ID: 930732853

View in Genome Browser
Species Human (GRCh38)
Location 2:54744746-54744768
Sequence AAACTCAGCATGTCTGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930732853_930732855 5 Left 930732853 2:54744746-54744768 CCTATTTCAGACATGCTGAGTTT 0: 1
1: 1
2: 3
3: 28
4: 288
Right 930732855 2:54744774-54744796 GCCTATTGAAAATTTAACTATGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930732853 Original CRISPR AAACTCAGCATGTCTGAAAT AGG (reversed) Intronic