ID: 930722954

View in Genome Browser
Species Human (GRCh38)
Location 2:54655573-54655595
Sequence TGCGTGTGTGGCCCCCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930722954 Original CRISPR TGCGTGTGTGGCCCCCTGCA TGG Intronic
901849069 1:12003868-12003890 TGCGTGTGTGCAGCCCTGCCAGG + Intronic
902168058 1:14588556-14588578 TGAGTCTGTGCCCCCCAGCAGGG + Intergenic
903032707 1:20475231-20475253 TGTGTGCCTGGCCCCATGCAGGG - Intergenic
906718880 1:47991274-47991296 AGCGTGTGGAGCCTCCTGCAGGG + Intronic
920039936 1:203089026-203089048 TGCTGCTGTGGTCCCCTGCAGGG - Intergenic
920719103 1:208370241-208370263 TGCGTGTGTGCCCTCCTGGTGGG - Intergenic
922800860 1:228364242-228364264 TGCTTCTGTGGCCTCCCGCAGGG + Intronic
1063144486 10:3284399-3284421 TGCGTGTTGGGGCCCCAGCAGGG + Intergenic
1067378193 10:45747732-45747754 TGGGTGTGTGGCACCATGCCCGG + Intronic
1067885894 10:50088407-50088429 TGGGTGTGTGGCACCATGCCCGG + Intronic
1070704746 10:78629508-78629530 GGCTTGTGTGGTCTCCTGCAGGG - Intergenic
1073136149 10:101221756-101221778 TGTGTGTGTGGCAGGCTGCATGG - Intergenic
1073380780 10:103076567-103076589 TGGGTGCGTGGCTCCCTGCCTGG + Intronic
1074833354 10:117265332-117265354 TGAGTGTGTGGCCAGCTGCTGGG + Intronic
1075297733 10:121292862-121292884 TGAGTGTGTGTCTCTCTGCATGG - Intergenic
1075477822 10:122751659-122751681 TGAGTGTGTGGCCCCCACCGTGG - Intergenic
1076944705 10:133637976-133637998 TGCGGGCGTGGCCCCCTCCAGGG - Intergenic
1082814542 11:57499515-57499537 AGCGTTTGTGGCCCCTTGGAGGG - Intronic
1082900422 11:58243906-58243928 TGCGTGTGTGTCTCCTTGCCTGG + Intergenic
1085044179 11:73343730-73343752 TCAGTGTGTGTACCCCTGCAGGG + Intronic
1085471386 11:76760539-76760561 TGCATGTGTGTGCCCATGCAAGG - Intergenic
1088555569 11:111057323-111057345 TGCACATGTGGCCCCTTGCAAGG + Intergenic
1092524646 12:9302307-9302329 TCCCTTGGTGGCCCCCTGCATGG + Intergenic
1092542619 12:9429505-9429527 TCCCTTGGTGGCCCCCTGCATGG - Intergenic
1092903644 12:13083104-13083126 TGGGTGGGTGGCTGCCTGCAAGG - Exonic
1096407639 12:51355350-51355372 TGTGTGTGTGGCCACAGGCAGGG - Intronic
1096625148 12:52890561-52890583 TGCATGGCTGGCCCCCTGCTTGG - Intergenic
1097152035 12:56986290-56986312 TGTGTGTGTGGGCCCCTGTGTGG - Intergenic
1097342397 12:58454114-58454136 AGGGTGTGTGGGCCCCTCCAGGG - Intergenic
1101011891 12:100459245-100459267 TACGTGTGTGCACCCCTGCCAGG - Intergenic
1101837050 12:108303092-108303114 TGCATGTTTGGCCCCCTGCCTGG - Intronic
1102701579 12:114843865-114843887 TGAGACTGTGGCCCCCTACAGGG - Intergenic
1104376247 12:128267305-128267327 TGCGGGAGTGGCCCCGGGCATGG + Intergenic
1104432477 12:128727746-128727768 TGCACATGTGCCCCCCTGCAAGG - Intergenic
1106021047 13:25915667-25915689 TGCATGAGTTGGCCCCTGCAGGG + Intronic
1119703788 14:76771793-76771815 CCCGTGTGTAGCCCCCTGCCTGG + Intronic
1122811506 14:104291674-104291696 TGCCTGTGTGGCCTGCTGCAGGG + Intergenic
1126433765 15:48614533-48614555 AGCATGTGTGGTGCCCTGCAGGG - Intronic
