ID: 930728933

View in Genome Browser
Species Human (GRCh38)
Location 2:54709359-54709381
Sequence CAGAGTGAGCAGCAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930728933_930728938 -5 Left 930728933 2:54709359-54709381 CCCAGCTCCTGCTGCTCACTCTG No data
Right 930728938 2:54709377-54709399 CTCTGATCTCGGAGCAAGGTTGG 0: 3
1: 8
2: 28
3: 69
4: 204
930728933_930728939 -4 Left 930728933 2:54709359-54709381 CCCAGCTCCTGCTGCTCACTCTG No data
Right 930728939 2:54709378-54709400 TCTGATCTCGGAGCAAGGTTGGG 0: 3
1: 6
2: 25
3: 75
4: 206
930728933_930728946 29 Left 930728933 2:54709359-54709381 CCCAGCTCCTGCTGCTCACTCTG No data
Right 930728946 2:54709411-54709433 GGTGCTGTTGCAGCCCAGCTGGG No data
930728933_930728941 8 Left 930728933 2:54709359-54709381 CCCAGCTCCTGCTGCTCACTCTG No data
Right 930728941 2:54709390-54709412 GCAAGGTTGGGGCCAAGCCCAGG No data
930728933_930728937 -9 Left 930728933 2:54709359-54709381 CCCAGCTCCTGCTGCTCACTCTG No data
Right 930728937 2:54709373-54709395 CTCACTCTGATCTCGGAGCAAGG No data
930728933_930728940 -3 Left 930728933 2:54709359-54709381 CCCAGCTCCTGCTGCTCACTCTG No data
Right 930728940 2:54709379-54709401 CTGATCTCGGAGCAAGGTTGGGG 0: 2
1: 10
2: 36
3: 134
4: 243
930728933_930728945 28 Left 930728933 2:54709359-54709381 CCCAGCTCCTGCTGCTCACTCTG No data
Right 930728945 2:54709410-54709432 AGGTGCTGTTGCAGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930728933 Original CRISPR CAGAGTGAGCAGCAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr