ID: 930722942

View in Genome Browser
Species Human (GRCh38)
Location 2:54655483-54655505
Sequence CTGATCTAGGGCATAGTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930722942_930722946 0 Left 930722942 2:54655483-54655505 CCATTGACTATGCCCTAGATCAG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 930722946 2:54655506-54655528 TTTGCTGTTGAGTGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 178
930722942_930722948 14 Left 930722942 2:54655483-54655505 CCATTGACTATGCCCTAGATCAG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 930722948 2:54655520-54655542 CATGGTTGGTGATTCTGGTTAGG 0: 1
1: 0
2: 2
3: 21
4: 152
930722942_930722947 9 Left 930722942 2:54655483-54655505 CCATTGACTATGCCCTAGATCAG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 930722947 2:54655515-54655537 GAGTGCATGGTTGGTGATTCTGG 0: 1
1: 0
2: 0
3: 9
4: 89
930722942_930722950 21 Left 930722942 2:54655483-54655505 CCATTGACTATGCCCTAGATCAG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 930722950 2:54655527-54655549 GGTGATTCTGGTTAGGATGGTGG 0: 1
1: 0
2: 1
3: 30
4: 323
930722942_930722949 18 Left 930722942 2:54655483-54655505 CCATTGACTATGCCCTAGATCAG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 930722949 2:54655524-54655546 GTTGGTGATTCTGGTTAGGATGG 0: 1
1: 0
2: 0
3: 9
4: 182
930722942_930722945 -4 Left 930722942 2:54655483-54655505 CCATTGACTATGCCCTAGATCAG 0: 1
1: 0
2: 2
3: 13
4: 82
Right 930722945 2:54655502-54655524 TCAGTTTGCTGTTGAGTGCATGG 0: 1
1: 0
2: 2
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930722942 Original CRISPR CTGATCTAGGGCATAGTCAA TGG (reversed) Intronic
900077750 1:831808-831830 CTTATCTAGGGCTGAGTCATGGG + Intergenic
908758286 1:67489172-67489194 CTTATCTAGGGCAGTGGCAATGG - Intergenic
915943282 1:160132477-160132499 CTGAACTAGGGCAGAAACAAAGG + Intronic
920282311 1:204853476-204853498 CTTACCTAGGGCTTAGTCACTGG + Intronic
920761473 1:208787245-208787267 CTGAACTCGAGCATAGTCCATGG + Intergenic
1069794013 10:71040946-71040968 CTGATCTAGGGACTGGTCATGGG + Intergenic
1070260661 10:74851932-74851954 CTGCTCTAGGGCAGGGTTAAGGG - Intronic
1073619910 10:105036085-105036107 CTGATCCAGGGCCAAGTGAATGG + Intronic
1079725773 11:23879064-23879086 CTGATCTTTGGCACAGTCAATGG - Intergenic
1091975873 12:4824571-4824593 CTGATCTCGGGGATTCTCAATGG - Intronic
1093004190 12:14034332-14034354 AAGATCTAGGGTATAGACAATGG - Intergenic
1093381804 12:18501872-18501894 CTAATTTTGGGCATGGTCAAAGG + Intronic
1093514430 12:19969463-19969485 CTGAACTAGGGCAGTGGCAATGG - Intergenic
1095839976 12:46682411-46682433 ATGTTCTAGGATATAGTCAAAGG + Intergenic
1097324002 12:58255400-58255422 CTGAACTAGGGCATTATCCATGG - Intergenic
1098789593 12:74804756-74804778 ATGATTTAGGGCATAGGCATGGG + Intergenic
1100014761 12:89995986-89996008 TTGATCTGGGGCATGGTCCAGGG - Intergenic
