ID: 930732432

View in Genome Browser
Species Human (GRCh38)
Location 2:54741133-54741155
Sequence CTGGACAATAAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930732432_930732436 3 Left 930732432 2:54741133-54741155 CCCTCCTCATTCTTATTGTCCAG 0: 1
1: 0
2: 1
3: 42
4: 314
Right 930732436 2:54741159-54741181 GCCCCAAGTGCAGCTGATCTTGG 0: 1
1: 0
2: 2
3: 28
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930732432 Original CRISPR CTGGACAATAAGAATGAGGA GGG (reversed) Intronic
901313187 1:8285559-8285581 CTTGAAAATAAGGATGAGGTTGG + Intergenic
902809269 1:18879227-18879249 CTGGCCATTATGAAAGAGGAGGG - Intronic
903030674 1:20462188-20462210 CTGGACATTCTGAATAAGGAAGG + Intergenic
904465680 1:30705938-30705960 CAGGAGAATAAGAATTAGGGAGG - Intergenic
904633743 1:31863608-31863630 CTGAAAAATAAGATTGAGAAGGG + Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906457485 1:46009502-46009524 CTAGACAATAAGCATGAAGAAGG + Intronic
906740868 1:48182566-48182588 CTGGAACATAAGAATCAGGCTGG - Intergenic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
909070566 1:70988531-70988553 CTGGTCAGTAGGAAGGAGGAAGG - Intronic
910140743 1:84024862-84024884 TTGGACAATAATATAGAGGATGG - Intergenic
911642774 1:100306530-100306552 CTGTACAATAAGCATGATGCTGG - Intergenic
912423628 1:109566148-109566170 CTGTTCAGAAAGAATGAGGAGGG + Intronic
912885321 1:113465444-113465466 CTGGGCAAAAAGAATGAAGCTGG - Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915356616 1:155258913-155258935 CTGGACAAAAAGAAGGTAGAGGG + Exonic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
918132380 1:181641104-181641126 CTGCACAAGATGAATGAGAAAGG - Intronic
919230306 1:194764830-194764852 CTGGAGAATAGGCATGGGGATGG - Intergenic
920973800 1:210766498-210766520 CTGGGCAACAAGATTGAGGGGGG + Intronic
922222643 1:223620201-223620223 CTGGACAAGAAAGTTGAGGATGG - Exonic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
923226960 1:231947156-231947178 CTGGGCAAGAAGAATGAAGCTGG + Intronic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924279716 1:242424157-242424179 ATGGACAATAAGAGGGAGTAAGG - Intronic
924330278 1:242934559-242934581 CTGGACCATAAGATTCAAGAAGG - Intergenic
924476180 1:244383763-244383785 CTGGAGTATAGGAATCAGGAGGG + Intronic
1063384921 10:5610196-5610218 CTGCACAATAAGGATGTGCATGG - Intergenic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1064000689 10:11661590-11661612 CTTGTCAATCAGAATGAGGGAGG - Intergenic
1066224757 10:33371311-33371333 CTGGATGATAAGTATGATGAAGG - Intergenic
1068533904 10:58218908-58218930 CTGGACAATAGGAATGGGAAGGG - Intronic
1069177915 10:65316963-65316985 CTGCACAAAGAAAATGAGGAAGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071754250 10:88518876-88518898 CTGGACTTTACTAATGAGGAGGG - Intronic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1074538935 10:114349064-114349086 CTGGACAGTAAGAGTGCAGAAGG + Intronic
1075162050 10:120032941-120032963 CTGGAAAATAGGAATTAGGGAGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075853410 10:125607312-125607334 CTGGACAATATTTATGAGGCTGG + Intronic
1076033559 10:127179577-127179599 CTGGACATTAAGAATTACTAAGG + Intronic
1076854618 10:133109693-133109715 CTGGAGAATATGAACCAGGAGGG - Intronic
1077893144 11:6434052-6434074 GAGGACAATAAGAAAGAGAAAGG - Intronic
1078916593 11:15784142-15784164 CTGGACTGTAAGAACCAGGAGGG - Intergenic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1079498251 11:21071016-21071038 CTGGACTATATGAAGTAGGAGGG - Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080697371 11:34614350-34614372 TTGCATACTAAGAATGAGGATGG + Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083295308 11:61712161-61712183 CTGGCCAAGAAGCACGAGGAGGG + Intronic