1129034357 15:72640654-72640676 TGGGAGTGGGGCTCCCTGCATGG + Intergenic
1129215525 15:74096562-74096584 TGGGAGTGGGGCTCCCTGCATGG - Intergenic
1129392433 15:75227036-75227058 TGGGTGTGTGTCCCACTCCAGGG - Intergenic
1129471959 15:75761148-75761170 TGGGTGTGTGTCCCACTCCAGGG + Intergenic
1132545342 16:530525-530547 TGCATGTGTGTCTCGCTGCAGGG + Intronic
1132689276 16:1175286-1175308 TGCATGTGGGGTCCCCTGCTGGG + Intronic
1132908575 16:2297030-2297052 TGCGTGTGTTGGCCTCTCCAAGG + Intronic
1133155111 16:3868845-3868867 TACGTGTGGGGCACCCTGCTGGG - Intronic
1137274475 16:46924477-46924499 GGCGTACATGGCCCCCTGCAAGG - Exonic
1141649180 16:85384130-85384152 TGAGTCTGTGCCCCCCTGTAAGG - Intergenic
1145268286 17:21391040-21391062 TGTGTGCGTGGGGCCCTGCACGG + Intronic
1149434497 17:56621586-56621608 TGTGTGTGTAGCCCCCTCAAAGG + Intergenic
1151935448 17:77258178-77258200 CCCGTGTGTGGCCCACAGCAAGG + Intergenic
1152362709 17:79839844-79839866 TGCTTCCGTGGCCCCCAGCAGGG - Intergenic
1152521598 17:80859763-80859785 TGTGTGTGTGGCGCCCTGTCAGG + Intronic
1156228166 18:35129301-35129323 TGCCTGTGGGGCCCCCTACCAGG - Intronic
1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG + Intronic
1156676158 18:39529492-39529514 TGCCTGTGTGTCCACCTGCTCGG - Intergenic
1156915470 18:42461415-42461437 TGGGAGTCTGGCCCCCAGCATGG + Intergenic
1160515951 18:79479325-79479347 GGCCTGTGCGGCCCCCTCCACGG + Intronic
1160521279 18:79509520-79509542 TGCATGTGAGGCCCACGGCATGG - Intronic
1161123011 19:2540516-2540538 TGGGTGCGTGGGCCCCTGCTCGG + Intronic
1161505431 19:4641002-4641024 TGAGTGCCTGGACCCCTGCAGGG + Intronic
1161967696 19:7557396-7557418 TGTGTGTCTGCACCCCTGCATGG - Intronic
1164678529 19:30119017-30119039 TGCGTTTGTGACCCCGTGAAAGG + Intergenic
1164990865 19:32682522-32682544 TGGGTGTGTCTCCTCCTGCAAGG + Intergenic
1165100921 19:33438318-33438340 TTGGTCTGGGGCCCCCTGCAGGG - Intronic
1165108361 19:33487431-33487453 TGGGTGGATGGCCCCCTGCAGGG + Intronic
1165827471 19:38713518-38713540 TGGGTGTGTGTCCCGCAGCATGG + Intronic
1166417547 19:42607080-42607102 TGAGTGTGCGGCCCCGTGCACGG - Intronic
1167650852 19:50727834-50727856 TGCTTGTGTGGCATCATGCAGGG + Intergenic
925637054 2:5950840-5950862 TGTGTGTGTGTGCCCCTGTATGG + Intergenic
925660677 2:6199056-6199078 TGGGTGTGTGGCATCCTTCATGG - Intergenic
926910985 2:17852353-17852375 TGAGTGTGTGGTTCCCTGCGTGG + Intergenic
927722151 2:25390588-25390610 TGCGTGTGTGCCACCATGCCTGG + Intronic
930722954 2:54655573-54655595 TGCGTGTGTGGCCCCCTGCATGG + Intronic
934952207 2:98584457-98584479 TGCTTCTGTGGCACCCTCCAGGG + Intronic
935082238 2:99809409-99809431 TGTATGTGTGACCCCCAGCAGGG - Intronic
937855558 2:126670095-126670117 TGCGTGTGAGGCCCTCCCCAAGG + Intronic
947854018 2:233311178-233311200 TGTCTGTGTGGCCCCAGGCATGG + Intronic
948631034 2:239302917-239302939 AGCCTGTGTGGCCCCCTGCTTGG - Intronic
948865465 2:240772703-240772725 TGGGTGTGTGGCCACAAGCAGGG + Intronic
948920417 2:241063710-241063732 TGCATGTGGGGCCCACTGGAGGG - Intronic
1169266883 20:4172391-4172413 TGAGGATGTGGCCGCCTGCACGG - Intronic
1172130659 20:32652707-32652729 TGCGTGTCTGGCTACCTGGAAGG - Intergenic
1175812672 20:61867085-61867107 TGTGTGTGTGGGCACCTGGAAGG - Intronic
1176228325 20:64016746-64016768 TGGGAGTGTGGCCACCTGCCAGG + Exonic
1176292673 21:5054558-5054580 TGCGTGAATGTCCACCTGCATGG - Intergenic
1176386562 21:6141014-6141036 TGCTTCTGTGGCCCCCTTCAGGG - Intergenic
1176887379 21:14272848-14272870 TGCTTGTTTGGCCCTATGCAAGG - Intergenic
1179736911 21:43397238-43397260 TGCTTCTGTGGCCCCCTTCAGGG + Intergenic
1179864587 21:44209092-44209114 TGCGTGAATGTCCACCTGCATGG + Intergenic
1181080573 22:20412100-20412122 TGTGTGTGTGGCCTCCTCCAGGG - Intergenic
1181494614 22:23280951-23280973 TGTGTGTGTGTTCCCATGCAAGG - Intronic
1182039985 22:27230506-27230528 TGTGTCTGTGGCCAGCTGCAGGG + Intergenic
1184666603 22:45992596-45992618 TGGCTGTGTGGCCCCATGCGTGG - Intergenic
1184727049 22:46353279-46353301 TGCCTGTGTGCCCCACTGCAGGG + Intronic
1185070449 22:48653001-48653023 TGCTGGTGTGGCCCTCTGCTTGG + Intronic
1185318043 22:50187174-50187196 AGCCTGTGGGGCCCCCTGCATGG + Intronic
952888092 3:38024183-38024205 TGAGTGTGTGGCCCACTGTGGGG - Intronic
953743842 3:45558081-45558103 AGCGTGTGTTTCGCCCTGCATGG + Intronic
960055706 3:113274872-113274894 TGGGTGTGTGGGACCCTGGAAGG + Intronic
961234837 3:125357288-125357310 TGCGCGTGCGCCCCTCTGCAGGG - Intronic
961259209 3:125586657-125586679 TGCGTGTGTGCCACCATGCCTGG + Intronic
963655856 3:148049419-148049441 TGAGGGTGTGGCCCTCTCCAGGG - Intergenic
964477011 3:157106442-157106464 AGTGTGTGTGGTCCCCTGTAAGG - Intergenic
967633483 3:191774576-191774598 TAAGTGTGTGGCCAACTGCATGG - Intergenic
969049750 4:4364248-4364270 TTCCTGTGTGGCCCCAGGCATGG + Intronic
974368589 4:60985397-60985419 TGCGTGTGTCCCCTCCTGTAAGG - Intergenic
977226669 4:94400003-94400025 TAAGTGTGTGGGCCCCTGGAAGG + Intergenic
977672227 4:99709079-99709101 TGTGTGTGTTGCTCTCTGCATGG - Intergenic
977794011 4:101141090-101141112 ACCATGTGTGGCCCACTGCAGGG - Intronic
981228781 4:142328101-142328123 AGTGTCTGTGGCCCACTGCATGG + Intronic
982316341 4:154035885-154035907 TGCATGAGTGGGTCCCTGCAGGG - Intergenic
985448091 4:190038486-190038508 TGCGGGCGTGGCCCCCTCCAGGG - Intergenic
985833679 5:2254923-2254945 TGCGTGGGTGGGCACGTGCAGGG + Intergenic
986290628 5:6396527-6396549 TGAGTGTGTGGCCCTGTGCGTGG + Intergenic
991244066 5:64490147-64490169 TGTGTGTGCAGCCCACTGCATGG + Intergenic
992014064 5:72558138-72558160 TGCGTATGTGGCCCCTTTCCTGG + Intergenic
1001309984 5:170603674-170603696 TGCTTGTGTGGCCCTGTGCTGGG - Intronic
1003131187 6:3396585-3396607 TGCCTGTGTGCCTCCCTGCTAGG - Intronic