1106417006 13:29554168-29554190 CAAATCTAGGGCATAGTCGTAGG + Intronic
1107031470 13:35858200-35858222 CTGATCTAGGGTAGTGTCATGGG + Intronic
1107559128 13:41544859-41544881 GTGGTTTAGGGCACAGTCAAAGG - Intergenic
1112602526 13:100870233-100870255 CTGCTGTAGGCCACAGTCAAAGG - Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1130242286 15:82205970-82205992 CTGATCTGGGTGATAGACAAGGG + Intronic
1130458093 15:84134852-84134874 CTGATCTGGGTGATAGACAAGGG - Intergenic
1133519274 16:6541526-6541548 CTGAGATAGGGCATAGTGAATGG + Intronic
1141465144 16:84200592-84200614 CTGCTCCAGGGCATAGGAAAAGG - Intergenic
1141706831 16:85670176-85670198 CTGATCTAAGGAATAATCACAGG - Intronic
1141952615 16:87348505-87348527 CTGATCTGGGGCATGGTCCCAGG + Intronic
1142280860 16:89146861-89146883 CTGAGCTATGGCCTTGTCAAAGG + Intronic
1143987811 17:10930190-10930212 CTGAACTAGGGCATTGGCATAGG + Intergenic
1147614114 17:41818428-41818450 CTGATCAAGGGCATGGACCAGGG + Exonic
1151295025 17:73178866-73178888 CAGATCAAGGGCATAGTTAAAGG - Intergenic
1159895252 18:73989917-73989939 CTGGTCTAGGGAAAAGTCCAGGG - Intergenic
926163230 2:10502429-10502451 CTGAACTAGGGCAGAGAGAAAGG - Intergenic
926367665 2:12147938-12147960 TTGACTTAGGGCATAGTCATTGG - Intergenic
926384891 2:12326303-12326325 CTGAACTAGGGAATTGACAATGG + Intergenic
927228569 2:20796626-20796648 CTGATCCAGGGTGTAGTCATGGG - Intronic
930722942 2:54655483-54655505 CTGATCTAGGGCATAGTCAATGG - Intronic
932095228 2:68841342-68841364 GTGATCAAGGACATAATCAAAGG - Intergenic
942963580 2:181862216-181862238 CTCATCAAGGGCAGAGTCAGAGG + Intergenic
1170079551 20:12457317-12457339 CTTCTCTAGGGCACAGTCAGAGG + Intergenic
1171168503 20:22994427-22994449 CTGAGCCATGGGATAGTCAAAGG + Intergenic
1173654762 20:44691951-44691973 ATGATCTAGGGCATAGTGTCAGG - Intergenic
1175795452 20:61767694-61767716 CTGAAGCAGGGCAGAGTCAAAGG + Intronic
1178921105 21:36738820-36738842 CTGCTCAAGGGTATAGGCAAAGG - Intronic
1179442185 21:41403001-41403023 CTGATGTAAGGAATAGTCAGAGG + Intronic
951413425 3:22393609-22393631 CAGATCTTGGGCAGAGTTAAGGG + Intergenic
952747162 3:36792342-36792364 CAGATCCAGGGCATAGCCAGAGG + Intergenic
957023297 3:75149243-75149265 GTTACCCAGGGCATAGTCAAAGG + Intergenic
959232112 3:103667692-103667714 CTGATTTAGGGCATAGCCCTTGG + Intergenic
961118998 3:124357218-124357240 CTGATCTAAGGCAGTGGCAATGG - Intronic
962017058 3:131452677-131452699 GTGATCTAGGGCACATTCCAGGG - Intergenic
966405248 3:179590798-179590820 CTGCACTAGGGCAAAGACAATGG + Intronic
967570044 3:191017750-191017772 CTGATATAGGGAATATTCAATGG + Intergenic
969042656 4:4312787-4312809 CTGAACTAGGACACAGCCAAGGG + Intronic
970366391 4:15362873-15362895 TTGATGTAGAGCATACTCAAGGG - Intronic
970767986 4:19574267-19574289 CTCATCTAGGGCACAGACAATGG + Intergenic
970876738 4:20879347-20879369 CAGATCTATGCCATAGCCAATGG - Intronic
970879267 4:20909099-20909121 CAGATCTAGAGCATATTCAGAGG - Intronic
973033310 4:45372394-45372416 CTGATTTAGGGCATCTACAACGG - Intergenic
975439401 4:74393860-74393882 CTGGCCCAGGGCATACTCAATGG + Intergenic
984228178 4:177061233-177061255 CAGATATAGGGCACTGTCAATGG + Intergenic
988976772 5:36523875-36523897 CTGATCAAGGGCACAGGCAAGGG - Intergenic
993709624 5:91211856-91211878 CTGAGCAAGGGCAGAGTCAGAGG - Intergenic
995273495 5:110250565-110250587 ATGATAAAGGGCATAGTCACTGG - Intergenic
997838127 5:137213095-137213117 ATAATCTGGGGCATAGTCATGGG + Intronic
1005057725 6:21745723-21745745 CTGGTCTTGAGCATAGTGAATGG - Intergenic
1005360352 6:25025227-25025249 TTGATCTAAGATATAGTCAAGGG + Intronic
1008105774 6:47439816-47439838 CAGAGTTAGGGCATAGTAAAGGG - Intergenic
1008969922 6:57355602-57355624 CTGATTTAGGGCAAAGACTAGGG + Intronic
1009158889 6:60257412-60257434 CTGATTTAGGGCAAAGACTAGGG + Intergenic
1010478522 6:76320120-76320142 CTGATCTAAGGAACAGTTAAAGG + Intergenic
1016442687 6:144100330-144100352 CTGCTCTAGGGCATATACATAGG + Intergenic
1021929993 7:25570841-25570863 CTCTTCTTGGGCATAGTGAAGGG + Intergenic
1034252986 7:149706951-149706973 CTGAACTACAGCATAGTCAGAGG + Intergenic
1035527872 8:327829-327851 CTTATCTAGGGCTGAGTCATGGG - Intergenic
1045280220 8:100743499-100743521 CTGATCTAGGGCAGAGTCCAGGG - Intergenic
1045666172 8:104487303-104487325 CTGTTCTAGGGCATTGTAAAAGG + Intergenic
1045992377 8:108324156-108324178 ATGATCTAGGCCAAAGTCAGTGG + Intronic
1050571681 9:6946985-6947007 CTGGTCTAAGTCATAGTGAAGGG + Intronic
1051084835 9:13336603-13336625 CTGGTTTAGGGCAAAGTAAATGG - Intergenic
1051392805 9:16584398-16584420 CTGATCTAAAGCATAGGGAATGG - Intronic
1190176086 X:48151081-48151103 GAGATCTAGGGCATAGCGAACGG + Intergenic
1190182048 X:48200876-48200898 GAGATCTAGGGCATAGTCAATGG - Intronic
1190186758 X:48241782-48241804 GGGATCTAGGGCATAGTGAACGG + Intronic
1190187430 X:48247906-48247928 GAGATCTAGGGCATAGTGAAGGG - Intronic
1190195191 X:48311598-48311620 GAGATCTAGGGCACAGTGAATGG - Intergenic
1190201146 X:48362347-48362369 GAGATCTAGGGCATAGTGAATGG - Intergenic
1190477345 X:50841174-50841196 CTGATCTATAGAAAAGTCAAGGG + Intergenic
1190656312 X:52615670-52615692 GAGATCTAGGGTATAGTGAATGG - Intergenic
1190661632 X:52659817-52659839 GAGATCTAGGGCATAGTGAACGG - Intronic
1190667976 X:52712807-52712829 GAGATCTAGGGCATAGTGAATGG - Intergenic
1190671441 X:52745597-52745619 GAGATCTAGGGCATAGTGAATGG + Intergenic
1192829187 X:74732339-74732361 CTGAGCTAGGGCACACTCAGAGG + Intergenic
1194905056 X:99565613-99565635 CTGAGCTAGGGCATAGAGAGTGG - Intergenic
1195158401 X:102145313-102145335 CTAATCTGGGGCATAGAGAATGG + Intergenic
1195931808 X:110085536-110085558 CTGAGCTTGAGGATAGTCAAAGG - Intronic
1198659716 X:138955062-138955084 GAGATCTAGGGGATAGTCACAGG - Intronic