ID: 930748870

View in Genome Browser
Species Human (GRCh38)
Location 2:54913116-54913138
Sequence GGGTGTGAGACAGCATCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930748870 Original CRISPR GGGTGTGAGACAGCATCTTG TGG Intronic
901630106 1:10643761-10643783 GGGACTGAAACAGCATCATGGGG + Intronic
903147119 1:21381516-21381538 GGCTGAGAGACAGTATCTGGAGG + Intergenic
904115686 1:28160201-28160223 GTGTGTGTGACAGGGTCTTGAGG - Intronic
904700875 1:32357344-32357366 GGGTGTGAGTCTGTATCTGGAGG + Intronic
905743137 1:40389675-40389697 TGGTGTGACACATCATCCTGGGG + Intronic
906931080 1:50170142-50170164 CAGTGTCAGACAGTATCTTGTGG + Intronic
907407964 1:54265367-54265389 GGGGCTGAGACACCAACTTGAGG + Intronic
908069903 1:60448630-60448652 GGATGTGAGCCAGGAGCTTGGGG + Intergenic
908462725 1:64361535-64361557 GGGTGTGAAGTGGCATCTTGTGG - Intergenic
910148201 1:84107777-84107799 TGGTGTGAGATGGTATCTTGTGG - Intronic
911549554 1:99263181-99263203 GGATGTGAGACAGCATCATGCGG + Intergenic
916965035 1:169929867-169929889 GGGTGAAAAACAGCACCTTGGGG + Intronic
917990213 1:180368089-180368111 TTGTGTGAGACGGTATCTTGTGG + Intronic
918797222 1:188916343-188916365 GGGAGGGAGAAAGAATCTTGTGG + Intergenic
919115637 1:193277203-193277225 GGGTTTTATAGAGCATCTTGAGG + Intergenic
919812480 1:201417797-201417819 GGCAGTGAGACAGCACCTAGGGG + Exonic
920680860 1:208071469-208071491 GGGTCTGAGAAAGCAAATTGTGG + Intronic
920824493 1:209412807-209412829 GGGTGTGAGACAGCAAGTTTGGG + Intergenic
1066154431 10:32659767-32659789 TGGTGTGAGACGGCATCTCATGG - Intronic
1067923766 10:50486602-50486624 TGGTGTGAGATGGCATCTAGTGG - Intronic
1070560399 10:77562187-77562209 GGGTGTGGCACAGCAGCTGGGGG - Intronic
1071363817 10:84878483-84878505 GTGTGTGAGACAGAGTCATGTGG + Intergenic
1071418926 10:85469510-85469532 TGGTGTGAGATGGTATCTTGTGG - Intergenic
1072818236 10:98530800-98530822 GGGTGGGAGGCATCATGTTGGGG - Intronic
1074369859 10:112891567-112891589 GGGTGGGAGCCAGCATTTTGTGG - Intergenic
1075719427 10:124576308-124576330 GGGTATGAGGCAGCATGTGGGGG + Intronic
1076455607 10:130591713-130591735 GGATGTGAAATAGTATCTTGTGG + Intergenic
1077917483 11:6621097-6621119 GGGTGGGAGAGGGGATCTTGGGG - Intergenic
1080763234 11:35272718-35272740 GAGTGTGTGACACCATCTTTGGG + Intronic
1083013083 11:59422695-59422717 TGATGTCAGACAGCATCTTAGGG + Exonic
1090217115 11:124978547-124978569 TGGTGTGAGATGGTATCTTGTGG + Intronic
1091681909 12:2533413-2533435 GGGTATGAATGAGCATCTTGGGG - Intronic
1092627368 12:10341156-10341178 TGGTGTGAGATAATATCTTGTGG + Intergenic
1097397741 12:59096419-59096441 GGCTGTGAGACAGCAATGTGAGG + Intergenic
1097767966 12:63547376-63547398 GGGTCTCAGACAGCACCATGTGG - Intergenic
1097784326 12:63742442-63742464 GGGTCTCAGACAGCACCATGTGG - Intergenic
1097981630 12:65742174-65742196 GGGTGTGAGACAGGAGATGGTGG - Intergenic
1102528181 12:113526914-113526936 TGTTGTAAGACAGCAACTTGGGG + Intergenic
1102966528 12:117132012-117132034 AGGTGTGAGCCAGCATGCTGGGG - Intergenic
1103455481 12:121062019-121062041 GGGTGTGGAGCATCATCTTGTGG - Intergenic
1104594767 12:130113581-130113603 GGGTGTGGGACAGCACCTGCTGG + Intergenic
1105333867 13:19445395-19445417 GGGTGTGTGATGGCATCTTATGG - Intronic
1108795661 13:54026918-54026940 TGGTGTGAGATGGCATATTGTGG - Intergenic
1110784837 13:79511577-79511599 GTGTGTGATACTGAATCTTGAGG + Intronic
1111211448 13:85085098-85085120 AGGAGTGAGACTCCATCTTGGGG - Intergenic
1112762242 13:102704441-102704463 GGGTATGAGACATCACCTAGGGG + Intergenic
1115830528 14:37335204-37335226 GGATGTGAGGTAGTATCTTGTGG + Intronic
1118371577 14:65141689-65141711 GGGTGAGGGAGAGCATCTGGTGG - Intergenic
1119350779 14:73963264-73963286 ATGAGTGAGACAGCACCTTGTGG - Exonic
1121172602 14:91867623-91867645 GGGTGTGAGAAATGCTCTTGGGG + Intergenic
1121816441 14:96932576-96932598 GGATGGGAGACAGGATCATGAGG + Intergenic
1121993653 14:98584935-98584957 GGGTGATAGAGAGCATCTTTGGG + Intergenic
1122522591 14:102355596-102355618 GTGTCTAAGACAGCATCTTGGGG + Intronic
1122576696 14:102747419-102747441 GCCTGTGAGTCAGCTTCTTGAGG + Intergenic
1123766000 15:23478753-23478775 GGTTGTGTGAAAGGATCTTGTGG + Intergenic
1131369742 15:91869755-91869777 GGGTTTAAAACATCATCTTGGGG + Intronic
1131793226 15:95987550-95987572 GAGTATGTGACAGCATCTTCTGG - Intergenic
1132242428 15:100268494-100268516 TGGTGTGAGATGGTATCTTGTGG + Intronic
1133311842 16:4853275-4853297 GAGTGAGTGACAGGATCTTGGGG - Intronic
1134135055 16:11672257-11672279 GGGAGTGAGACAGCAGCCAGGGG + Intronic
1134630000 16:15749692-15749714 GGCTGTTAGTCAGCATCTAGTGG - Intronic
1135584032 16:23653977-23653999 TGGTGTGAGACGGTATCTCGTGG - Intronic
1135749578 16:25046292-25046314 GGGTGTGAAATAGCATCTCATGG + Intergenic
1135847580 16:25932580-25932602 GAGTATGAGACAGTACCTTGAGG - Intronic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1137562721 16:49513244-49513266 GGGTGTCAGCCAGCAACTTCAGG + Intronic
1138234826 16:55373434-55373456 GACTGCGAGACAGCATCCTGGGG + Intergenic
1138998354 16:62478901-62478923 GGGTGTTAGAGTGTATCTTGGGG - Intergenic
1139933686 16:70551252-70551274 GGGTATGAGACTGTATCTTTAGG - Intronic
1140919294 16:79522086-79522108 GGGATAGAGACAGCATCCTGGGG + Intergenic
1142116528 16:88359071-88359093 AGCTGTGTGACAGCATCTTTGGG - Intergenic
1143032675 17:3976554-3976576 GGGGGTGGGACAGCGTCTGGAGG + Intergenic
1144626379 17:16846281-16846303 GGGTGAAAGACAGCAACTTCAGG - Intergenic
1144880054 17:18426439-18426461 GGGTGAAAGACAGCAACTTCAGG + Intergenic
1145119311 17:20242457-20242479 GTGTGTGACACAGCATCAGGCGG + Intronic
1145152179 17:20517945-20517967 GGGTGAAAGACAGCAACTTCAGG - Intergenic
1148212272 17:45815805-45815827 GGGAGGGAGACACCATCTGGGGG - Intronic
1148943550 17:51237614-51237636 AGGTGTGTTACAGTATCTTGTGG - Intronic
1150514097 17:65789588-65789610 GGGTGTGAAATAGCATATTCAGG - Intronic
1151679756 17:75617078-75617100 GGCTGGGGGACAGCATCTGGGGG - Intergenic
1152667816 17:81581448-81581470 GGGTTTGAGGGAGCCTCTTGAGG - Intronic
1155070768 18:22314044-22314066 GGGGGTGAGATATCTTCTTGAGG + Intergenic
1156680425 18:39581970-39581992 GGAACTGGGACAGCATCTTGGGG - Intergenic
1157316263 18:46592477-46592499 GGGTGAGATGCACCATCTTGGGG - Intronic
1158325809 18:56313058-56313080 GGGTGGGAGACAGCATTTGAGGG - Intergenic
1158641003 18:59203396-59203418 GGTTGTGAAAAAGGATCTTGTGG + Intergenic
1158763395 18:60417600-60417622 TGGAGTGAGATAGTATCTTGTGG + Intergenic
1159923168 18:74244726-74244748 GGGTGTGAAATGGCATCTTGTGG + Intergenic
1160476151 18:79190114-79190136 GGGTTTGATACTGCATCTTCAGG + Intronic
1162709297 19:12579786-12579808 CAGAGTGAGACACCATCTTGGGG + Exonic
1163133767 19:15294346-15294368 AGCTGGCAGACAGCATCTTGAGG - Intronic
1164284021 19:23794394-23794416 TGATGTGAGATGGCATCTTGTGG + Intronic
1165092848 19:33395804-33395826 GGGTGTGAGCCAGGCTCTAGGGG + Intronic
1165272075 19:34718575-34718597 GTGTGTGAGATGGCATCTTGTGG - Intergenic
1165703685 19:37958969-37958991 TGGTGTGAAATAGAATCTTGTGG - Intronic
1166109890 19:40615215-40615237 GTGTGTGAGTCCGCATCTTGTGG + Intronic
926397931 2:12464898-12464920 GTATGTGAGACAGTATCTTTTGG + Intergenic
927186466 2:20485855-20485877 GGGGGTCATACAGCCTCTTGGGG + Intergenic
928147789 2:28795519-28795541 TGGTGTGAGACAGTATCTTGTGG + Intronic
930748870 2:54913116-54913138 GGGTGTGAGACAGCATCTTGTGG + Intronic
933978187 2:87528701-87528723 GGGTGTGAGACATGGTCTTATGG + Intergenic
937749167 2:125453818-125453840 GGGAGAGAGGCAGCATGTTGGGG - Intergenic
937974092 2:127570717-127570739 GGGTGTGAGAGAAGATCTGGGGG - Intronic
940497769 2:154455213-154455235 CGGTGGGAGACAGTATTTTGAGG - Intergenic
942888750 2:180961702-180961724 GCTTTTGAGACAGCATTTTGTGG + Intergenic
944127808 2:196314155-196314177 GGGTTTGAGCCAACATCATGTGG - Intronic
945865649 2:215172046-215172068 AGCTGTGAGACAGCATGCTGTGG + Intergenic
945917302 2:215717395-215717417 GAGTCTGAGAAATCATCTTGAGG + Intergenic
948846651 2:240686092-240686114 GGCTGTGTGTCAGCATCTGGAGG + Intergenic
948884161 2:240874667-240874689 GGGTGTGAGTCAGGAGCCTGGGG + Intronic
1171060285 20:21950056-21950078 TGGAGGGAGACAGCATCTTCAGG + Intergenic
1171412953 20:24958796-24958818 GGAAGTGGGCCAGCATCTTGGGG - Intronic
1171990395 20:31691842-31691864 GGGTGTGAGATGGTATCTTGCGG - Intronic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1174643179 20:52062845-52062867 GGGTGTCAGACAACTTCCTGGGG + Intronic
1174659741 20:52201303-52201325 GGGCCTGGGACAGAATCTTGGGG + Intronic
1175051680 20:56161277-56161299 GGATGTGAGACAGCAGGCTGGGG - Intergenic
1178825468 21:36012654-36012676 GGGTGTGAGGAAGTATCTTGTGG - Intergenic
1179011450 21:37559399-37559421 GAGTGGGAGACTCCATCTTGGGG - Intergenic
1179060876 21:37978158-37978180 GGGTGTGAAATTGCATCTTGTGG - Intronic
1179171507 21:38976578-38976600 CAGTCTAAGACAGCATCTTGCGG + Intergenic
1181117154 22:20639288-20639310 GAGTGTGGGACAGCACTTTGGGG - Intergenic
1181442140 22:22942130-22942152 GTGTGTGTGACAGCATCCTGTGG - Intergenic
1182523960 22:30903953-30903975 AGGTCTGAGGCTGCATCTTGGGG + Intronic
1184893572 22:47394018-47394040 GGCTGTGTGGCAGCATGTTGGGG - Intergenic
950297725 3:11846576-11846598 GGAAGTGAGACAGGATCTTGCGG + Exonic
952903921 3:38127417-38127439 GGGTCTGTGGCAGCATCCTGAGG - Intronic
953921332 3:46954053-46954075 TGGTGGGAGACAGCTTCGTGTGG + Intronic
954686861 3:52375857-52375879 GTGGGGGAAACAGCATCTTGGGG - Intronic
956868658 3:73394635-73394657 GGATGTGAGACAGGATGGTGTGG + Intronic
961623668 3:128244204-128244226 GGCTGTGAGACTGGGTCTTGAGG - Intronic
961721744 3:128901613-128901635 GGGTATGAGAAAGCAGCCTGTGG + Intronic
963199318 3:142569977-142569999 GGGTGTGAAACAGTATCCTGTGG + Intronic
966756393 3:183375521-183375543 CGGTCTGAGACATCGTCTTGAGG + Intronic
967722383 3:192829042-192829064 GGGTGTGAGAAAACTTTTTGGGG - Intronic
968812527 4:2806358-2806380 GGGTGGGAGCCAGGAACTTGGGG + Intronic
971235953 4:24842608-24842630 GGGTGTGAGTCGTCAGCTTGCGG + Intronic
972178058 4:36431715-36431737 TGGTGTGAGATAGCATCTCATGG - Intergenic
973241461 4:47960205-47960227 AGGTGTGAAAAAGTATCTTGTGG - Intronic
973570450 4:52233674-52233696 TGCAGGGAGACAGCATCTTGGGG - Intergenic
974412221 4:61556351-61556373 GGCTGTGAGACAGGAGTTTGAGG + Intronic
975687999 4:76936913-76936935 GGGTCTGGGACAGCATCTTTGGG + Intergenic
976345030 4:83990289-83990311 GGTTGTGAAAAAGGATCTTGTGG + Intergenic
981130238 4:141150416-141150438 GGGTGTGAGCCATCACCCTGTGG + Intronic
982276316 4:153640035-153640057 GGGTGGGAGGGAGCCTCTTGGGG + Intergenic
988075462 5:26347933-26347955 GAGTTTGAGAAAGTATCTTGGGG + Intergenic
988118264 5:26925249-26925271 TGGTGTGAGATAGTATCTCGTGG + Intronic
990969047 5:61483120-61483142 GGTTGAGAGGCTGCATCTTGTGG + Intronic
991619778 5:68533599-68533621 GGGCATGTGACAGCATTTTGCGG - Intergenic
992972374 5:82075030-82075052 GGGTGTTGCACAGCTTCTTGTGG + Intronic
993794859 5:92254512-92254534 TGGTATGAGACGGCAGCTTGTGG - Intergenic
996514006 5:124349791-124349813 GGAGGAAAGACAGCATCTTGAGG - Intergenic
996945941 5:129067567-129067589 GGCTGTGAGAAAGCTTCTAGGGG + Intergenic
1000431400 5:161156927-161156949 TGGTGTGAGATAGTATCTTATGG - Intergenic
1002376138 5:178790369-178790391 GGCCCTGAGACAGCATCGTGAGG + Intergenic
1005096959 6:22127019-22127041 TGGTGTGAGACAGTATCTTGTGG + Intergenic
1005829415 6:29658639-29658661 GAATGTGGCACAGCATCTTGAGG - Intronic
1007114516 6:39334187-39334209 GGGTGTGAACCAGCCTCCTGGGG - Exonic
1007752781 6:44080557-44080579 GGTTGGGAGGCAGCTTCTTGTGG - Intergenic
1008509728 6:52264892-52264914 GTGTGTGAGAAAGAATATTGAGG - Intronic
1008777416 6:55057502-55057524 TGGGGTGAGATGGCATCTTGTGG + Intergenic
1010288660 6:74110238-74110260 GGCTGGGAGATAGCATCTTTAGG + Intergenic
1012236187 6:96818960-96818982 TGGTGTGAGATGGTATCTTGTGG - Intronic
1012796098 6:103763716-103763738 AGGTGTAAGCCAGTATCTTGTGG - Intergenic
1013497673 6:110714601-110714623 GGGTGTGAAGTAGTATCTTGTGG + Intronic
1013887151 6:114981910-114981932 GTAAGTGAGACAGCAGCTTGGGG - Intergenic
1014104700 6:117548384-117548406 GGGTGTGAGGCAGTCTCTGGGGG - Intronic
1014251576 6:119120699-119120721 GGGTGTGAAATAGGATCTAGTGG + Intronic
1014785838 6:125617994-125618016 GGGTGTGAGACATCAGAGTGGGG + Intergenic
1014854678 6:126385052-126385074 TGGTATGAGACAGTATCTTATGG - Intergenic
1015264359 6:131275774-131275796 TGGCTTCAGACAGCATCTTGGGG + Intronic
1017268535 6:152479171-152479193 GGGTGTAGGACAGGATCCTGGGG + Intronic
1019413271 7:915872-915894 GGGTGGCAGACAGCGTCTCGTGG - Intronic
1020077191 7:5266105-5266127 GTGTGTGTGACAGCGTTTTGGGG + Intergenic
1021962772 7:25889181-25889203 GTTTTTGAGACAGGATCTTGTGG - Intergenic
1023190954 7:37581893-37581915 GGGTGTGAGATAGCTCATTGTGG + Intergenic
1023286762 7:38629404-38629426 GGGGGTGAGAGACCCTCTTGGGG - Intronic
1024047132 7:45592552-45592574 GGCTGTGAGACAGCATGTCAGGG - Intronic
1027535818 7:79399482-79399504 GGGTTGTAGAGAGCATCTTGTGG + Intronic
1028068660 7:86421050-86421072 GGGTTAGAGGCAGAATCTTGAGG - Intergenic
1028629566 7:92919927-92919949 AGGTGTGAGATGGTATCTTGTGG + Intergenic
1032708941 7:134445963-134445985 GAGTGTGTGTCAGCCTCTTGTGG - Intronic
1033058407 7:138081358-138081380 GTGTGTGAGAGTGGATCTTGGGG - Intronic
1033668520 7:143466662-143466684 GGGTGTGAAATGGTATCTTGTGG + Intergenic
1034873555 7:154705294-154705316 GGGACTCAGACAGCATCCTGGGG + Intronic
1035355982 7:158276380-158276402 GGGGGTGATACAGCCTGTTGGGG - Intronic
1036921934 8:12864490-12864512 GGGTGAGAGGAAGCATCTGGCGG + Intergenic
