ID: 930740021

View in Genome Browser
Species Human (GRCh38)
Location 2:54822738-54822760
Sequence AAGCAGTTATCTCTGGGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930740021 Original CRISPR AAGCAGTTATCTCTGGGTAA TGG Intronic
901965256 1:12861187-12861209 AAGAAGTTAGTTCTGGGCAATGG - Intronic
901980644 1:13031538-13031560 AAGAAGTTAGTTCTGGGCAATGG - Intronic
901988790 1:13095774-13095796 AAGAAGTTAGTTCTGGGCAATGG + Intergenic
901993023 1:13130993-13131015 AAGAAGTTAGTTCTGGGCAATGG - Intergenic
902001445 1:13197393-13197415 AAGAAGTTAGTTCTGGGCAATGG + Intronic
902020680 1:13343098-13343120 AAGAAGTTAGTTCTGGGCAATGG + Intronic
903591967 1:24463337-24463359 TAGTAGTTACCTCTGGGGAAGGG + Intronic
904351802 1:29913046-29913068 TAGAAGTTATCTGTGGGTAATGG - Intergenic
904806929 1:33138689-33138711 CAGCAGTTATCTCTGGACAGTGG + Intergenic
906424447 1:45698465-45698487 AAGCAGTTTTGTTTGGGTCAAGG + Intronic
908587821 1:65592377-65592399 AAGCTGTTTTCGCTGGGTATAGG + Intronic
909699349 1:78504256-78504278 CAGTAGTTATTTCTGGGTAGTGG - Intronic
910092102 1:83477921-83477943 AAGCAGTTATTTGTTGGTAATGG - Intergenic
910529991 1:88225101-88225123 AAGCAGTGCTCTCGGGGAAACGG - Intergenic
913061746 1:115215082-115215104 CAGTAGTTATCTCTGGGAGATGG + Intergenic
913530915 1:119733748-119733770 CAGCGGTTGTCTCTGGGTAGTGG - Intronic
916838060 1:168569667-168569689 AAGTGGTTTTCTCTGGGTAGTGG + Intergenic
918356981 1:183713961-183713983 TAGGAGTGATCTCTGGGTATTGG + Intronic
918389689 1:184045943-184045965 TAGTACTTATCTCTGGGGAATGG - Intergenic
919501214 1:198340407-198340429 AACCAGCAAACTCTGGGTAATGG - Intergenic
919971583 1:202583642-202583664 CAGCAGTTCTCTCTGGATACTGG + Exonic
920577284 1:207070749-207070771 CAGCAGTTGTTTCTGGGTAAGGG + Intronic
920853114 1:209642391-209642413 AACCTGATATCTCTGGGTAGTGG + Intronic
921192250 1:212721119-212721141 CAGCAGTTGCCTCTGGGTAAAGG - Intergenic
921256580 1:213346542-213346564 AAGTGGTTATCTCGGAGTAATGG + Intergenic
922671485 1:227511336-227511358 CAGCAGTTACTTCTGGGGAAGGG - Intergenic
923183098 1:231542084-231542106 GAGCAGTGATCCCTGGGGAAAGG - Intronic
1063499602 10:6541235-6541257 AAGCTGTTGACTCTGCGTAAAGG + Intronic
1063844946 10:10117218-10117240 AAGCAGTTATCACTGAGGAGAGG - Intergenic
1063903412 10:10759241-10759263 AAGCAGGCATCTCTGAGTATTGG + Intergenic
1065412746 10:25447967-25447989 CAGCGGTTATCTCTGGTTAGGGG - Intronic
1066166456 10:32793322-32793344 AAGCAGTTGGCTGTGGGAAAGGG + Intronic
1068796565 10:61088448-61088470 AAGTAGTTATCTCTGAGAAGTGG - Intergenic
