ID: 930732853

View in Genome Browser
Species Human (GRCh38)
Location 2:54744746-54744768
Sequence AAACTCAGCATGTCTGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930732853_930732855 5 Left 930732853 2:54744746-54744768 CCTATTTCAGACATGCTGAGTTT 0: 1
1: 1
2: 3
3: 28
4: 288
Right 930732855 2:54744774-54744796 GCCTATTGAAAATTTAACTATGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930732853 Original CRISPR AAACTCAGCATGTCTGAAAT AGG (reversed) Intronic
900583882 1:3423215-3423237 AAACCTAGCAAGTCTGAAAATGG - Intronic
901170439 1:7253133-7253155 AATCTCAGCAGGTCTGGAGTTGG + Intronic
901354197 1:8629105-8629127 CAAATCAGCATGCCTGTAATGGG + Intronic
903630840 1:24768934-24768956 AACTTTAGCATGTCTGTAATTGG + Intronic
904303280 1:29570013-29570035 AAATTCAGAAAGTCTGAAGTGGG - Intergenic
904454497 1:30639195-30639217 AAACTCAGAAAGTCTGAAGTGGG + Intergenic
904966767 1:34380232-34380254 AAACTCAGCATCTCAGACAGTGG - Intergenic
906287948 1:44600199-44600221 AAGCTCAACATGTCTGAGATGGG - Intronic
908419913 1:63949733-63949755 AACTTAAGCATGTCTGAAAATGG - Intronic
909176327 1:72365906-72365928 AAATTCAGCAGGTCTGAAGAGGG + Intergenic
909328183 1:74379526-74379548 AAACTGAGCATGTCAGAAATGGG - Intronic
911293238 1:96082871-96082893 AACCTCAGAATGTCTGTATTTGG + Intergenic
911894380 1:103412300-103412322 AAATTTAGAATATCTGAAATAGG + Intergenic
911959270 1:104279485-104279507 AAATGCAGCATTTCTAAAATAGG + Intergenic
912577145 1:110683319-110683341 AAGCTCAGTGTGTCTGAAGTGGG + Intergenic
913678086 1:121161280-121161302 AGACTCAGCTTGTCTGACTTGGG - Intergenic
914029923 1:143948909-143948931 AGACTCAGCTTGTCTGACTTGGG - Intronic
914159526 1:145119041-145119063 AGACTCAGCTTGTCTGACTTGGG + Intergenic
914704627 1:150160647-150160669 AACCTCAGCATGGCTGAAAGAGG - Intronic
915088387 1:153404437-153404459 ACACTCAGCATGACTGGAAGGGG + Intergenic
915772430 1:158441667-158441689 AATCTCAGCATGTCGGAAGGCGG - Intergenic
916267325 1:162903847-162903869 AAACCTAGAATGTCTGAATTTGG - Intergenic
917340803 1:173975549-173975571 GATCTTAGCATTTCTGAAATTGG - Intronic
917486962 1:175464214-175464236 AAACTCAGCACTTCTGAATGAGG + Intronic
918380542 1:183950186-183950208 TAATTCAGCAGGTCTGAGATGGG + Intronic
920465387 1:206179793-206179815 AGACTCAGCTTGTCTGACTTGGG - Intergenic
924694590 1:246385786-246385808 TAACTCAGTAGGTCTGAAAGTGG + Intronic
924892767 1:248301799-248301821 AACCTCATCATGTCTGCAAGAGG + Intergenic
1063490847 10:6462438-6462460 ATACACAGCATGTCAGAAAAAGG - Intronic
1063652312 10:7949951-7949973 AAAATGTGCATCTCTGAAATTGG - Intronic
1063727059 10:8648619-8648641 AAACACAGGATTTGTGAAATGGG + Intergenic
1063748672 10:8917083-8917105 AGACCCATCATGACTGAAATGGG + Intergenic
1064632875 10:17335091-17335113 AAACTCTGCAAGACTGAAAAAGG - Intronic
