ID: 930728964

View in Genome Browser
Species Human (GRCh38)
Location 2:54709499-54709521
Sequence GGGCACCGATAAGCCCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930728952_930728964 7 Left 930728952 2:54709469-54709491 CCCCTGCCGCCTCAGCCTCCTCT No data
Right 930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG No data
930728953_930728964 6 Left 930728953 2:54709470-54709492 CCCTGCCGCCTCAGCCTCCTCTG No data
Right 930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG No data
930728951_930728964 12 Left 930728951 2:54709464-54709486 CCAGTCCCCTGCCGCCTCAGCCT No data
Right 930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG No data
930728957_930728964 1 Left 930728957 2:54709475-54709497 CCGCCTCAGCCTCCTCTGGGCTT No data
Right 930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG No data
930728958_930728964 -2 Left 930728958 2:54709478-54709500 CCTCAGCCTCCTCTGGGCTTTGG No data
Right 930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG No data
930728954_930728964 5 Left 930728954 2:54709471-54709493 CCTGCCGCCTCAGCCTCCTCTGG No data
Right 930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG No data
930728961_930728964 -8 Left 930728961 2:54709484-54709506 CCTCCTCTGGGCTTTGGGCACCG No data
Right 930728964 2:54709499-54709521 GGGCACCGATAAGCCCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930728964 Original CRISPR GGGCACCGATAAGCCCGTGA GGG Intergenic
No off target data available for this crispr