ID: 930734477

View in Genome Browser
Species Human (GRCh38)
Location 2:54762361-54762383
Sequence GGTGATGTTCAATCTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930734471_930734477 29 Left 930734471 2:54762309-54762331 CCTCCTCAGAACATCACGGATGG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 930734477 2:54762361-54762383 GGTGATGTTCAATCTGATCATGG 0: 1
1: 0
2: 0
3: 2
4: 83
930734474_930734477 26 Left 930734474 2:54762312-54762334 CCTCAGAACATCACGGATGGGAA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 930734477 2:54762361-54762383 GGTGATGTTCAATCTGATCATGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930734477 Original CRISPR GGTGATGTTCAATCTGATCA TGG Intronic
901413403 1:9100783-9100805 GGGGCTGTTACATCTGATCAGGG - Exonic
902035072 1:13451996-13452018 TTTGCTTTTCAATCTGATCAGGG + Intergenic
902137566 1:14323300-14323322 AGGGAGGTGCAATCTGATCATGG + Intergenic
909789824 1:79661849-79661871 AGGGATGTGTAATCTGATCAAGG - Intergenic
911307551 1:96249473-96249495 GTTGATGTTCAATGTAATCGTGG + Intergenic
912047477 1:105477877-105477899 AGTGGTGTTAAATCTGATCTTGG + Intergenic
918058130 1:181040202-181040224 GCTGATGATCTATCTGTTCATGG + Intronic
918060429 1:181056538-181056560 GGGGATGTTCATTCTCACCATGG - Exonic
1068973301 10:62981699-62981721 GGTGGTGATGAATATGATCATGG - Intergenic
1081206920 11:40286499-40286521 GGTGATGTTATTTTTGATCATGG - Intronic
1086933346 11:92717836-92717858 GGTGATTTTTATTCTGATGAAGG - Intronic
1090992781 11:131834894-131834916 GTTGATGTTCATTATGGTCAGGG + Intronic
1092545529 12:9448412-9448434 GCTGATGTTTCATCTGGTCAGGG - Intergenic
1093330882 12:17836961-17836983 GGTGAGGTGCAATCTCATCATGG + Intergenic
1094507426 12:31073639-31073661 GCTGATGTTTCATCTGGTCAGGG + Intergenic
1097189087 12:57210943-57210965 GGTGATGTTCAACCTGTGCCTGG + Intronic
1097288975 12:57898059-57898081 GGTGATGTTGATTTTGAGCATGG + Intergenic
1097662342 12:62444988-62445010 GTTGATTTTCAATCTTATCTTGG + Intergenic
1112798513 13:103084256-103084278 GGTGATATTGAATCTGAGAATGG + Intergenic
1113154192 13:107299235-107299257 GGTGATATTAACTTTGATCATGG + Intronic
1114884073 14:26825631-26825653 GGTGATATTTAATCTGAGTAAGG - Intergenic
1115921795 14:38382494-38382516 TGTGATGTTCAATGGGAACAAGG - Intergenic
1122650114 14:103221435-103221457 GGTGATGTCCCTTCTGACCACGG + Intergenic
1123001784 14:105299644-105299666 AGTGATGTTCAACCTTATTAGGG - Intronic
1123044705 14:105505818-105505840 GATGATGTCCAATCTAATTAAGG - Intergenic
1125152221 15:36545890-36545912 GGAGATTTACAATCTAATCAAGG + Intergenic
1126328944 15:47511265-47511287 GGTGATCTTCAAACAGAACAAGG - Intronic
1133430286 16:5731023-5731045 GGTGATGTTCATGGTGATGACGG - Intergenic
1133613920 16:7458026-7458048 GGAGATGTCCAAGCTGAGCAAGG - Intronic
1134686542 16:16162822-16162844 GGTCATGTTCCATCTGCCCACGG + Intronic
1135509851 16:23072998-23073020 GGTGATGTGCAATCAGGTTAGGG - Intronic
1144249479 17:13401199-13401221 GGTGATGTTCAAACCCTTCAAGG + Intergenic
1147570847 17:41569933-41569955 GGTGCTGGACAATCTGACCATGG - Exonic
1149154647 17:53612574-53612596 TATGGTGTTAAATCTGATCAGGG + Intergenic
1152807190 17:82361744-82361766 GGTGCTGTTCAAACTGAGCAGGG + Intronic
1162085745 19:8248088-8248110 CGTGATTTTAAATGTGATCAAGG - Intronic
1163079618 19:14928113-14928135 GCTGTTGTTTAATCAGATCATGG + Intergenic
1167070996 19:47221855-47221877 GGTCCTGTACAATCTCATCATGG - Exonic