1068924260 10:62518380-62518402 AGACTAAGCTTGACTGAAATCGG - Intronic
1069220740 10:65879762-65879784 AAACTCCAAATGTCTTAAATTGG - Intergenic
1070470804 10:76777459-76777481 AAATTCACCATGGCTCAAATAGG + Intergenic
1076803236 10:132842490-132842512 AAACCCAGTATGTCTGTAAATGG - Intronic
1077288426 11:1777840-1777862 CAACCCAGCCTGTCTGAACTGGG - Intergenic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1079451003 11:20599661-20599683 ACACTCACCATGTCTGACACAGG - Exonic
1080433217 11:32217314-32217336 CTGCTCAGTATGTCTGAAATGGG + Intergenic
1081308541 11:41543014-41543036 AGAATCAGAATGTCTGAACTTGG + Intergenic
1081728679 11:45352962-45352984 AACCTTAAAATGTCTGAAATAGG - Intergenic
1086219243 11:84421397-84421419 AAATTCAGAAGGTCTGCAATGGG - Intronic
1088067222 11:105734177-105734199 AAACTAAGTATGTATAAAATTGG + Intronic
1090901343 11:131034520-131034542 AATCTCAGCATGGCTTAGATGGG - Intergenic
1090913704 11:131144023-131144045 ATACTCAGCATATCTAAAAACGG - Intergenic
1091066565 11:132519065-132519087 AAACTATGCATGTCAGAAATGGG - Intronic
1091974858 12:4816117-4816139 AAGCTTAGCATGTCTAAAAATGG + Intronic
1091984751 12:4900158-4900180 AAACTGAGCATTTTTAAAATAGG - Intergenic
1092040770 12:5382263-5382285 AAATTTAGCATTTATGAAATAGG - Intergenic
1092044220 12:5416775-5416797 AAGCTCAGCATGCCTGAAACAGG - Intergenic
1094420812 12:30269217-30269239 CCACCCTGCATGTCTGAAATTGG - Intergenic
1094428283 12:30338633-30338655 CCACTCCACATGTCTGAAATTGG + Intergenic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1095921845 12:47539649-47539671 GAGCTCAGCATATCTAAAATCGG - Intergenic
1096746255 12:53729044-53729066 AATCTCATCATGTGTAAAATGGG - Intergenic
1097731379 12:63132023-63132045 TGATTCAGTATGTCTGAAATAGG + Intergenic
1098101690 12:67024470-67024492 CAAGGCAGCATGTCTGAAATAGG + Intergenic
1099066591 12:77988188-77988210 AAATTCAGTAAGTCTGAGATGGG + Intronic
1099157308 12:79194417-79194439 ACACTCAGAAAGTCTGAAGTGGG + Intronic
1099462703 12:82943638-82943660 AAACTAGTGATGTCTGAAATAGG - Intronic
1100238862 12:92689674-92689696 AAACTAAGCATGTTTTAAATTGG + Intergenic
1102450599 12:113039142-113039164 TAAATCAGCATGACTGCAATGGG - Intergenic
1102557544 12:113737581-113737603 AAATTCTTCATTTCTGAAATGGG - Intergenic
1102759239 12:115371028-115371050 AAACTCAGGAAATCAGAAATGGG + Intergenic
1103101954 12:118184668-118184690 AAATTGAGTAAGTCTGAAATGGG + Intronic
1106140726 13:27008694-27008716 AAACACAGCATCACTGAAACAGG - Intergenic
1106258919 13:28047132-28047154 TGAGTCAGCATGTCTGGAATGGG + Intronic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108278986 13:48841828-48841850 TAAGTCAGAATATCTGAAATGGG + Intergenic
1109448789 13:62481567-62481589 CAATTTAACATGTCTGAAATTGG - Intergenic
1109875662 13:68400889-68400911 AAACTCTGCAAGACTGAAAGAGG + Intergenic
1110792029 13:79596989-79597011 AAAGTCAGCATTTCTCAAAATGG - Intergenic
