ID: 930722977

View in Genome Browser
Species Human (GRCh38)
Location 2:54655679-54655701
Sequence CACGACAAAACAGCTTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930722969_930722977 12 Left 930722969 2:54655644-54655666 CCTCTCCTGAACGTGTTTGCCGC 0: 1
1: 0
2: 0
3: 3
4: 195
Right 930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76
930722973_930722977 -7 Left 930722973 2:54655663-54655685 CCGCAGGGAGCCTCCTCACGACA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76
930722968_930722977 13 Left 930722968 2:54655643-54655665 CCCTCTCCTGAACGTGTTTGCCG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76
930722972_930722977 7 Left 930722972 2:54655649-54655671 CCTGAACGTGTTTGCCGCAGGGA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76
930722967_930722977 25 Left 930722967 2:54655631-54655653 CCGTCTTGCTGTCCCTCTCCTGA 0: 1
1: 0
2: 5
3: 65
4: 622
Right 930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930722977 Original CRISPR CACGACAAAACAGCTTTGGC AGG Intronic
911194814 1:94983482-94983504 CAAGACAACACAGCTCTGCCTGG - Intronic
923544421 1:234913933-234913955 AACAACAGAACGGCTTTGGCGGG - Intergenic
924786269 1:247202806-247202828 CACAACAGAAATGCTTTGGCCGG + Intergenic
1066295140 10:34047584-34047606 CACCAGAAAACAGCAGTGGCAGG + Intergenic
1067156641 10:43786883-43786905 CACGACAAAACAGAATTGCTGGG - Intergenic
1071460478 10:85889102-85889124 CAAGTTAAAACAGCTTTGCCTGG + Intronic
1073591850 10:104765354-104765376 CACGACCATACAGCTTTGTAAGG - Intronic
1076007463 10:126959301-126959323 CCCCACAAAACAGCTTTGCAGGG + Intronic
1082866534 11:57904726-57904748 AACGACAAAACAGATTTGTCAGG + Intergenic
1083525469 11:63360943-63360965 CAGGACATATCAGCTTAGGCAGG - Intronic
1092220826 12:6712121-6712143 AAAGAAAAATCAGCTTTGGCTGG + Intergenic
1097086275 12:56470619-56470641 CAAGAATAAACAGTTTTGGCCGG - Exonic
1098020100 12:66146001-66146023 CAATACAAAACAGCTTTTTCTGG + Intronic
1100386795 12:94111335-94111357 CACAACAAAACAGATGTTGCTGG + Intergenic
1102063481 12:109953015-109953037 CACTGCACAGCAGCTTTGGCAGG + Intronic
1103971995 12:124678342-124678364 AATAACAAAACAGCTTTGGGAGG - Intergenic
1117321812 14:54631527-54631549 CAAGACAAAGCAACTTTGGAGGG + Intronic
1118256187 14:64208147-64208169 CAAGCCACCACAGCTTTGGCTGG + Intronic
1120203573 14:81564070-81564092 CTCATCAAAGCAGCTTTGGCAGG - Intergenic
1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG + Intronic
1143081119 17:4382128-4382150 CATGACAAAACTGAATTGGCAGG - Intergenic
1144859163 17:18289309-18289331 AACAACAAAACAGATCTGGCTGG - Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1151686639 17:75651048-75651070 CCCGACACAACAGCCTTTGCAGG + Intronic
1156141745 18:34120493-34120515 CACCACAAAATAACTTTGGATGG - Intronic
1157088543 18:44607667-44607689 CACAACAAAAGGGTTTTGGCTGG + Intergenic
1161866843 19:6839195-6839217 CACAAAAAAACAGCTGCGGCTGG - Intronic
1163488579 19:17604198-17604220 CTTCACAAAACAGCTTTTGCAGG + Exonic
1165700232 19:37932021-37932043 CACAACTGAACGGCTTTGGCTGG - Intronic
1167850919 19:52201176-52201198 CACGTCAAAACAGTCTTTGCAGG - Intronic
926023706 2:9519879-9519901 CATGACAAAGCAGCATAGGCTGG - Intronic
927734032 2:25502338-25502360 GAAGAGAAAACAACTTTGGCTGG + Intronic
929217725 2:39433939-39433961 CACAACAAAACAGCTCTGAGAGG + Intronic
929900136 2:45993541-45993563 CCTGACAAAACAACTTGGGCTGG - Intronic
930601707 2:53451326-53451348 CACTGCAAAATAGCTTTTGCAGG + Intergenic
930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG + Intronic
931225206 2:60323420-60323442 CATAACATGACAGCTTTGGCTGG + Intergenic
932992996 2:76811412-76811434 AAGGACAAAACAACATTGGCTGG + Intronic
936036655 2:109118329-109118351 CACGACAACACAGCTATCCCAGG + Intergenic
942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG + Intergenic
944010011 2:194964230-194964252 CAAGAGAAAACAGCTTATGCAGG + Intergenic
944235339 2:197437039-197437061 CACCACAAAATAGCTTTACCAGG - Intergenic
1176874096 21:14109766-14109788 CATCACAAAACAGCTTAGGCAGG + Intronic
1181449673 22:23011204-23011226 CACTAGAAATCAGCTTGGGCTGG + Intergenic
1185086556 22:48744047-48744069 CTCGACAGAACAGCCTTGGCAGG - Intronic
952720371 3:36526131-36526153 CAGGACAAAACAGCTATAGAAGG + Intronic
954220779 3:49152524-49152546 AACAAAAAAACACCTTTGGCCGG + Intergenic
959947847 3:112145898-112145920 CAAGAGAAGACAGCTTGGGCAGG - Intronic
962321929 3:134397408-134397430 CAAAACAAAACAGTCTTGGCCGG + Intergenic
962900401 3:139756561-139756583 CAGCACAAAACAACTTTGTCTGG - Intergenic
965403727 3:168245671-168245693 CAGGACTGAAAAGCTTTGGCTGG + Intergenic
966157596 3:176933897-176933919 GGCGAGAAAACAGTTTTGGCAGG - Intergenic
966871381 3:184292290-184292312 CAAGAGCAAACAGCTTTGTCAGG - Exonic
966906345 3:184528638-184528660 CAATACAAAACACTTTTGGCCGG + Intronic
967791590 3:193555165-193555187 CAGGACAATACAGAGTTGGCAGG + Intronic
969814132 4:9674215-9674237 GAGAACAAAACAGCTTAGGCTGG - Intergenic
977358057 4:95971350-95971372 AACCACAAAACAGCATTGGCTGG - Intergenic
979833789 4:125335099-125335121 TAGGACAAGACAGCTTTGGATGG + Intronic
983770452 4:171542112-171542134 CACCACAAACTGGCTTTGGCTGG + Intergenic
992799657 5:80284479-80284501 CAACATAAAACAGCTTAGGCTGG - Intergenic
994453612 5:99977127-99977149 GAGGCTAAAACAGCTTTGGCAGG + Intergenic
995700910 5:114934096-114934118 CAAAACAAAACAGGTTTGTCTGG - Intergenic
1003349434 6:5302187-5302209 CACAACAACACAGGTTTGGATGG - Intronic
1008293047 6:49741298-49741320 CAGGAAAAAACAGCATTGGGAGG - Intronic
1011104974 6:83769453-83769475 CAAAACAAAACAGATTTTGCAGG - Intergenic
1014391341 6:120869645-120869667 AACAACAAAACAGTTGTGGCAGG - Intergenic
1016171920 6:141028067-141028089 CACGACAAATCAACATTGCCTGG - Intergenic
1019345470 7:527797-527819 CAGGGCTAAACATCTTTGGCAGG - Intergenic
1032271487 7:130411771-130411793 AATAACAAAACAGCTCTGGCAGG + Intronic
1037686512 8:21144128-21144150 CATGACAAAACAGATGTGCCAGG - Intergenic
1039902685 8:41764641-41764663 CACCAGAAGACAGCTTTGGTGGG - Intronic
1045388424 8:101692349-101692371 CCCAACAAAACCCCTTTGGCAGG + Intronic
1046174392 8:110556239-110556261 CACTTCAAAAGAGCTTTGGAAGG + Intergenic
1053393307 9:37751618-37751640 CAACACAAAACAGCTTTGCAGGG + Intronic
1186878061 X:13837167-13837189 CACGACATGACAGCTTTGAAGGG + Intronic
1191674533 X:63780636-63780658 CAAAACAAAACAACTTTGGTTGG + Intronic
1197347060 X:125336722-125336744 CACCAGAAAACAGCTTTGCAAGG - Intergenic
1200821027 Y:7582693-7582715 CAATACCAAACAACTTTGGCAGG - Intergenic
1202239278 Y:22750049-22750071 CAATACCAAACAACTTTGGCAGG + Intergenic
1202392265 Y:24383811-24383833 CAATACCAAACAACTTTGGCAGG + Intergenic
1202478519 Y:25286306-25286328 CAATACCAAACAACTTTGGCAGG - Intergenic