1084494264 11:69495038-69495060 CTGGCCAGTAAGATTGAGGCTGG + Intergenic
1084558281 11:69888127-69888149 CTGGACAGCAAGAAGGAGCAAGG - Intergenic
1085417793 11:76330772-76330794 CTGGACCTGAAGAATGAAGAGGG - Intergenic
1087677649 11:101181206-101181228 CAGGAACATAAGAATGAAGAAGG + Intergenic
1088548127 11:110982159-110982181 CTGGACAGAAAGAATGTGAAAGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092919794 12:13221305-13221327 CTGGAAAATAAAAAAGAGCATGG - Intergenic
1093020340 12:14197639-14197661 CTGGAATAGAAGAATAAGGAGGG + Intergenic
1093175111 12:15904768-15904790 CTGGACGTAAAGAAAGAGGAAGG - Intergenic
1093426822 12:19037112-19037134 CTGGAAAACAGGAATTAGGAAGG + Intergenic
1097734335 12:63165461-63165483 CTGTACTATAAGACTGAAGAAGG - Intergenic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098528288 12:71511796-71511818 CTGGATAATAAGAATGCTGGTGG - Intronic
1098600116 12:72321064-72321086 AATGACAATAAGAATGAGCAGGG + Intronic
1099270919 12:80509940-80509962 CTAGACAATAAAAAAGAGGTGGG - Intronic
1100121954 12:91378912-91378934 ATTGAAAATAAGAATGTGGAGGG - Intergenic
1100274210 12:93057127-93057149 CTGGACAAAAAGAATATGAAAGG - Intergenic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1101068663 12:101049929-101049951 CTGGAGAATAAGAATCTGGGTGG - Intronic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101533584 12:105596751-105596773 ATAGACAATAAGAATCAGAAAGG + Intergenic
1102724327 12:115045909-115045931 TTGGATACTAAGAATGACGATGG + Intergenic
1103329926 12:120147136-120147158 CTGGACAATGGGCATGATGAGGG + Exonic
1105340963 13:19525247-19525269 CTGCACAAAAAGAATGAAGCTGG + Intronic
1106455151 13:29920434-29920456 CTGGACAGAAACAATCAGGATGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1108033763 13:46265328-46265350 GTGGACAATCAGAATGAGTGTGG - Intronic
1108260019 13:48646810-48646832 TTGGAAAATAGGCATGAGGAAGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112482682 13:99791605-99791627 CTGTAAAATAAGAGTAAGGATGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112828904 13:103424503-103424525 CTGGAAAGTAAAAATGTGGATGG + Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113268815 13:108649527-108649549 CAGGAAAATAGGAATAAGGATGG + Intronic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115863141 14:37711994-37712016 CTGGACAAAAAGAAGGAAGCAGG + Intronic
1115993055 14:39169596-39169618 CTGAGCATTAGGAATGAGGAAGG + Intronic
1116430457 14:44840041-44840063 CTGGCTAATATGAATGAGGAGGG + Intergenic
1119026351 14:71155901-71155923 CTGGACAATGAGGATGGGGGCGG + Intergenic
1119569667 14:75659678-75659700 CAAGAAAATAATAATGAGGATGG - Intronic
1120120522 14:80674330-80674352 CTCTATAATAAGAATGATGATGG - Intronic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121946817 14:98131134-98131156 CTGGACGATAAGAATAAATAAGG + Intergenic
1202832681 14_GL000009v2_random:53868-53890 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1125456669 15:39867368-39867390 GTGGACAATAAGAATAAGTTAGG + Intronic
1125818981 15:42611595-42611617 CTGGACAAGGACAATGAGGGTGG - Intronic
1126544260 15:49855274-49855296 CTGACCAATAAGAATGAACATGG - Intergenic
1127524355 15:59777440-59777462 CTGGACAAAAAGATTTAAGATGG + Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130747634 15:86673005-86673027 TGGGACAATAAGAATGCAGAAGG - Intronic