1112763402 13:102715457-102715479 AATCTCAGCATCACTGAAAATGG + Intergenic
1112873733 13:104008395-104008417 AAACTGGGCAAGTCTGAAATAGG - Intergenic
1112943056 13:104890077-104890099 AAAATAAGCATTTCTGAGATAGG - Intergenic
1112943057 13:104890107-104890129 AAAATAAGCATTTCTGAGATAGG - Intergenic
1114620404 14:24093215-24093237 AAACTCAGCATATCTATGATGGG - Intronic
1117287109 14:54296609-54296631 AATCTCTGCATCTCTAAAATAGG - Intergenic
1117883812 14:60338306-60338328 AAACTCAGCAAGTTTGTAAATGG + Intergenic
1118036432 14:61873369-61873391 AAACCCAGCATGACAGAAAGAGG - Intergenic
1118412035 14:65490233-65490255 AAGCTCAGGATTTCTGAAACTGG + Intronic
1118484290 14:66199305-66199327 AAAGTCAGCATGTATCAAGTAGG + Intergenic
1118695211 14:68377840-68377862 AAAATCAGCACTTCTCAAATTGG + Intronic
1120714994 14:87831081-87831103 AAACTCTGCATGTTGGATATAGG - Intergenic
1124353486 15:28977785-28977807 AACCTCAGCATTTCTGTACTAGG - Intronic
1124553657 15:30706679-30706701 AATTCCAGCAGGTCTGAAATTGG - Intronic
1124677591 15:31698995-31699017 AATTCCAGCAGGTCTGAAATTGG + Intronic
1125009540 15:34855935-34855957 AAACTCAGAATTTCTGCCATGGG + Exonic
1125203474 15:37123633-37123655 AAAATCAGCATGTAACAAATTGG + Intergenic
1127129461 15:55847275-55847297 AAATGCAGCATGCCAGAAATAGG + Intronic
1128626881 15:69217651-69217673 GAAATCAGCACTTCTGAAATTGG + Intronic
1129813609 15:78531878-78531900 AAACTACGTATTTCTGAAATTGG - Intronic
1129912926 15:79243130-79243152 ATACTCAGCATGTCTGAACTGGG - Intergenic
1130325770 15:82878610-82878632 AGACCTAGCATGTCTGTAATTGG - Intronic
1131392832 15:92062951-92062973 AACCTCAGCATTTCTCAAAGTGG + Intronic
1133430402 16:5732198-5732220 CAATTCAGCATCTATGAAATAGG + Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1137996118 16:53215325-53215347 AAATTCAGCCTTTCTGAAAAAGG + Intronic
1138493080 16:57388296-57388318 GAACTCAGCAGGTCAGAAGTGGG - Intergenic
1139078205 16:63481320-63481342 AAACTTAGTATTTCAGAAATAGG - Intergenic
1142245395 16:88967962-88967984 AAACTGAACATGTGTGAAAATGG - Intronic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1143727780 17:8861277-8861299 AATTGCAGAATGTCTGAAATGGG + Intronic
1144479660 17:15618359-15618381 AGACTCAGCAGGTCTGAGGTGGG - Intronic
1144514962 17:15910979-15911001 TGACTCAGAATGTCTGGAATGGG + Intergenic
1144736339 17:17557663-17557685 AAGCTCAGCAGGACTGAAATGGG + Intronic
1145127753 17:20315895-20315917 AACTTCAGAATGTCTGGAATGGG + Intronic
1145979434 17:29003096-29003118 AAACTCTGCATGTGTGAATGTGG - Intronic
1146394305 17:32450672-32450694 TAACTCAGTATGTATGAAAGTGG + Intronic
1149680539 17:58504042-58504064 AGACTCACCATGTCTGAGCTGGG + Exonic
1151520526 17:74626031-74626053 AAACTCACCATGTCTAATATAGG + Intergenic
1153672808 18:7428668-7428690 ACACTCAGCATCTGTGACATGGG - Intergenic
1156476561 18:37409338-37409360 AAACTCACCATGTTTGAGCTAGG + Intronic
1156717088 18:40024284-40024306 AAATGCTGCATGTCTGAAAAAGG - Intergenic
1160115095 18:76071575-76071597 CATTTTAGCATGTCTGAAATAGG + Intergenic
1160620667 18:80168190-80168212 AACCTCAGCCTGTCTGCAGTGGG + Intronic
1161549916 19:4906791-4906813 AAACTCAACGTGGCTGAAAGAGG - Intronic
1164083407 19:21880202-21880224 AAAGTCAACATGTCTCTAATTGG - Intergenic
1164201314 19:23021196-23021218 TATCTCAGCATGTCTGTAGTAGG + Intergenic
1164962578 19:32447287-32447309 AAAGACAGAAAGTCTGAAATCGG + Intronic
1166624348 19:44336504-44336526 AAACTTACTATGTGTGAAATGGG + Intronic
1167114670 19:47482021-47482043 AAACTTAGCATCTCTGATCTTGG + Intronic
1168148076 19:54430540-54430562 TAGCTCAGGATGTCTGAAGTGGG - Exonic
1168549236 19:57279798-57279820 AAACTGATCATGCTTGAAATGGG + Intergenic
925406208 2:3606752-3606774 ATACCCAGCATGTCAGGAATTGG + Intronic
927336740 2:21933243-21933265 AAAATCATCATGTGTGAAAGAGG - Intergenic
927614445 2:24577470-24577492 AAAAGCAGCATGTCAGAATTTGG - Intronic
927677536 2:25117278-25117300 AGACTCAGCATGTCTGGGAGGGG + Intronic
927839529 2:26430643-26430665 AAACTTGGCAGGTCTGAATTTGG + Intronic
928923574 2:36553051-36553073 AAACTCAGCACATTTGAACTTGG - Exonic
930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG + Intronic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
933130938 2:78673457-78673479 AAGCTCAGCATGCCTGCAAAAGG - Intergenic
933328652 2:80870051-80870073 AAGGTCAGCATTTCTGAAACAGG + Intergenic
933537761 2:83597941-83597963 AAACTTACCAAGTCTGAAAAAGG + Intergenic
933775874 2:85770883-85770905 AAACTCAGGATCTCTGACCTAGG + Intronic
935534374 2:104276605-104276627 AATCTCAGCATCTCTAAAACTGG + Intergenic
936462062 2:112721432-112721454 AAACACATCATCTCTGAATTTGG + Intergenic
936542455 2:113363357-113363379 ACACTCAGCAGGTCGGAAGTGGG - Intergenic
937044220 2:118842754-118842776 AAACGCAGCATTTTTGAAAAGGG - Exonic
938641713 2:133287963-133287985 AAACCAAGCATGTTTGGAATGGG - Intronic
938738351 2:134206901-134206923 AGACTCCAGATGTCTGAAATTGG - Intronic
939401772 2:141703699-141703721 AAACTCAGGATGTGTGATTTAGG - Intronic
939827676 2:147034755-147034777 AAACTGAGAATGTCTCTAATAGG - Intergenic
941505372 2:166337325-166337347 AAACACAGGATGTCCAAAATTGG - Intronic
941701888 2:168612643-168612665 AAACTCAAAATCTCTGCAATAGG - Intronic
944333008 2:198494535-198494557 AAAACCAACATATCTGAAATTGG + Intronic
944891828 2:204125495-204125517 AAAATCAGGATGTCAGAAATGGG + Intergenic
947053914 2:226078709-226078731 AAACTGAGCATATGGGAAATGGG - Intergenic
947246382 2:228053322-228053344 AATCTCAGCATGACTGTATTTGG - Intronic
947368709 2:229423308-229423330 AAACTCAGTATATCTTAAAATGG - Intronic
948711284 2:239827282-239827304 AAACTCAGCAGGTCTCAAGTGGG - Intergenic
1169845357 20:9985686-9985708 AAGCTTTGCATGTCTGAAAATGG + Intergenic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1170768903 20:19315240-19315262 AAACTAGGCATGTTTTAAATGGG + Intronic
1170900104 20:20454307-20454329 AATTTGAGCATGTCTGAATTTGG + Intronic
1175469643 20:59218364-59218386 AAACTCTGCATGCCTGTATTAGG + Intronic
1176425351 21:6545311-6545333 AGACCCAGCGTGTCTGAAACCGG - Intergenic
1177285549 21:19043861-19043883 GATCTCTGCATGTCTGAATTTGG - Intergenic
1178846979 21:36182199-36182221 AGACTCACCATTTCTGAGATTGG + Intronic
1179700842 21:43153628-43153650 AGACCCAGCGTGTCTGAAACCGG - Intergenic
1181634583 22:24168715-24168737 CCCCTCAGCATGTCTGAACTGGG - Intronic
1181772131 22:25133302-25133324 AGACTTAGCATTTCTGAAAGTGG - Intronic
1183137535 22:35903603-35903625 AAACTCAACATGCCCAAAATTGG + Intronic
950448324 3:13051226-13051248 TCACTCAGCATGGCTGGAATGGG - Intronic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952469276 3:33628607-33628629 AAACTTATCCTGTTTGAAATTGG - Intronic
955821215 3:62897610-62897632 AAACTCAGTATTTCTGGAAAAGG + Intergenic
956356937 3:68404265-68404287 AATCTCAGCAGGTCTGTGATTGG - Intronic
956421322 3:69089056-69089078 TAACCCAGTAGGTCTGAAATGGG - Intronic
957430019 3:80092223-80092245 AAGCCAAGCATCTCTGAAATTGG + Intergenic
957552941 3:81730446-81730468 AAACTCACCAAGCCTAAAATTGG - Intronic
957697805 3:83665375-83665397 AAAATCAGCGTGACTGAAACAGG - Intergenic
959946452 3:112130517-112130539 AAACTCAACATATCAGAAACAGG + Exonic
960958144 3:123049566-123049588 CAAGTCAGCATGTATGTAATAGG - Intergenic
961136407 3:124515478-124515500 AAACTCAGCTTTTCTGATGTTGG + Intronic
962084938 3:132180765-132180787 AAACTCAGCAAGTCCGAGACAGG + Intronic
963159352 3:142134390-142134412 AAAATTTTCATGTCTGAAATAGG - Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
966424997 3:179771510-179771532 TAATTCAGCAGGTCTGAAGTGGG - Intronic
966580353 3:181555188-181555210 AACCTCACAATGTCAGAAATTGG + Intergenic
966643545 3:182217073-182217095 AAACACAGCAAGTCTAAAATAGG + Intergenic
967034729 3:185639615-185639637 CAAGTCAGCATCACTGAAATTGG + Intergenic
967079288 3:186034120-186034142 AAACTCAGCATCAGTGATATTGG + Intergenic
967468267 3:189832781-189832803 TAACTCTGCATCTGTGAAATGGG - Intronic
967748365 3:193085098-193085120 ATATTCTGCATGTGTGAAATGGG - Intergenic
968210097 3:196841915-196841937 AAACTCTGCAATTCTGAAAGAGG - Intergenic
969461845 4:7333180-7333202 AAACTCAGCCAGTCAGAAATGGG - Intronic
970561930 4:17290478-17290500 CAAATCAGAATGTCTGAGATTGG - Intergenic
970889672 4:21028803-21028825 AAACTCACCATGTCTAAGTTGGG + Intronic
970903800 4:21191725-21191747 TAACTCAGCCTTTCTTAAATTGG - Intronic
971010808 4:22432258-22432280 CATTTCAGCAGGTCTGAAATGGG - Intronic
972228665 4:37044685-37044707 AATCTCAGCATCTGTAAAATAGG - Intergenic