1004252288 6:14032618-14032640 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252297 6:14032657-14032679 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252307 6:14032696-14032718 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252316 6:14032735-14032757 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252332 6:14032811-14032833 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252341 6:14032850-14032872 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252357 6:14032926-14032948 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1004252374 6:14033004-14033026 TGCAGGTGATGCCCCCTGCATGG + Intergenic
1006722288 6:36164111-36164133 TGCGTGTGTGGCACCACACATGG + Intergenic
1013426964 6:110021076-110021098 TTCCTGTGTGGCTCTCTGCATGG - Intergenic
1013601899 6:111712800-111712822 TGCCTGTGTGGCCACCAGCCAGG - Intronic
1016658098 6:146543819-146543841 TCCGAGTCTGGCCCCCTGCCCGG - Exonic
1018247746 6:161838925-161838947 TGCTTGTCAGGCCCCTTGCAGGG - Intronic
1018372369 6:163179889-163179911 TGCCTGTGTGGCCTCGGGCAAGG - Intronic
1023939801 7:44762113-44762135 AGCATGTGTGCCCCCTTGCAGGG + Intronic
1026456022 7:70573254-70573276 TGCGTCTGTGGCCACCTCCGGGG - Intronic
1032792371 7:135252037-135252059 TGTGTGTGTGCACCCCTGCTGGG + Intronic
1034959236 7:155354343-155354365 TGTGTGTGTGTGCACCTGCATGG - Intergenic
1035468687 7:159096239-159096261 GGAGTGTGTGGCCCCAGGCAGGG - Intronic
1036591402 8:10172211-10172233 TTGGTGTGTGTCACCCTGCATGG + Intronic
1036659522 8:10699093-10699115 TATGTCTCTGGCCCCCTGCAGGG + Intronic
1037832800 8:22199121-22199143 GGCGTGTGTGTCTCCGTGCAGGG - Intronic
1039869938 8:41537477-41537499 AACGTGTGTGGCCCACTGCGGGG + Intronic
1040059560 8:43092970-43092992 TGCGTGTTGGGCTCCCGGCAGGG + Intergenic
1049043312 8:140129264-140129286 GGTGTGTCTGGCCCCTTGCAAGG + Intronic
1055497302 9:76868400-76868422 TGTATGTGTGGACACCTGCAAGG - Intronic
1056679751 9:88706657-88706679 TGTGTGGGAGGCTCCCTGCATGG + Intergenic
1058312110 9:103516099-103516121 TGTGTGTGTGTACACCTGCAGGG + Intergenic
1061227228 9:129287725-129287747 TGCGTGCCTGGCCCTCAGCAGGG + Intergenic
1061818203 9:133208447-133208469 TGTGAGTGTTGCCCACTGCAGGG - Exonic
1061902521 9:133680362-133680384 TGCCTGTGAGGCCCCCTACAGGG + Intronic
1062059943 9:134489875-134489897 AGCGAGTGTGGCCCCGTGCACGG - Intergenic
1062242253 9:135546911-135546933 TGTGAGTGTTGCCCACTGCAGGG + Exonic
1185466926 X:360765-360787 TGCGTGTCTGGACCCCTGGTGGG - Intronic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1186470321 X:9816447-9816469 GGTGGGTGTGGGCCCCTGCAGGG + Intronic
1186509217 X:10117695-10117717 TGCGGATGTGGCCTCCTGCGGGG + Intronic
1189214169 X:39309106-39309128 TCTGTGTGACGCCCCCTGCAAGG + Intergenic
1195108796 X:101624771-101624793 TGCTTGTGTTGCCCCATGCAGGG - Intronic
1198159140 X:133989704-133989726 TGCGTGTGTGGCCATGTGCACGG - Intergenic
1199529452 X:148830401-148830423 TGGCTGTGTGGCTCCCTCCATGG + Intronic
1200067914 X:153513666-153513688 TGTGTGTGTGTCTCCGTGCATGG + Intergenic
1200067920 X:153513888-153513910 TGTGTGTGTGTCTCCGTGCATGG + Intergenic