1130948861 15:88570018-88570040 CTGGAATATAAGGATGAGGAAGG + Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133083446 16:3342581-3342603 CTGAACAATAAAAACGAGGCCGG + Intergenic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137331442 16:47501313-47501335 CTAGGAAATAAGTATGAGGATGG + Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138599293 16:58045565-58045587 CTGGACATAAATAATGAGGGCGG - Exonic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141289814 16:82707381-82707403 CTGGCCAATGAGAATGAGCAGGG + Intronic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1145093102 17:20001951-20001973 CTTGAAAATAAGAAAGAGGCCGG - Intergenic
1145303522 17:21656773-21656795 CTAGACAAGGACAATGAGGAGGG + Intergenic
1145346521 17:22045076-22045098 CTAGACAAGGACAATGAGGAGGG - Intergenic
1146982414 17:37176805-37176827 CTGCACAACAGGAATGAGGTTGG - Intronic
1150472424 17:65448474-65448496 CTGTAAGATAAGAATGAGGGTGG + Intergenic
1151950313 17:77349956-77349978 CTGGACTGTACTAATGAGGAAGG - Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152164883 17:78696898-78696920 CTTGGCAATAGGAATGTGGAAGG + Intronic
1152252374 17:79218745-79218767 CTGGCCTTGAAGAATGAGGAGGG + Intronic
1152501314 17:80711410-80711432 CCTGACACTAAGAACGAGGATGG + Intronic
1153306121 18:3632597-3632619 TTGGATTATAAGAATTAGGATGG - Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1157185367 18:45536081-45536103 CTGGACAATAAGAAGGAAAAAGG - Intronic
1157389096 18:47286416-47286438 CTAGTCAATTAGAAAGAGGAGGG - Intergenic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1158521366 18:58174113-58174135 CTGGACATTGAGGGTGAGGAGGG + Intronic
1159851321 18:73530075-73530097 ATGGACAAAAAGAATAAGAAAGG + Intergenic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1163662580 19:18587657-18587679 ATGGACAAAAAGAAAGGGGAGGG + Intronic
1165341000 19:35212180-35212202 CCCAACAATAAGAATGAGGTAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167673342 19:50869147-50869169 GTGGGCAGTAAGACTGAGGAAGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
1167766207 19:51484280-51484302 CTGGACTACAAGATTCAGGAGGG + Intronic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
1168627934 19:57933784-57933806 CTGGACCATATTAATGAGTAAGG - Intronic
1202640000 1_KI270706v1_random:73863-73885 CTGGGAAATAAGAACGGGGAGGG - Intergenic
925899555 2:8498868-8498890 CTGCAAAATGAGGATGAGGATGG + Intergenic
926293940 2:11553739-11553761 CGGGGCAATAAAAATGAAGAAGG - Intronic
926664517 2:15505891-15505913 CTGGACAAGAAGAGTGAAAAAGG + Intronic
927630949 2:24773556-24773578 CTGGACAATATGATTTAGTATGG + Intergenic
927752273 2:25680053-25680075 CTGGACAATAAAAAAAAGAATGG + Intergenic
928572943 2:32627123-32627145 CTGGGCAATAGGAAAGAGGGAGG - Intergenic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
928873615 2:36011283-36011305 CTAGCCACTTAGAATGAGGAAGG - Intergenic
929360321 2:41080938-41080960 CTTGACATTATGAGTGAGGAGGG + Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930505527 2:52279025-52279047 ATGGCCAATAAGAATGTGAAGGG - Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
933880170 2:86661664-86661686 CTGGAAAATAAGGATATGGAGGG - Intronic
935051357 2:99527730-99527752 CTAGACATTAAGAATGCAGAAGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
937530876 2:122825576-122825598 CTACAAAATTAGAATGAGGATGG - Intergenic
937886404 2:126902390-126902412 CTGGACAATAAATATGAGGTGGG - Intergenic
939314141 2:140525459-140525481 CTGTACAATAACACTGAGTAAGG + Intronic
939807926 2:146796314-146796336 CTGGACATTAAGACAGAGGTAGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940210883 2:151255604-151255626 CAAGACATTAAGAATGAGGGCGG - Exonic
940434810 2:153638901-153638923 ATGGACTAAAACAATGAGGAAGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940914402 2:159238741-159238763 CTAGAAAAAAACAATGAGGAAGG - Intronic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
941146179 2:161848822-161848844 CTGAACAAAAAGAATGAAGCTGG - Intronic
942720704 2:178949228-178949250 CTGGTAGATAAGAATGAAGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
944195593 2:197050029-197050051 CTGTACAAGAAGCATGAGGCTGG + Intronic
944613402 2:201434256-201434278 TTGGACGATAAGAATGATTATGG - Intronic
945109007 2:206344875-206344897 CTGTACAAGAAGAATGACGCTGG - Intergenic
945801741 2:214441190-214441212 ATGCACAATAAGAAAGAGAAGGG + Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946349214 2:219137713-219137735 ATGGAAAATAAGAATAAGAATGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
1170508921 20:17057302-17057324 CTGGACATTAATAAGGAGGTTGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171521044 20:25774458-25774480 CTAGACAAGGACAATGAGGAGGG + Exonic
1171555880 20:26082021-26082043 CTAGACAAGGACAATGAGGAGGG - Intergenic
1172222344 20:33282519-33282541 GTGGACCAAAAGAATAAGGAGGG - Intronic
1172451772 20:35030452-35030474 CAGCACAAAAAGAATGAAGATGG - Intronic
1172704045 20:36870070-36870092 CTGGTCAAGAAGAATGGAGAAGG + Intergenic
1173406755 20:42773056-42773078 CTGGGCACTGGGAATGAGGATGG + Intronic
1174564941 20:51457827-51457849 CTGGCCAATTAGAATGGGAATGG + Intronic
1175745234 20:61451835-61451857 CTGCACAACATAAATGAGGAGGG + Intronic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176654893 21:9579576-9579598 CTAGACAAGGACAATGAGGAGGG + Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1182028578 22:27139383-27139405 CTGCACAATAAAAATCACGATGG - Intergenic
1182032612 22:27171310-27171332 CAGGACCATAATAAAGAGGAGGG + Intergenic
1182143473 22:27982447-27982469 CGGCACAATAAGAAGGAGGAGGG - Exonic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
950771115 3:15311968-15311990 CTGGACTACAAGACTGAAGATGG - Intronic
951610906 3:24492217-24492239 CTGGAAAATAAGAGTGAGTGAGG + Intronic
951918340 3:27825474-27825496 CTGGATAATAATAATGATAATGG + Intergenic
954259484 3:49428415-49428437 AGGGACTATAAGAATGGGGAGGG + Intronic
954301299 3:49702121-49702143 CTGGACAATAAAGATGACAATGG + Exonic
954445791 3:50546150-50546172 CTGGACCAAAAGAATCAGGGAGG + Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
956100187 3:65760179-65760201 CTGGACATTATAAAGGAGGACGG - Intronic
956551485 3:70465167-70465189 CTGGAAAATATGAAAGGGGAAGG + Intergenic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
958788309 3:98623054-98623076 CTGTACAAGAAGCATGATGAGGG + Intergenic
959289901 3:104460512-104460534 CTGGCCAATAGGTATTAGGAGGG - Intergenic
959516736 3:107275800-107275822 CTGAACAATATTAAAGAGGAGGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960258041 3:115532787-115532809 CTGGAACATGTGAATGAGGATGG - Intergenic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
964276380 3:155012689-155012711 CTGGACAATAAGCAGGAAGAAGG - Intergenic
965148317 3:164936065-164936087 GTGCATAATAAGAATGAAGAAGG - Intergenic
965421129 3:168459869-168459891 CTGGACTTTAAGAATTAGGATGG - Intergenic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
967524853 3:190479749-190479771 CTGGAAGATAAGAATGTGAATGG + Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969435078 4:7184554-7184576 CTGTTCAATGAGAATGATGATGG - Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970750930 4:19359977-19359999 CCAGACAAGAAGAGTGAGGAAGG + Intergenic