972281331 4:37604386-37604408 AAACTCAGAATGTGTGCACTAGG - Intronic
972341944 4:38159727-38159749 AAACTCACCAGATCTCAAATTGG + Intergenic
972652263 4:41029776-41029798 AAACTCACAATGGCTGAAGTTGG + Intronic
972978478 4:44666300-44666322 AAACTGGGCATGGCTGAACTGGG - Intronic
973576769 4:52297576-52297598 AAACTCAGAAAGTCTCAAAGAGG + Intergenic
974445938 4:61981321-61981343 AAAATCTGCAGGTCTAAAATGGG + Intronic
975353368 4:73370460-73370482 GAAGTCAGTATGTCTGAAATAGG - Intergenic
975378835 4:73675012-73675034 ATATACAGCATGTCTGAATTGGG - Intergenic
977660687 4:99581685-99581707 AAACTAAGGTTCTCTGAAATGGG + Intronic
978609825 4:110525403-110525425 AAACTGGGCATGGGTGAAATGGG - Intronic
978828617 4:113055016-113055038 ATACACAGCAGGTCTGAAGTGGG - Intronic
979174279 4:117642991-117643013 AAAAACAGCATGGCGGAAATTGG + Intergenic
981542535 4:145860692-145860714 AAACTCAGGATGGCTTAAAATGG + Intronic
982198916 4:152940700-152940722 TAAGTCAGCATATCTGGAATTGG + Intronic
982467780 4:155751507-155751529 AAACACAGCATATGTGAAAATGG + Intergenic
982490669 4:156025505-156025527 AATCTCAACAGGTCTGACATAGG - Intergenic
983004084 4:162460916-162460938 AAAGTCAGCATGTGAGAATTAGG - Intergenic
984002475 4:174267183-174267205 AAACTCAGCATGCCTGAGGATGG + Intronic
984008203 4:174338943-174338965 AAATTCAAAATGTTTGAAATGGG + Intergenic
984078473 4:175213738-175213760 AAACGCAGGTTGTCAGAAATGGG - Intergenic
984720956 4:182972712-182972734 AGACTCAGCTTGTCTGGTATTGG - Intergenic
986580220 5:9258010-9258032 AATCTCAGCATGTTTGCACTAGG - Intronic
987265367 5:16247765-16247787 AAAGTCAGCATGTTAGAAAATGG + Intergenic
987361937 5:17115316-17115338 AAAATTAGCAGGTCTGAAACAGG - Intronic
987756696 5:22105860-22105882 AGACTCAGCATGTCTTATTTTGG + Intronic
988406486 5:30829857-30829879 AAACTCAGTATGTTTAATATTGG + Intergenic
989271432 5:39538073-39538095 AAACTTAACATGTCCCAAATTGG - Intergenic
989594738 5:43145864-43145886 AAACTCAACTTGTCTGGTATCGG - Intronic
990652767 5:57921224-57921246 AAGCTCTTCATGTCTTAAATGGG - Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
993189340 5:84661412-84661434 AAACCCAGCATTTCTGCAATTGG + Intergenic
994942885 5:106347510-106347532 TTACTCAGCATGTCTAAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
995591826 5:113707443-113707465 AATCTCAGCATGACTCAACTGGG + Intergenic
996942866 5:129030173-129030195 AAACTCAGAATTTCTCACATGGG - Intronic
997459760 5:134043970-134043992 AGCTTCAGCATCTCTGAAATGGG - Intergenic
997963436 5:138338939-138338961 AACCTCAGCATCCCTGAAACAGG + Intronic
998136141 5:139675725-139675747 AATTTCCTCATGTCTGAAATTGG + Intronic
1000295083 5:159906508-159906530 TAATTCAGCAGGTTTGAAATGGG - Intergenic
1000627434 5:163555300-163555322 AAAATCAGCATTTCAGAAACAGG - Intergenic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1002189065 5:177469476-177469498 AATCTCCGCCTCTCTGAAATGGG + Intronic
1003564283 6:7209352-7209374 AAAATGAGCATTTCTAAAATTGG + Intronic
1004136151 6:12968965-12968987 TGACTCAGCAGGTCTGAAGTGGG + Intronic
1004866574 6:19858680-19858702 GAAGTCAGAATGTCTGGAATTGG + Intergenic
1005717222 6:28561492-28561514 AAACTCATCAAGTCAGAAAAAGG + Intergenic
1006398291 6:33801292-33801314 AAGCTCAGCCTGTCTGGATTTGG + Intronic
1008244913 6:49160189-49160211 AAAATCAAAATGTCAGAAATAGG + Intergenic
1008313891 6:50014992-50015014 AAACTCTACATGTCCAAAATTGG + Intronic
1008876398 6:56334298-56334320 AAATTCAGCAGGTCTGGGATTGG - Intronic
1009611155 6:65943056-65943078 AAACTAAGCAATTCTGAAATTGG - Intergenic
1010276227 6:73971758-73971780 AAGCTCAGGATCTCTGAATTGGG + Intergenic
1010771904 6:79841394-79841416 ACACTCAGCATGTCTAAAGATGG - Intergenic
1011293087 6:85797619-85797641 AAACTCAAGATGTCTGAAAATGG - Intergenic
1011399933 6:86949418-86949440 AATCTCTGCATGAGTGAAATAGG - Intronic
1011941482 6:92848460-92848482 TGATTCAGCATGTCTGAAGTGGG + Intergenic
1013751546 6:113412837-113412859 AAACTCAGTGACTCTGAAATTGG - Intergenic
1014309130 6:119777950-119777972 AAACTCAGGATATTTTAAATAGG - Intergenic
1014736814 6:125103290-125103312 AAACTCTGCCTGTATCAAATTGG - Intergenic
1015210005 6:130686208-130686230 AAAGATAGCATGTCTGAAACTGG - Intergenic
1015542876 6:134333624-134333646 AACCACAGCCTGTTTGAAATTGG - Intergenic
1015853717 6:137601433-137601455 AAATTCAGTATTTCAGAAATAGG - Intergenic
1019168636 6:170116141-170116163 AACATCAGCTTGACTGAAATGGG + Intergenic
1020757374 7:12219838-12219860 AAACTAAACATGTATGTAATTGG + Intronic
1020814853 7:12892914-12892936 TAACCCAGCAGGTCTGAAGTGGG - Intergenic
1020946533 7:14615948-14615970 AAACTCAGTATATCTGATTTTGG + Intronic
1022182150 7:27931453-27931475 AAACTCTGCATGTGGGAATTTGG + Intronic
1022733605 7:33055538-33055560 AAATTCAGCTTGACTGAAATAGG + Intronic
1024823367 7:53360592-53360614 AAACTCAAAATGGCTAAAATTGG - Intergenic
1024886644 7:54149534-54149556 AAATTTAACATGTCTGAAACTGG - Intergenic
1024942987 7:54781465-54781487 CAACTCAGCCGGTCTGAACTTGG - Intergenic
1030168955 7:106582445-106582467 AAACTCTGAATATCTGAGATGGG - Intergenic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1030747380 7:113183629-113183651 AAACACTGAATGTCTCAAATTGG - Intergenic
1031588017 7:123556238-123556260 AAACTTAACATGTCCAAAATGGG - Intronic
1031718426 7:125137305-125137327 AAACTCAGCATGTTTGATCTGGG - Intergenic
1031735321 7:125352369-125352391 CAATTCAGCATTTCTTAAATTGG - Intergenic
1032382690 7:131501691-131501713 AAGCTCAGCATGACTTAAACAGG - Intronic
1035310180 7:157962729-157962751 AACCTCCCCATGTCTGTAATAGG - Intronic
1035406421 7:158601395-158601417 AAACACAGCCTGTCTGTACTAGG - Intergenic
1038228787 8:25681637-25681659 GAACTCAGGATGCCTGAAACTGG + Intergenic
