912373147 1:109189079-109189101 CAGCAGGTTCAGTCCCTGCAGGG - Exonic
912557330 1:110525554-110525576 CAGCATGGACAGCCTCTGAAAGG - Intergenic
914359801 1:146924026-146924048 TAGCATGTATAGTCTTTGAAAGG - Intergenic
914493950 1:148175868-148175890 TAGCATGTATAGTCTTTGAAAGG + Intergenic
914948236 1:152085925-152085947 CAACATGGAGAGTCTGTGCAAGG - Exonic
917706567 1:177640760-177640782 CAGTATGTAAATTCTCTGCTAGG + Intergenic
922396255 1:225203940-225203962 AAGCATGTACTGTCTTTGCAGGG + Intronic
923617780 1:235552042-235552064 GAGCATGCATGGTCTCTACAGGG + Exonic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064565532 10:16635488-16635510 CAGAATGTATAGTAGCAGCATGG - Intronic
1065769965 10:29068993-29069015 CTGCAGGTTTATTCTCTGCATGG - Intergenic
1067746999 10:48943518-48943540 CAGCATGCAGAGCCTCTGCTAGG + Intronic
1067836046 10:49642453-49642475 CATCATGTGCAGGCTCTGCAGGG - Intronic
1072140882 10:92588173-92588195 CAGCCTGTATATTCACTGCCAGG + Intergenic
1080462961 11:32471733-32471755 AAGAGTGTATAGTCTCGGCAGGG + Intergenic
1081385420 11:42466610-42466632 CAATAAGTATAGTCTCTGCCAGG - Intergenic
1085821175 11:79795317-79795339 CAGAATGTACTGTCTCTCCAGGG + Intergenic
1088905425 11:114151813-114151835 CACCATGTCTACTCTCTGCAGGG - Intronic
1091537602 12:1427222-1427244 CAGTATGTGTAGTGTCTGCCAGG - Intronic
1099014659 12:77329752-77329774 CAGCTTTTAAAGTCTTTGCAGGG - Intergenic
1099586428 12:84522568-84522590 CAACATTTATATTCTATGCAGGG + Intergenic
1099672270 12:85709769-85709791 CAGCATCTTTGGTCTCTGCTAGG + Intergenic
1101368725 12:104103110-104103132 CATCATGTATAGTAACTGCTGGG + Exonic
1101856989 12:108452062-108452084 CAGCATTTTGAGTGTCTGCAAGG - Intergenic
1102777384 12:115532470-115532492 CAGCCTGTCTTGTCTCTGAAAGG + Intergenic
1103155100 12:118677909-118677931 CAGAATGAAAAGTCTCTGAAGGG + Intergenic
1117791724 14:59348902-59348924 CAGCATGAAGAGTTTCTCCATGG - Intronic
1119129738 14:72160755-72160777 CAGCACGGTTAGTCTCTGAAAGG - Intronic
1124888435 15:33709395-33709417 CAGCATGTACAGTAGCTGAAAGG + Intronic
1131955877 15:97735882-97735904 GAGCATGTATATCCTCTCCAGGG + Intergenic
1138127000 16:54447330-54447352 CTGCATGTCTACTCTCTGCTGGG - Intergenic
1139089528 16:63628683-63628705 GAGCATAGATAGTCTCTGAAAGG + Intergenic
1143232648 17:5370026-5370048 CAGCTTGAAAAGTGTCTGCAAGG - Intronic
1144096190 17:11902852-11902874 CAGCATGCAGAGGCGCTGCAGGG - Exonic
1147691438 17:42317625-42317647 GAGCCTGTGTAGTCTTTGCATGG + Intronic
1151164662 17:72193336-72193358 CAGCCTGTCTGGTCACTGCATGG - Intergenic
1154013637 18:10596903-10596925 CAGCATGTACATCCTATGCAGGG + Intergenic
1154502851 18:15005178-15005200 CACCAGATATGGTCTCTGCAGGG - Intergenic
1154510919 18:15100849-15100871 CAGCAGGTATAAACTCTGCCGGG + Intergenic
1157306209 18:46519425-46519447 CAGCATCTAGAATCTCTGCCAGG + Intronic
1161621654 19:5300884-5300906 CAGCACCTCTAGTCTCTGCAAGG - Intronic
1163258315 19:16171392-16171414 CACCAAGGATGGTCTCTGCAAGG - Intronic
925142588 2:1560147-1560169 CAGCAATTTTACTCTCTGCAGGG - Intergenic
925710264 2:6732140-6732162 CAGCATTTCTACTCTCTGGAGGG + Intergenic
929023791 2:37579371-37579393 CAGCATGTGTTCTGTCTGCATGG - Intergenic
929484508 2:42341883-42341905 GAGCAAGTCTAGTCTCTGGACGG + Intronic
929774167 2:44917820-44917842 CAGCTGGGAAAGTCTCTGCAAGG - Intergenic
930721213 2:54640017-54640039 CAGCATGTATAGTCTCTGCATGG + Intronic
931619564 2:64196228-64196250 CAGCATGTAAAGTCTATGTCTGG + Intergenic
937064154 2:119004679-119004701 CTGTATGTACAGTGTCTGCAAGG + Intergenic
938502019 2:131835348-131835370 CACCAGATATGGTCTCTGCAGGG - Intergenic
938506133 2:131885311-131885333 CAGCAGGTATAAACTCTGCTGGG + Intergenic
939063392 2:137451957-137451979 CAGCATGTATAGAGGCTGAATGG - Intronic
941570042 2:167159155-167159177 CAGCATGTGGAATCTCTCCATGG - Intronic
942828105 2:180205121-180205143 CAGCATGCACAGTGTATGCAAGG + Intergenic
1170560604 20:17554987-17555009 CTTCATGTAGAGTCTATGCATGG - Intronic
1170901798 20:20470534-20470556 CAGCATGTGTAATCTCCCCAAGG + Intronic
1172449766 20:35013766-35013788 CACCCTGTCTAGTCCCTGCAGGG - Intronic
1173430270 20:42981674-42981696 CAGCTTGTTTAGTTTCTGCTGGG - Intronic
1174142586 20:48426249-48426271 CAGCATGTTTAGTCACTTGAGGG + Intergenic
1174204636 20:48829284-48829306 GAGATTGTATCGTCTCTGCAGGG + Intergenic
1175372728 20:58503085-58503107 CAGCATTTACAGTCCCTGAAAGG + Intronic
1177986101 21:27977067-27977089 CAGCAGGTATAAGCTCTGCCGGG - Intergenic
1178273674 21:31216905-31216927 CAGCTTAAAAAGTCTCTGCATGG + Intronic
1181778328 22:25175802-25175824 CAGCATTTAGAGTCACTCCATGG - Intronic
951061446 3:18211471-18211493 CAGAATGTTTAATCTCTGAATGG + Intronic
953514460 3:43576589-43576611 CAACATCTATTTTCTCTGCAAGG + Intronic
953749954 3:45601398-45601420 CAGCTGGGATAGTCTCTTCAGGG + Intronic
955680752 3:61498932-61498954 TAGCATGTATAGTATGTGCGAGG + Intergenic
963501986 3:146138668-146138690 CAGAATGAATAGACTGTGCAGGG + Intronic
970947598 4:21713329-21713351 AAGCATCTAAAGTTTCTGCAAGG + Intronic
974786996 4:66631344-66631366 CAACATTCATAGTCTGTGCAGGG - Intergenic
977009827 4:91623318-91623340 ATGCATTTATAGTGTCTGCAGGG - Intergenic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
979237713 4:118420671-118420693 CAGCATCTCTGGTCTCTCCAAGG - Intergenic
985018013 4:185657554-185657576 CAGCATGCGCAGTCTCTGGATGG - Exonic
987924313 5:24320349-24320371 CAGCAAGTATAGTCATTTCAAGG - Intergenic
988855858 5:35227713-35227735 CAGCATGTACTCTCTCTCCATGG - Intronic
989335578 5:40312815-40312837 CTGAATGTATAGTTTCTGCCTGG + Intergenic