1069236179 10:66077234-66077256 AAACTGTTATTTCTAGGTAATGG + Intronic
1071757680 10:88562505-88562527 CATCAGTTAGCTCTGGGGAATGG + Intronic
1071947088 10:90657729-90657751 AAATAGTTATCTATGGATAAAGG + Intergenic
1071950801 10:90700935-90700957 AAGTAGTTATCTGTGGATGATGG + Intergenic
1072193673 10:93096757-93096779 AAGCGGTCATTTCTGGGTGATGG + Intergenic
1073257573 10:102163502-102163524 AAGCTGTTATCTCTGGTCACTGG - Exonic
1073433937 10:103504785-103504807 AAACAATTATCTCTGGGTAAAGG + Intronic
1074127818 10:110543903-110543925 TAACAGTTATCTCTGGCTGATGG - Intergenic
1075132235 10:119749442-119749464 AAGAAGTTGTCTCTGGGTGGTGG + Intronic
1076261274 10:129069013-129069035 AAGCAGGTATCTTGGGGGAAAGG - Intergenic
1076942545 10:133619381-133619403 AAGCTGTTCTCTCTGGGTGCAGG + Intergenic
1078679017 11:13457832-13457854 AAGCAATTATCACTGAGTCATGG + Intronic
1079494270 11:21023441-21023463 AAGGGGTTATCACTGGGTAGCGG + Intronic
1081924807 11:46816659-46816681 AAGTAGTTTTCTCTGGGTGGTGG - Intronic
1081980127 11:47261103-47261125 AAGCAGACAGCACTGGGTAAAGG - Intronic
1082644869 11:55710402-55710424 TAGGAGTTATATTTGGGTAAGGG + Intergenic
1083353423 11:62047397-62047419 AAGCAAATAACTCTGGGTAGTGG - Intergenic
1086934505 11:92729937-92729959 TAGTGGTTATCTCTGGGTAATGG + Intronic
1089707018 11:120285634-120285656 AAGGAGTTACCTCTGGGAAGAGG - Intronic
1089913338 11:122126171-122126193 AAACACTGACCTCTGGGTAAGGG - Intergenic
1090540377 11:127696286-127696308 AAGCAGTTATCACTTGGGCATGG - Intergenic
1090900817 11:131029372-131029394 TAGCAGTTATGTCTTGGGAAAGG + Intergenic
1093714028 12:22361136-22361158 AAGCAATTCTCTCTAGCTAAGGG - Intronic
1096440202 12:51635957-51635979 TAGTAGTTATCTTTGGGGAAAGG - Intronic
1096576197 12:52554342-52554364 CAGCAGGGATCTCTGGGCAAGGG - Intergenic
1096621332 12:52867561-52867583 AAACACATATCTCTTGGTAAGGG + Intergenic
1096973434 12:55684997-55685019 AAGGAGCCATCTCTGGGGAAGGG + Exonic
1097753992 12:63389027-63389049 AAGTGGTTACCTCTGGGTGAGGG + Intergenic
1097792743 12:63832135-63832157 AAGCAGCAATTTCTGGGAAAGGG + Intergenic
1099951111 12:89304764-89304786 AAGCAACTATCTCTGGGTAGTGG + Intergenic
1102184698 12:110938616-110938638 TACCAGTTATTTCTGGGTAGAGG - Intergenic
1103229799 12:119319900-119319922 AAGCAGTAATCTCTAGTTGAAGG - Intergenic
1104138887 12:125967396-125967418 TGGCACTTATCTCGGGGTAAAGG - Intergenic
1104836865 12:131797376-131797398 CAGCAGCTCTCTCTGGGGAAAGG + Intronic
1105643665 13:22292922-22292944 ATGCTGTTATCTCTGAGTAATGG - Intergenic
1106911723 13:34470241-34470263 AAACAGCTCTCTCTGGGAAATGG - Intergenic
1107719664 13:43234904-43234926 AAGCAGCTATCTCTAGTGAAAGG + Intronic
1109832963 13:67816438-67816460 CAGCAATCATCTCTGGGGAAGGG - Intergenic
1109980750 13:69903124-69903146 AAGCAGCCATGTCTGGGTGAGGG + Intronic
1110999161 13:82156010-82156032 AAGCAATTGTCTATGGGTGAGGG + Intergenic
1111121081 13:83850158-83850180 AAGCAGTTATTTTAGGATAAAGG + Intergenic
1112052250 13:95654511-95654533 TAGCACTTACCTCTGTGTAAGGG - Intergenic
1114260496 14:21033057-21033079 AAGCAGGAACCTCTGGGGAATGG + Exonic
1114811879 14:25910363-25910385 AGGCAGTAACCTCTGGTTAAAGG + Intergenic
1116036294 14:39631235-39631257 AAGCAATTCTCTCTGGTTATTGG - Intergenic
1117913374 14:60654667-60654689 AAGCAGTGATACCTGGGTAGTGG - Intronic
1119226831 14:72950907-72950929 GAGCAGTTCTCTCTGAGTAGAGG + Intronic
1119280019 14:73398485-73398507 TAGCAATTATCTCTGGATTAGGG + Intronic
1119289598 14:73484738-73484760 AAGAAGTTCCCTCTGGGCAATGG - Intronic
1121203170 14:92138015-92138037 TGTCAGTTATCTCTGAGTAATGG + Intronic
1122536015 14:102463557-102463579 CAGCAGTTACCTCAGGGTAGAGG + Intronic
1122566728 14:102663502-102663524 TAGAAGTTTTCTCTGGGTTATGG + Intronic
1123688142 15:22814803-22814825 CAGCAGGTGTGTCTGGGTAAGGG - Intronic
1125149406 15:36515111-36515133 TAGTGGATATCTCTGGGTAATGG + Intergenic
1125900456 15:43341808-43341830 CAGTAGTTATCTCTGGGTGGTGG + Intronic
1127814177 15:62592032-62592054 AAGCCGTTATCTGTGGGAAATGG + Intronic
1131966352 15:97848108-97848130 CTGCACTTATCTCTAGGTAAAGG + Intergenic
1131970373 15:97886478-97886500 AAGCAAATATCTCTGGGAAGCGG + Intergenic
1132904509 16:2275551-2275573 GAGGAGTTATTTCTGGGAAATGG + Intergenic
1133519322 16:6542079-6542101 AAAAAGTTATCTCTGTGTGATGG - Intronic
1133567673 16:7010262-7010284 AAGCAGTTTTCTCTTGGTCCTGG - Intronic
1133679959 16:8112070-8112092 AAACAGTTATTTCTTGGTGAAGG - Intergenic
1135614622 16:23900282-23900304 ATGCAGTTATCACTGTGTACAGG + Intronic
1135798579 16:25470984-25471006 AAGTGGCTATGTCTGGGTAATGG + Intergenic
1136042197 16:27588801-27588823 CAGCAGTTATTTCTGGGAAGGGG - Intronic
1136122233 16:28145508-28145530 AAGCAATTATCTCTGGGGTGTGG + Intronic
1136125423 16:28176130-28176152 AAGCAGTTATTTTTGTGTATAGG - Intronic
1137560127 16:49497071-49497093 AAGCAGTGATTTGTGGGTACAGG - Intronic
1139031034 16:62880993-62881015 AAGCAGTTATCTCTAGAGAGTGG + Intergenic
1139792172 16:69447302-69447324 AAGTAGTTTTCTCTGCATAAGGG - Intronic
1140144704 16:72295330-72295352 AAGCAGTTTTCTCAGGCTCAGGG + Intergenic
1142778645 17:2162771-2162793 CAGTAGTTATCTCTGGGTAGTGG + Intronic
1143200050 17:5106650-5106672 CAACAGTTATCTCTTGGTGATGG + Intronic
1149427085 17:56565648-56565670 GAGTAGTTATCTGTGGATAATGG - Intergenic
1149709981 17:58732040-58732062 AAGCTGTTATCACAAGGTAAAGG - Intronic
1152885964 17:82849673-82849695 AAGCAGGTCTCTCTGGACAATGG - Intronic
1153005040 18:490441-490463 AAGAGGTTACCTCTGGGGAATGG + Intronic
1154095728 18:11413488-11413510 AATCAGTTATTTGTGGGGAAAGG - Intergenic
1154957150 18:21270021-21270043 ATGGAGTTATCTCTGGTTAGGGG - Intronic
1155447881 18:25930947-25930969 CAGCATTTATCTCTGGGTAGAGG - Intergenic
1155543968 18:26895812-26895834 CAGTGGTTATCTCTGGGTAATGG - Intergenic
1155903804 18:31424885-31424907 TAGTTGTTGTCTCTGGGTAATGG - Intergenic
1156524011 18:37749422-37749444 CAGTAGTTACCTCTGGGGAAAGG - Intergenic
1156746582 18:40399328-40399350 AAGCAGTTGTATCTTGGTCAAGG - Intergenic
1157679322 18:49591469-49591491 AAGCAGTTATATCTGGCAACCGG - Exonic
1158526465 18:58219135-58219157 AAGCCGATTTCTCTGGGTTAGGG + Intronic
1158947055 18:62456321-62456343 CAGTAGGGATCTCTGGGTAAAGG + Intergenic
1162437481 19:10670789-10670811 AAGCTGTTGTCTCTGGGCAGTGG - Intronic
1163128742 19:15258899-15258921 AAGGAGTTATTTCTGAATAAAGG - Intronic
1163658299 19:18561096-18561118 AAGCAGTTAAATCAAGGTAAAGG + Intronic
1163977278 19:20864156-20864178 AATCAGCTCTCTCTGGGCAAAGG - Intergenic
1165620542 19:37243189-37243211 AAGCTTTGAGCTCTGGGTAAAGG - Exonic
926460255 2:13120924-13120946 AAGCAGTTGCCACTGGGGAACGG + Intergenic
926758832 2:16258895-16258917 AAGTAGTTATTGCTGGGTGATGG - Intergenic
927294643 2:21440286-21440308 GAGCAGTGGTCTCTGGCTAAGGG + Intergenic
927819182 2:26247460-26247482 AAGTAGTTATCTCCGGGTGGTGG - Intronic
928325287 2:30314842-30314864 AAGCAGTTATCTCCAGGGAATGG - Intronic
929938979 2:46316018-46316040 CAGTGGTTATCTCTGGGTGATGG - Intronic
930740021 2:54822738-54822760 AAGCAGTTATCTCTGGGTAATGG + Intronic
932151716 2:69379174-69379196 CAGTAGTTATCTCTGAGAAAGGG - Intronic
933768399 2:85727461-85727483 AAGTGGTTGTCTCAGGGTAATGG + Intergenic
933866166 2:86520085-86520107 TAGTAGTTATCAGTGGGTAAGGG + Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937687821 2:124718264-124718286 AAGCTGTTCTATCTGGGTAGAGG + Intronic
939002303 2:136750273-136750295 ATTCAGTTATGTCTGGGGAAGGG - Intergenic
939698178 2:145354749-145354771 AAGCACTCATCTCTCTGTAATGG - Intergenic
940400392 2:153242181-153242203 AAGCCTTTATCTTTTGGTAATGG + Intergenic
940752034 2:157636712-157636734 AAGAAGATATCTCTGGCTTATGG - Intergenic
942778756 2:179615860-179615882 CATCAGTAATCTCTGGGTGATGG + Intronic
943668947 2:190640005-190640027 CAGTAATTATCTCTGGGTGATGG - Intergenic
944749061 2:202689451-202689473 AAGCAGTTAGCTCTGGATGGTGG + Intronic
944984814 2:205163943-205163965 AAGCTGTTACCTCTGGCAAAAGG + Intronic
945263626 2:207868411-207868433 ACTCAGTTGTCTCTGGGTATTGG + Intronic
945852816 2:215030228-215030250 ATGCAGTTATCTCAGTTTAAAGG + Intronic
948611861 2:239174962-239174984 GAGGAGTTATCTTTGGGGAAGGG + Intronic
948911590 2:241007593-241007615 AAGCACTTATTTTTGGGTGATGG - Intronic
1169605218 20:7310134-7310156 AGGCAGTTAACTCTGGGAATGGG - Intergenic
1169948152 20:11011534-11011556 AAGCAGTGACCTCTGGTCAAGGG + Intergenic
1170223408 20:13964790-13964812 AAGAAGTTATCTATGTGAAAAGG - Intronic
1170675233 20:18473036-18473058 GAGCAGTTACCTCTGGGAAATGG - Intronic
1171078967 20:22158329-22158351 AAGCAGTGTTCTCTGGGTGGAGG + Intergenic
1172395873 20:34604697-34604719 AATCAGTTATTTCTTGATAACGG - Intronic
1172397377 20:34618147-34618169 TAGTGGTTATCTCTGGGTAGTGG + Intronic
1173554130 20:43953595-43953617 AAGGACTTGTCTCTGGGGAAAGG + Intronic
1175220963 20:57416271-57416293 AAGCAGCTGTCTCTGGGATAAGG + Intergenic
1175331471 20:58167715-58167737 AAGCAGCTCTCTCTGGGTGCCGG - Intergenic
1175372987 20:58505095-58505117 GAGCAGTTATCTCTGGGAGGGGG - Intronic
1175554295 20:59836956-59836978 AAGCAGTCAGCTCAGGGAAACGG + Intronic
1177033982 21:16018943-16018965 AAATAGTTATATCTGGGTAAAGG + Intergenic
1177296005 21:19176759-19176781 TTGCAGTAATCTCTGGGTTAAGG - Intergenic
1179131442 21:38640844-38640866 CAGCAGTTACCTCTAGGAAAGGG + Intronic
1179630500 21:42675026-42675048 CAGCGGTTTTCTCTGGGTAGTGG - Intronic
1181386360 22:22548657-22548679 AAGCAGTTAGTGCTGGGGAATGG + Intronic
1181528821 22:23504480-23504502 AAGCAGTTGGCTCTGGTTTAAGG - Intergenic
949308093 3:2665938-2665960 AAGATTTTATCTCTTGGTAAAGG + Intronic
949556283 3:5156370-5156392 AGGCAGTAAACTCTGGGGAAGGG - Intronic
949746664 3:7302217-7302239 TAGCAGTTATCTCTGAGTGCTGG - Intronic
950111985 3:10424920-10424942 AAGGTGGTATCTCTGGGGAAGGG + Intronic
950327432 3:12124822-12124844 GAGTAGTTATCCCTGGGGAAGGG + Intronic
950397666 3:12746353-12746375 GGGTGGTTATCTCTGGGTAATGG + Intronic
950767941 3:15287629-15287651 AAGCAGCTATGTGTGGCTAATGG + Intronic
951051072 3:18094406-18094428 AAGTGGTTATCTCTGGGGAGGGG - Intronic
952583711 3:34865875-34865897 AAGAGGTTATCTCTGGATGATGG - Intergenic
953935842 3:47041726-47041748 AATGAGTTATCTCTGAGTAGTGG + Intronic
956808136 3:72837228-72837250 AAGAATATATCTCTGGGTATGGG + Intronic
956810305 3:72858082-72858104 AGGTAGTTCTCTCTAGGTAAGGG - Intronic
957024821 3:75169262-75169284 AAACAACTGTCTCTGGGTAATGG - Intergenic
957168595 3:76708403-76708425 TAGCTGTTATTTCTGGGAAATGG + Intronic
958891907 3:99793496-99793518 AAGTGGTTATCTCTGAGTAGTGG + Intronic
960527855 3:118730828-118730850 AAGGAGTTGTCTTTGGGTCAGGG - Intergenic
960970474 3:123135725-123135747 AAGTTGTTACCTCTGGATAATGG - Intronic
961780497 3:129317608-129317630 AAGCAGGCTTCTCTGGGTGAGGG + Intergenic
962274789 3:134003818-134003840 AATCAGTTGACACTGGGTAAGGG + Intronic
962285260 3:134079938-134079960 AAACAGGAATTTCTGGGTAAAGG - Intronic
963363823 3:144309282-144309304 AAGCACTCAACTCTAGGTAATGG - Intergenic
964352813 3:155819951-155819973 AAGCAGTTGTGTTTGGGTATGGG - Intergenic
966299722 3:178464563-178464585 AATCAATTCTCTCTGGGGAATGG - Intronic
966524269 3:180903909-180903931 ACGCAGTTGTCTCTGGGAAAAGG - Intronic
966596910 3:181732307-181732329 AAGCAGTTATCTCCAGCTCATGG + Intergenic
966872710 3:184301781-184301803 AAGCACTTCTCTGTGGGTCAAGG - Intronic
968201265 3:196757476-196757498 AAGCAGGTATCTCTGAGAAGTGG + Intronic
969370819 4:6730356-6730378 CAGCAGTTGTTTCTGGGTGATGG + Intergenic
970812355 4:20109281-20109303 AAGCAATTATCTCTGTATCAGGG - Intergenic
971897448 4:32616083-32616105 AAGCAGATATCTCTGGGAGTAGG - Intergenic
974392731 4:61293765-61293787 AAGCAGTGAGCTTTGGGGAAAGG + Intronic
974688227 4:65260498-65260520 AAGCAGTTATGTCTGTGTGGTGG - Intergenic
976681357 4:87759669-87759691 AATCATTTATCTCTGGTTATTGG - Intergenic
976929312 4:90544881-90544903 AAGCAGATCTCTCTGGGGAGGGG + Intronic
977713952 4:100159887-100159909 AAGCAGTTCTCTTTGGTTACTGG + Intergenic
978234218 4:106438270-106438292 AAGATGTTACCACTGGGTAAAGG - Intergenic
979339094 4:119499468-119499490 CTGTAGTTTTCTCTGGGTAATGG + Intronic
979855622 4:125629785-125629807 AAGCAGTTCTATATGGTTAATGG + Intergenic
981040864 4:140220228-140220250 AAGCAGCTGTCTTTGGGGAACGG + Intergenic
981681187 4:147400187-147400209 GAGCAGTTACCTCTGAGTAGAGG - Intergenic
981929455 4:150174105-150174127 AAGCAGTTTTATCTGAGTAGTGG - Intronic
983896782 4:173089625-173089647 ACCCAGTTATCTCTGGATAGTGG + Intergenic
985121733 4:186649970-186649992 AAGTGGTTATCTCTGAATAATGG - Intronic
987281209 5:16415397-16415419 CATCAGCTATCTCTGGGTGAGGG - Intergenic
987296267 5:16554596-16554618 ATGTAGTTATCTCAGGGTGAGGG - Intronic
989259313 5:39401444-39401466 AAACAGTTAACTTTGGGTAGAGG + Intronic
990083860 5:51951318-51951340 AATCACTTACTTCTGGGTAAAGG - Intergenic
990521188 5:56582975-56582997 AAGCAGTTTCCCCTGGGAAAGGG + Intronic
991024237 5:62012732-62012754 AAGGAGTTTTCTCTGGGGGATGG - Intergenic
991327777 5:65456748-65456770 ACTTAGTTATCTCTGGGTATTGG + Intronic
991331401 5:65496665-65496687 AAGTGGTTATCTCTGGGTGGTGG + Intergenic
991479858 5:67066324-67066346 AAGTAGTTAATTCTGAGTAATGG - Intronic
992552622 5:77873601-77873623 AAGTAGTTATCCCTGGGGAAAGG - Intergenic
995952962 5:117739016-117739038 AAGTAGCTATCTATGGCTAATGG - Intergenic
996316946 5:122170653-122170675 AATCAATTATCTCTGTGAAATGG - Intronic
996864581 5:128105619-128105641 AAAAAGTTAACTCTGGTTAAAGG + Intronic
997643344 5:135464189-135464211 AAGGGGTGATCTCTGAGTAAGGG - Intergenic
999146842 5:149401869-149401891 GAGAAGTTATCTCTGGGTGGAGG - Intronic
1001047075 5:168382351-168382373 CAACAGTTACCTCTGGGCAATGG + Intronic
1004955887 6:20727164-20727186 AAACAGTTACCTGTGGGTCAAGG - Intronic
1005657423 6:27955453-27955475 AAGCTGTTACTTCTGGGGAATGG - Intergenic
1006422227 6:33942192-33942214 AAGCAGTGATCCCTGGGTATGGG + Intergenic
1007956239 6:45920221-45920243 AAGGAGTTTTCTCTGAGTAGAGG + Intronic
1010162949 6:72880085-72880107 AAACAGTTTTCCCTGGGGAAAGG - Intronic
1012052730 6:94363593-94363615 AAGTAGTAATCTTTGAGTAAGGG - Intergenic
1012211970 6:96530763-96530785 AAGCAGGGATCTCTGGAGAAAGG - Intronic
1012682052 6:102194722-102194744 ATGGAGTTAGCTCTGGGTATTGG - Intergenic
1013629207 6:111969079-111969101 TAGCAGAAATCTCTGGGAAATGG + Intergenic
1015706946 6:136098366-136098388 AAGCAGATTTCTCTGAGTATAGG - Intronic
1015835955 6:137420171-137420193 AAGCAGCTAACTCTGGCTGAGGG - Intergenic
1015897516 6:138031631-138031653 GAGCAGTGCTCTCTGGGGAAAGG + Intergenic
1016572395 6:145529815-145529837 AAGCAATTTTCTCTGGTTACCGG - Intronic
1020753641 7:12172752-12172774 AAGCTGTTGTTTCTGGGTAACGG + Intergenic
1022078267 7:26994750-26994772 AAAGAGTTCTCTCTGGGAAAGGG - Intronic
1023440091 7:40176553-40176575 AATTTGTTATCTCTGGGCAAAGG - Intronic
1023569447 7:41556835-41556857 AAGTAGGTTTCTCAGGGTAAAGG - Intergenic
1023803319 7:43853526-43853548 AATCAGTGAACTCTGAGTAAAGG + Intergenic
1026505699 7:70980722-70980744 ATGCACTTGTCTCTGGGTTACGG + Intergenic
1027308962 7:76934401-76934423 AAGCAGTTATTTGTTGGTAATGG - Intergenic
1027402341 7:77822103-77822125 TAGCAGTTTTCTCTGGCTCAAGG + Intronic
1027640945 7:80733151-80733173 AAGCAGTTATCTGTGGTGTAGGG + Intergenic
1030644156 7:112040948-112040970 AAGTAGTTATCTCTGGATGACGG + Intronic
1030814568 7:114019961-114019983 GAGAAGTTATCTTTGGGTAAAGG + Intronic
1031433222 7:121699127-121699149 CAGCAGTCATCTGTGGGTCATGG - Intergenic
1034511796 7:151541522-151541544 TAGGAGTTACCTCTGGATAATGG - Intergenic
1036383405 8:8255234-8255256 TAGCAGTTCTCTGTAGGTAAAGG - Intergenic
1037069918 8:14631491-14631513 AACCAATTATCTCTGGGCAAGGG - Intronic
1039371176 8:36985475-36985497 CAGTAGATATCTCTGGGTGATGG + Intergenic
1045210777 8:100097138-100097160 TAGCAGGTGTCTCTGGGGAATGG + Intronic
1047219292 8:122906582-122906604 AAGCAGTTACTTCTGGGGATTGG + Intronic
1047475810 8:125227771-125227793 ATGTGGTTATCTCTGGGTAACGG - Intronic
1047835371 8:128684377-128684399 ATGTAGATGTCTCTGGGTAATGG - Intergenic
1047845381 8:128800086-128800108 AAGCAGTTAACCCTGGGGAAGGG - Intergenic
1051743316 9:20272321-20272343 CAGCAGTTCTCTCTGGATGATGG - Intergenic
1051846430 9:21456234-21456256 GGGCAGTTATCTCTGAGTTACGG - Intergenic
1053559317 9:39173731-39173753 AAGCTGGTATCTCTGGGTTCTGG - Intronic
1054137794 9:61445215-61445237 AAGCTGGTATCTCTGGGTTCTGG + Intergenic
1056098305 9:83276363-83276385 ATGCATTTTTCTCTGAGTAAAGG + Intronic
1057425083 9:94941967-94941989 CAGTAATTATCTTTGGGTAAGGG - Intronic
1058063291 9:100522410-100522432 AAGAAGATATTTCTGGATAAAGG - Intronic
1058872179 9:109212106-109212128 CAGCAGTTTGCTCTGGGTGAAGG - Intronic
1058942710 9:109828632-109828654 AAACAAATATCTCTGGGTAGTGG - Intronic
1060121694 9:120997254-120997276 AATTAGATATCTCTGGGTATGGG + Intronic
1061047219 9:128172742-128172764 CAGTGTTTATCTCTGGGTAATGG + Intronic
1061280856 9:129597155-129597177 AAGCAGTTCTGTCTGGCCAAGGG + Intergenic
1061612647 9:131757861-131757883 AAGCTGCTATCAATGGGTAAAGG + Intergenic
1062505239 9:136870700-136870722 AAGCAGTAACCTCTGGGGATTGG - Intronic
1186027324 X:5327296-5327318 AATCAGTTCTCTCTGGGCAATGG - Intergenic
1186060113 X:5695789-5695811 TAGTAGTTATGTCTGGGTAGGGG + Intergenic
1187780079 X:22811419-22811441 TTGCAGTTATCTCTGGGTGGAGG + Intergenic
1188271420 X:28146275-28146297 GTCCAGTTATATCTGGGTAAAGG - Intergenic
1188618845 X:32194363-32194385 AAGTGGTTACCTCTGGGTGAGGG - Intronic
1189119044 X:38374262-38374284 AAGCAGGCTTCTCTGGATAAAGG + Intronic
1189394106 X:40604653-40604675 CAGCAGTTACCTCTGGATGAGGG - Intronic
1189710731 X:43809057-43809079 AATAATTTATCTCTGGGGAAAGG - Intronic
1189731707 X:44027632-44027654 AAGGAGTTCTTTCTGGGTACAGG + Intergenic
1191664644 X:63687325-63687347 AGGCAGTGATCTCAGGCTAAGGG + Intronic
1193480227 X:82018604-82018626 GAGTAGTTATCTATGGGTGAAGG - Intergenic
1196105887 X:111894887-111894909 AAGTGGTTACCTCTGGGTAGGGG - Intronic
1196113643 X:111974170-111974192 AAGCAGTGGTCTCTGAGTGATGG + Intronic
1196693626 X:118587326-118587348 CAGTAGTTATCTCTGGGTGGCGG + Intronic
1197651976 X:129075007-129075029 AATCAGTTACATCTGGCTAATGG + Intergenic
1201195029 Y:11484583-11484605 AAGGAGTTACCTGTGGATAAAGG - Intergenic