1040868985 8:52080580-52080602 AGTCTCAGAATGTCTCAAATAGG - Intergenic
1042697246 8:71568485-71568507 ATTTTCAGCTTGTCTGAAATAGG + Intronic
1043742387 8:83830193-83830215 AAACCCAGCATAACTGAATTTGG + Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1046922593 8:119748479-119748501 AAACTGAAAATGTCTGAAGTAGG - Intronic
1046980565 8:120332107-120332129 AAACACAGCATGTCAGCAAGTGG - Intronic
1048078058 8:131094947-131094969 AATCTAAGCCTGTCTGAATTTGG + Intergenic
1048783361 8:138024842-138024864 AAACTGAGCAGGTCAGCAATAGG - Intergenic
1048879798 8:138862939-138862961 AATTTCAGCATCTGTGAAATGGG - Intronic
1049730443 8:144174853-144174875 TGACTCAGCAAGTCTGCAATGGG - Intronic
1050248868 9:3722254-3722276 AAACACAGCATCACTGAAAACGG - Intergenic
1050624832 9:7492189-7492211 CAAGTTAGCATGTCTTAAATTGG - Intergenic
1050884348 9:10744849-10744871 AAACTCAGCATGTTTTAGCTAGG - Intergenic
1051531654 9:18110527-18110549 AAGCTCAGGATGTCTCAGATAGG - Intergenic
1052165519 9:25321914-25321936 AAACTCAGCATAGCTAGAATAGG - Intergenic
1052300680 9:26949282-26949304 AAATTCTTCATGTGTGAAATGGG - Intronic
1054720801 9:68601913-68601935 GAACTCAGAAAGGCTGAAATAGG + Intergenic
1055166582 9:73202694-73202716 AAATTATGCATGTGTGAAATAGG + Intergenic
1056109453 9:83380382-83380404 AAACTCAGGAGTTCTGGAATCGG - Intronic
1056111573 9:83401393-83401415 AAACTCTTCATCTCAGAAATGGG + Intronic
1059265564 9:113026049-113026071 ACCCTAAGAATGTCTGAAATAGG + Intergenic
1059549569 9:115215399-115215421 AAAATAAGCAAGTGTGAAATGGG - Intronic
1059819159 9:117952420-117952442 AAACTCAGCATGGATGAAGCAGG - Intergenic
1059902964 9:118949121-118949143 AACCTGTGCATTTCTGAAATCGG + Intergenic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1187956990 X:24529044-24529066 TAACTCAGCATGTTGGAAACAGG + Intronic
1189125263 X:38438736-38438758 AAACTCAGCATCTGGCAAATGGG - Intronic
1191881650 X:65848750-65848772 AAACTCAGGATGTATCAAATGGG - Intergenic
1191998653 X:67124351-67124373 TGATTCAGCATGTCTGTAATGGG - Intergenic
1193246028 X:79231392-79231414 AATCTCTGTATCTCTGAAATTGG + Intergenic
1193501681 X:82283433-82283455 AAACTCAGAAAATCTGACATAGG - Intergenic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1197288948 X:124631578-124631600 AAGCTCAGCAAGTCCGAAGTAGG + Intronic
1198453688 X:136793996-136794018 AAACTCAGTATGACCCAAATTGG + Intergenic
1199470088 X:148185612-148185634 AAAATGGGCATGTCTGAAATTGG - Intergenic
1200015753 X:153161758-153161780 AAGCTGAACATGCCTGAAATGGG + Intergenic
1201629085 Y:16049286-16049308 AAACTAAGCATGTCTTCTATGGG - Intergenic
1202174535 Y:22085301-22085323 CAACTTATCATGACTGAAATGGG - Intronic
1202216825 Y:22501081-22501103 CAACTTATCATGACTGAAATGGG + Intronic
1202326362 Y:23694989-23695011 CAACTTATCATGACTGAAATGGG - Intergenic
1202544410 Y:25975065-25975087 CAACTTATCATGACTGAAATGGG + Intergenic