992876641 5:81062409-81062431 CAGTATGTATTGTCTCTGCTAGG + Intronic
995564822 5:113423263-113423285 TAACATGTATATTCTTTGCAAGG - Intronic
995792888 5:115911721-115911743 CAGCATGTATAATATTTGAAAGG - Intronic
997860026 5:137407910-137407932 CAGCAAGCATAGACCCTGCAGGG - Intronic
1000845351 5:166273004-166273026 CAGCAATTAAAGTCTCTGAAAGG - Intergenic
1009521129 6:64683065-64683087 CAGCAGCTAAAGTCTCTGCTGGG - Intronic
1010480557 6:76347806-76347828 AAGCATGTACAGTAACTGCAAGG + Intergenic
1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG + Intergenic
1013633921 6:112010570-112010592 CTCCATGTTTAGTCTCTGCGTGG - Intergenic
1014103023 6:117532536-117532558 CAGCATTTCTGGTCTCTGCATGG + Intronic
1021790501 7:24199931-24199953 CAGCATGTGAAATCTCTGCCAGG - Intergenic
1022892595 7:34716313-34716335 CACCAAGTATAGTGTCTGGAGGG - Intronic
1023249041 7:38237795-38237817 GAGCCTGTTTAGTCTCTGGAAGG + Intergenic
1026238736 7:68553024-68553046 GAGCATGTATAATTTCTACAGGG - Intergenic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028727093 7:94100697-94100719 TAGCATGTGTAATCTGTGCATGG - Intergenic
1032369765 7:131335873-131335895 CAGAATGCATAGTCTTTTCAAGG - Intronic
1033028044 7:137795888-137795910 CAGCATCTAAAATCTCTGCTTGG - Intronic
1035630014 8:1100110-1100132 CAGCATGTACAGTGTGTGTAGGG + Intergenic
1041675608 8:60535814-60535836 CACCATGTATTGTCTCTTGATGG + Intronic
1045556304 8:103217973-103217995 AAGCATTTATAGACTCTGAATGG + Intronic
1047572537 8:126115464-126115486 CAGCATAAAGAGTTTCTGCAAGG - Intergenic
1051767013 9:20535622-20535644 CAGCAGGAAGAGACTCTGCAAGG + Intronic
1052155090 9:25177499-25177521 CATCATATATGGTCTTTGCAAGG + Intergenic
1056568360 9:87794699-87794721 CAACATGAATTGTTTCTGCAGGG + Intergenic
1058772842 9:108254536-108254558 CAGTCTGTGTAGTCTCTGAATGG + Intergenic
1186082540 X:5948976-5948998 CACCATGCATAGCCTCTCCATGG + Intronic
1187385982 X:18848954-18848976 CAGCCTGTAAACTCTCTGAAGGG - Intergenic
1188375597 X:29424402-29424424 AAGCCAGTATAGTCTCTGGAAGG + Intronic
1192171490 X:68858159-68858181 TAGCATGTACGCTCTCTGCAAGG - Intergenic
1192911456 X:75608930-75608952 AAGCATGAATAGTCATTGCACGG + Intergenic
1193672982 X:84412658-84412680 CATCTTGTATAGTATCTCCAAGG + Intronic
1196119772 X:112037334-112037356 CAGCAGGTATAATCTTTGAATGG - Intronic
1196945744 X:120823783-120823805 CATCCTGTATATTCTCTGTAGGG + Intergenic
1197673739 X:129307857-129307879 AAGCCTGTATGGTCTCTTCAAGG - Intergenic
1198282909 X:135160077-135160099 CTGCAAGTATAGTCTTTGAAGGG + Intronic
1198285232 X:135183291-135183313 CTGCAAGTATAGTCTTTGAAGGG + Intergenic
1198288036 X:135212434-135212456 CTGCAAGTATAGTCTTTGAAGGG - Intergenic
1202385495 Y:24322474-24322496 CAGCATCTCTGGTCTCTACAAGG - Intergenic
1202485291 Y:25347654-25347676 CAGCATCTCTGGTCTCTACAAGG + Intergenic