1037155119 8:15690211-15690233 TGGTGTGAGGTAGCATCTTGTGG + Intronic
1037295328 8:17393994-17394016 GGGTGTGAAGCGGTATCTTGTGG - Intronic
1039994102 8:42516528-42516550 TGGTCTAAGACAGAATCTTGTGG - Intronic
1046724397 8:117658673-117658695 GGGTCTGAGACAGCAACCTTGGG + Intergenic
1047974823 8:130119626-130119648 GGCTGTCAGACAGCATCACGTGG - Intronic
1048212782 8:132469346-132469368 GCGTGAGTGGCAGCATCTTGAGG - Intronic
1049820242 8:144629036-144629058 GGGTGTGAGCCAACACCTTTGGG - Intergenic
1050590583 9:7156056-7156078 TGGTGTGAGATGGTATCTTGTGG + Intergenic
1050955718 9:11656611-11656633 GGTTCTGAGACATCATCATGAGG - Intergenic
1051334448 9:16053740-16053762 GTGAGGGAGACACCATCTTGAGG - Intronic
1052476893 9:28971576-28971598 GAGTGGGAGACTGCATCTTGTGG + Intergenic
1057173622 9:92978381-92978403 GAGTGTCAGTCAGCATCTGGTGG - Intronic
1057799049 9:98178663-98178685 GGGTGTCAGGCAGCCTCATGTGG - Intronic
1061167701 9:128933739-128933761 AGGACTGAGACAGCATCCTGGGG - Intronic
1061296296 9:129678656-129678678 GGGTGGGAGAGAGCATGATGGGG + Intronic
1061543164 9:131289162-131289184 GGGAGTGTGACAGCAGCTTCAGG - Intergenic
1061883314 9:133578701-133578723 GGGTCTGAGACAGAATCATCAGG + Exonic
1186069747 X:5805928-5805950 GGCTGGGAGACAGAATTTTGGGG + Intergenic
1187317202 X:18207016-18207038 GGGTGGGAGGCAGCATCTGTGGG - Intronic
1187925319 X:24244496-24244518 GGGTGTGAGCAAGCACTTTGTGG - Intergenic
1191119793 X:56891288-56891310 GGGTGTCAGACACCCACTTGAGG - Intergenic
1191131672 X:57019757-57019779 TGGTGTGAGATGGTATCTTGTGG + Intergenic
1191740874 X:64434306-64434328 GGGTTTGAGTCAGAAACTTGGGG + Intergenic
1191906450 X:66096301-66096323 TGGTGTGAGATGGTATCTTGTGG - Intergenic
1192634637 X:72805777-72805799 GGGAGTCAGTCAGCATCTGGTGG + Intronic
1192647076 X:72915024-72915046 GGGAGTCAGTCAGCATCTGGTGG - Intronic
1193371084 X:80698009-80698031 TGGTGTGAGATGGTATCTTGTGG + Intronic
1193906690 X:87253403-87253425 GGGTGTCAGGCACCAACTTGAGG + Intergenic
1194275033 X:91868106-91868128 GGGTGAATGACAGAATCTTGTGG - Intronic
1196520616 X:116667272-116667294 GGTTGTGAAAAAGGATCTTGTGG - Intergenic
1198933141 X:141880727-141880749 GGATGTGAGAAAGCACCTCGGGG - Intronic
1198935129 X:141896400-141896422 GGATGTGAGAAAGCACCTCGGGG - Intronic
1198962337 X:142195719-142195741 GGATGTGAGACAGCACCTCGGGG + Intergenic
1200109906 X:153735461-153735483 GGGTGTGAGGCAGTATCTCTTGG + Intronic
1200592275 Y:5089511-5089533 GGGTGAATGACAGAATCTTGTGG - Intronic
1202257264 Y:22934651-22934673 GTTTTTGAGACAGAATCTTGCGG - Intergenic
1202410255 Y:24568398-24568420 GTTTTTGAGACAGAATCTTGCGG - Intergenic
1202460527 Y:25101674-25101696 GTTTTTGAGACAGAATCTTGCGG + Intergenic