928082578 2:28324025-28324047 GGTGCTGTTCACTCTCATCTTGG - Intronic
928293772 2:30063131-30063153 GGTGTTCTTCAATCTGAAAAAGG + Intergenic
930257940 2:49113160-49113182 GGTGCTGTGCCATCTGCTCAAGG - Intronic
930734477 2:54762361-54762383 GGTGATGTTCAATCTGATCATGG + Intronic
936067752 2:109344900-109344922 TGTGATGTCCCCTCTGATCATGG - Intronic
938952467 2:136267512-136267534 GGCGAGGTTCTATCTTATCAAGG + Intergenic
943790903 2:191931289-191931311 GGTGATGCTTAAACTGACCAGGG - Intergenic
943869165 2:192971617-192971639 GATGATCTTAACTCTGATCACGG - Intergenic
1170033277 20:11964768-11964790 AGTGATGTTCAATCATATCTGGG - Intergenic
1176009394 20:62884538-62884560 GGTGATGTTAAAGATCATCACGG + Intronic
1178329893 21:31679014-31679036 GGTGATGACCAAACTCATCAAGG + Intronic
1179376036 21:40850463-40850485 TGTGGGGTTCATTCTGATCAAGG + Intergenic
1181090177 22:20467122-20467144 CGTCATTTTCAATCTGAACATGG - Intronic
953745048 3:45567746-45567768 GGTGATGTTCAGACGGAACATGG - Intronic
955330785 3:58045262-58045284 CGTCATTTTCAAACTGATCATGG - Intronic
957961818 3:87264921-87264943 GGTGATGTTTGTTGTGATCATGG + Intronic
961581635 3:127888021-127888043 GGTGATGTCCAATCTGGGGAGGG + Intergenic
965265769 3:166540944-166540966 TGAGATGCTCAATCTGATAAAGG + Intergenic
968455742 4:698620-698642 GGTGATGTGCCAGCTGCTCAGGG + Intergenic
968829765 4:2927126-2927148 TGTGATGTTCACTCAGATGATGG + Intronic
978692327 4:111529103-111529125 GTTGATTTTCAATCTTATCTTGG + Intergenic
980484977 4:133444829-133444851 GGTGATCTGCAATCCCATCAAGG - Intergenic
986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG + Intronic
988889216 5:35596507-35596529 TGTGATGTGCACTGTGATCAAGG + Intergenic
990754135 5:59049461-59049483 GGTAATGGTCAAGCAGATCATGG + Intronic
994873010 5:105378364-105378386 GTTGATTTTCAATCTCATCTTGG + Intergenic
1003997869 6:11561760-11561782 GTTCATGTTCAGTCTGATGAAGG + Intronic
1008454400 6:51692158-51692180 GGGGATTTTCAATGTGAACATGG - Intronic
1008490098 6:52077589-52077611 GTTGATTCTCAATCTGATTAAGG - Intronic
1010732716 6:79408059-79408081 AATTATGTTCAAACTGATCAGGG - Intergenic
1011401473 6:86966700-86966722 GGTGATGCTCAGTCTGAGTATGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023819956 7:43975106-43975128 GGTGACGGTCCCTCTGATCACGG - Intergenic
1024217579 7:47260609-47260631 GGTGATGTTGATTGTGATAATGG + Intergenic
1025738191 7:64173620-64173642 GGGGATCTTCAAGCTGATTAAGG + Intronic
1029748232 7:102528559-102528581 GGTGACGGTCCCTCTGATCACGG - Intergenic
1029766179 7:102627646-102627668 GGTGACGGTCCCTCTGATCACGG - Intronic
1035947274 8:3979143-3979165 GGTGTTGTAAAATGTGATCAGGG - Intronic
1042544573 8:69939807-69939829 GGTGATGATGAAGATGATCAGGG - Intergenic
1048056419 8:130870336-130870358 GGTGATGTTCATGATGATGATGG - Intronic
1048356397 8:133657336-133657358 GGAGATGTTCAGTCTGTGCAGGG + Intergenic
1048681490 8:136846515-136846537 GTTGATTTTCAATCTTATCTTGG - Intergenic
1056940902 9:90955524-90955546 GGTGATGCTCTTTCTGATGACGG + Intergenic
1187628169 X:21140267-21140289 AGTGATGTTGAATTTTATCAAGG - Intergenic
1189549213 X:42075787-42075809 AGAGATGTTCAAGGTGATCAGGG + Intergenic
1190490803 X:50980954-50980976 GGTGATGTTCAATCTTTTTTAGG + Intergenic
1200834282 Y:7717885-7717907 GGTGATGTTTAGCCTGACCATGG + Intergenic
1201011204 Y:9549178-9549200 GGTGGTGTGCAATCTGATTTAGG - Intergenic