971285274 4:25283091-25283113 CTGGACAAGAAGAACGAAGTTGG + Intergenic
971458525 4:26868733-26868755 CTGGACAATAGGAATAAAGAAGG - Intronic
971738324 4:30486387-30486409 CTGGACTATAACAATAATGATGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973370247 4:49240206-49240228 CTGGAAAATAAGAACGGGGAGGG - Intergenic
973390782 4:49555214-49555236 CTGGAAAATAAGAACGGGGAGGG + Intergenic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
975110711 4:70620048-70620070 CAAGACAATAGTAATGAGGAAGG + Intergenic
975416519 4:74111601-74111623 CTAGAACATAAGAATGGGGAAGG + Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
977204355 4:94153006-94153028 CTGGAGAATAGGTATGAGAATGG + Intergenic
978141807 4:105326324-105326346 CTGGACTGCAAGAATGAGTAAGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
979603283 4:122609290-122609312 CTACTCAAGAAGAATGAGGAGGG + Intergenic
980086526 4:128396361-128396383 TTGGACAAGATGAATAAGGAAGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980277601 4:130675143-130675165 CATGGCAATATGAATGAGGAAGG + Intergenic
981144296 4:141307219-141307241 CTGGAAAATAACACTGATGAGGG - Intergenic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
981485304 4:145279707-145279729 CTGGAAATTAAGAATGGGAAGGG - Intergenic
983644563 4:169976783-169976805 CCGGACAATAAGAAGGAGTCAGG + Intergenic
983966450 4:173818817-173818839 CAGAACAAAAAGACTGAGGAAGG + Intergenic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985733020 5:1561470-1561492 TTGGATAATAAGAATGTGGAGGG + Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989632362 5:43498585-43498607 CTGGACGCTGAGGATGAGGAAGG - Intronic
992018548 5:72599721-72599743 CTGGTCAGTAAGGGTGAGGATGG + Intergenic
992775398 5:80084532-80084554 CTGGGCAATGAGAGTGAGGCTGG + Intergenic
992966836 5:82011358-82011380 CTGAACAAAAAGAATGGTGATGG - Intronic
995298736 5:110553000-110553022 GTTGACAATAACAATGAGGAAGG - Intronic
995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG + Intergenic
995802928 5:116019325-116019347 ATGGACAATATGTATGAGGGAGG - Intronic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
1000121562 5:158202913-158202935 CTGGCCATTATAAATGAGGACGG + Intergenic
1001447895 5:171800447-171800469 ATGGACAATAAGCACGAGAAAGG + Intergenic
1002695874 5:181088109-181088131 CTGAAAAATAAAAATGAAGAGGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1004266676 6:14154112-14154134 ATGGACAATAAGCAGGAGGCAGG - Intergenic
1004702652 6:18093412-18093434 GTGGAAAATAAGAATTGGGAGGG - Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007142235 6:39587720-39587742 CAGGACAATAAGAAGGTGAAGGG - Intronic
1007373524 6:41442096-41442118 CTGGACTATGAGAGGGAGGAGGG - Intergenic
1011083637 6:83515527-83515549 CTGGACAACTAGAATGAGACAGG - Intronic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011402787 6:86982040-86982062 CTGGAGAATAAGAACCAGGTGGG + Intronic
1012688129 6:102277728-102277750 GTGGACTATTAGAATGTGGAGGG - Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015505161 6:133977809-133977831 CGAGACAATGAGGATGAGGATGG - Intronic
1015688346 6:135891857-135891879 CTGGACTGTAAGCTTGAGGAAGG + Intronic
1015844487 6:137505609-137505631 CTGGAAACTAGCAATGAGGATGG + Intergenic
1016165786 6:140941373-140941395 CTTGACAAAAAGAATGATGCTGG + Intergenic
1018005217 6:159615794-159615816 TGGGGAAATAAGAATGAGGAAGG + Intergenic
1020804756 7:12775249-12775271 CTGGACACTAAAAGAGAGGAGGG + Intergenic
1021558758 7:21947440-21947462 GTGGACAATAAGGATCTGGAAGG - Intergenic
1022966840 7:35482097-35482119 CTGAACAGAAAGAATGAGGGAGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024654814 7:51442669-51442691 CAGGAAAATAAGAATTAGGGAGG + Intergenic
1025281518 7:57629406-57629428 CTAGACAAGGACAATGAGGAGGG + Intergenic
1025303212 7:57836109-57836131 CTAGACAAGGACAATGAGGAGGG - Intergenic
1026941176 7:74289022-74289044 CTGGACAGAAAGGATGAGGAGGG - Intergenic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032559535 7:132874300-132874322 CTGGAGAATAAGTTTGATGATGG - Intronic
1033042207 7:137928796-137928818 CTTGACCAAAAGAATGTGGAGGG - Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035652809 8:1281595-1281617 CTCCCCAATGAGAATGAGGACGG - Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036199592 8:6757036-6757058 CTGGAAAATAAGGATGAATACGG - Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037612906 8:20491405-20491427 CTGTTCAAAAAAAATGAGGAAGG + Intergenic
1040101180 8:43507345-43507367 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1041668123 8:60465839-60465861 CAGGTCAATAAAAATGAGGCCGG + Intergenic
1042745182 8:72099451-72099473 CTGGGCAACAAGAAAGAGGGAGG - Intronic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043783108 8:84361980-84362002 CTGGAAAATAAGAATTATTATGG - Intronic
1045932925 8:107647845-107647867 CTGGACATTAAGTATCTGGAAGG + Intergenic
1046492863 8:114975792-114975814 CTGTACAAGAAGCATGAGGCTGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1051602989 9:18892696-18892718 CTGGCCAATCAGAATGTGAAAGG - Intronic
1052738485 9:32370084-32370106 CTGTACAGTAAGAATGGCGACGG - Intergenic
1053404204 9:37857100-37857122 CTGGCCTATAAGACTGAGGAAGG - Intronic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1054721213 9:68605775-68605797 CTGAAAAATAAAAATGAGGTAGG + Intergenic
1056587162 9:87936188-87936210 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1056609713 9:88116755-88116777 CTGGGAAATAAGAACGGGGATGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058993328 9:110275552-110275574 CTAGACAGTAAAAAAGAGGAGGG - Intergenic
1059993812 9:119890460-119890482 CTGGAGAATAAAAATGACCAAGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1203548114 Un_KI270743v1:144594-144616 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1203632618 Un_KI270750v1:83029-83051 CTAGACAAGGACAATGAGGAGGG + Intergenic
1186119919 X:6349595-6349617 CAAGGCAATAAGAATGAGAAGGG - Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190508960 X:51157588-51157610 GGGGACTATAAGAATGGGGAGGG + Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1192418032 X:71002037-71002059 CTGGGCAATAAGAGTGAGATTGG + Intergenic
1193010457 X:76669709-76669731 CTGGAATATATGAATGAGCATGG + Intergenic
1194189179 X:90813553-90813575 CTGGAGAATAAAAATCAGCATGG + Intergenic
1194673369 X:96764099-96764121 CTGGAAAATAAGAATGAGATAGG + Intronic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196735416 X:118977233-118977255 CAGGGCAATATGAATGAGGCAGG + Intronic
1197302071 X:124793381-124793403 CTGGAGAATAATTATGATGATGG - Intronic
1197629663 X:128843741-128843763 CTGGACGAGAAGAATGAAGCTGG - Intergenic
1197976761 X:132173855-132173877 CTGGTCAGCAGGAATGAGGAAGG + Intergenic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198662096 X:138980758-138980780 CTGGATGATAAGAATGAATAGGG + Intronic
1199155966 X:144549849-144549871 CCAGACAATAACAAAGAGGAAGG - Intergenic
1200535759 Y:4395446-4395468 CTGGAGAATAAAAATCAGCATGG + Intergenic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic