ID: 930749324

View in Genome Browser
Species Human (GRCh38)
Location 2:54917726-54917748
Sequence TGTGATCTTACTACAGATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930749324 Original CRISPR TGTGATCTTACTACAGATGA CGG (reversed) Intronic
901575604 1:10198396-10198418 GGAGATCTTACAACAGATGGCGG - Intergenic
901609496 1:10486083-10486105 TGTGATTTCTCTATAGATGATGG + Intronic
902224131 1:14985827-14985849 TGTATTCTTAGTAGAGATGAGGG - Intronic
903074545 1:20752647-20752669 TGTCAGCTTACCACAGATAAAGG + Intronic
904461754 1:30684901-30684923 TGTCACCTTGTTACAGATGAGGG - Intergenic
905778878 1:40690528-40690550 TTAGATCTTTTTACAGATGAAGG + Intergenic
908142480 1:61201094-61201116 TGAGATCTTACTACATATCTTGG - Intronic
908536290 1:65081008-65081030 TGTGATCTGCCCACAGATCATGG + Intergenic
910464178 1:87478805-87478827 TGTTATCATTTTACAGATGATGG + Intergenic
912031982 1:105259385-105259407 TGTGATTATACTATATATGATGG + Intergenic
912699580 1:111867082-111867104 TGTCTCCTTTCTACAGATGAAGG - Intronic
912985284 1:114421873-114421895 TATGATCTTATTTCAGAAGAAGG + Intronic
913999001 1:143676564-143676586 TGTGAATATACTACAGTTGATGG + Intergenic
914358997 1:146913910-146913932 TGTTATCATTTTACAGATGATGG + Intergenic
914494748 1:148185966-148185988 TGTTATCATTTTACAGATGATGG - Intergenic
914576964 1:148981210-148981232 TGTGGACTCACTACAGTTGATGG + Intronic
916063008 1:161114668-161114690 TGTTATGTTTCTACAGATGGGGG + Intronic
918590821 1:186239054-186239076 AGTTATCTAAGTACAGATGAGGG + Intergenic
919601011 1:199622146-199622168 CATGATCTTACTACAGATCATGG - Intergenic
922021231 1:221706706-221706728 TGTGCTCTTTCTACAAATGAGGG + Intronic
1065021452 10:21505038-21505060 TCTGATCCTACCACACATGAAGG - Intergenic
1067080635 10:43210502-43210524 TGTGCACATACTACAGCTGAGGG - Intronic
1068538039 10:58262372-58262394 AGGGTTCTTACTACAGAAGAAGG + Intronic
1069887886 10:71635323-71635345 TATTATCTGTCTACAGATGAAGG - Intronic
1071313821 10:84371755-84371777 TGTGATCTGGTTATAGATGAAGG - Exonic
1074300307 10:112227270-112227292 TGTGATCTTTCCACAAAGGAGGG + Intergenic
1074302685 10:112247285-112247307 TATCATCATTCTACAGATGAGGG + Intergenic
1074339586 10:112614356-112614378 TGAGACCTTACTACACTTGAGGG + Intronic
1077512575 11:2976720-2976742 TGTGAGCTCACTACACATGTAGG - Intronic
1081747586 11:45483792-45483814 TGTGCTCATTATACAGATGAGGG - Intergenic
1084143790 11:67252360-67252382 TGCCATTTTAATACAGATGAAGG + Intronic
1087933878 11:104008422-104008444 TGTATTCTTATTTCAGATGATGG - Intronic
1088142039 11:106629105-106629127 TCTGATCACAGTACAGATGATGG + Intergenic
1094437792 12:30440651-30440673 TTTGATCTGACTAGAGAGGAGGG + Intergenic
1095172876 12:39056044-39056066 TGAGATCACACAACAGATGAGGG + Intergenic
1097919823 12:65059823-65059845 TGTGTTTTTAGTAGAGATGAGGG + Intronic
1101033081 12:100678908-100678930 TCTGATGTTTCTAAAGATGAGGG - Intergenic
1102128565 12:110506056-110506078 TGTGTTTTTAATAGAGATGAGGG + Intronic
1105357231 13:19669680-19669702 TGTGTTCTTAGTAGAGATGGGGG + Intronic
1110701767 13:78556673-78556695 TGTGTTCCTACTGCAGGTGAGGG - Intergenic
1114776321 14:25486371-25486393 AGTGATCTTAATACAGAACAGGG + Intergenic
1118181056 14:63493686-63493708 TCTGATATTACTAAACATGAAGG + Intronic
1118791171 14:69094344-69094366 TGTGATCAGACTGCAGATGGTGG - Intronic
1118882157 14:69838494-69838516 TGAGATCTTACAACAGAAAAAGG - Intergenic
1119284313 14:73439669-73439691 TGTGATCTTCCTTCAGAAAAAGG + Intronic
1123716001 15:23032219-23032241 TGTTCTCTTTCTACAGCTGAAGG + Intronic
1123879884 15:24667692-24667714 TGTGATTATATTACAGGTGAAGG - Intergenic
1124458081 15:29863120-29863142 TGTGTTTTTAGTACAGATGGGGG - Intronic
1125082595 15:35692998-35693020 TGTGACCTTACTACAGAGTAAGG - Intergenic
1126473764 15:49045846-49045868 TGTGTGGTAACTACAGATGAAGG - Intronic
1134320716 16:13160209-13160231 TGTGTTCTGGGTACAGATGAAGG + Intronic
1135580448 16:23621312-23621334 TATCCTCATACTACAGATGAGGG + Intronic
1135827785 16:25745193-25745215 TGTTCTATTACTAAAGATGAAGG + Intronic
1138074351 16:54026160-54026182 TGTGAACTTCTTTCAGATGAAGG - Intronic
1139611189 16:68060130-68060152 TTTGATCTTATTTCAAATGAAGG + Intronic
1141750373 16:85954426-85954448 TGTGTCCTTACTACAGAGGCGGG - Intergenic
1145282210 17:21476491-21476513 TGTCAGCTCACTTCAGATGATGG + Intergenic
1147270243 17:39264353-39264375 TGTGAGCTGATCACAGATGATGG - Exonic
1152090439 17:78243780-78243802 TGTGCTTTTAGTACAGATGGGGG + Intergenic
1155017359 18:21858015-21858037 TGTTTGCATACTACAGATGATGG + Intronic
1155102246 18:22623049-22623071 TGTAATCTTTTTACTGATGAAGG - Intergenic
1156970301 18:43146230-43146252 TCTGATCTTGCTCCAGATTAAGG - Intergenic
1160095562 18:75869221-75869243 TGAGATCTTAATAGACATGATGG - Intergenic
1160667271 19:337014-337036 TGTATTTTTACTAGAGATGAGGG + Intronic
1163489302 19:17607434-17607456 TGTGTTTTTAGTACAGATGGGGG + Intronic
1165007479 19:32818620-32818642 TGTGCTCTTGCCACAGATGCAGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927162146 2:20275427-20275449 TGTAACCTTACAACTGATGAGGG + Intronic
928498350 2:31859372-31859394 TGTGATTTTATTAAAGATTAAGG - Intergenic
928860741 2:35854621-35854643 TGTCATCTTACTAAGGATGAAGG - Intergenic
929085070 2:38159955-38159977 GGTGGTCTTGCTACTGATGAGGG + Intergenic
930211353 2:48641535-48641557 TGTGTTTTTATTAAAGATGAGGG + Intronic
930749324 2:54917726-54917748 TGTGATCTTACTACAGATGACGG - Intronic
932578706 2:72978836-72978858 GGTGATTATAATACAGATGAAGG + Intronic
937584596 2:123531271-123531293 TGTGTTCTCACTAGAGCTGATGG - Intergenic
942324301 2:174762433-174762455 TGTAATCTTTATTCAGATGATGG + Intronic
946215944 2:218183753-218183775 GGAGATTTTACTACAAATGAAGG + Intergenic
946819625 2:223616562-223616584 CGTAATCTTAATACCGATGAGGG - Intergenic
948325044 2:237109938-237109960 GGTCTTCTTACTATAGATGAAGG - Intergenic
1171047020 20:21818591-21818613 TGTGATTTTACTACAGAAGTAGG + Intergenic
1175281920 20:57809573-57809595 TCTGATCTTTTTACAGATGAGGG + Intergenic
1175850744 20:62091030-62091052 TGTGTTTTTAGTACAGATGAGGG + Intergenic
1176341398 21:5699844-5699866 AGTGATATTACTCCAGTTGAAGG - Intergenic
1176473652 21:7131997-7132019 AGTGATATTACTCCAGTTGAAGG - Intergenic
1176503429 21:7624612-7624634 AGTGATATTACTCCAGTTGAAGG + Intergenic
1178685281 21:34705674-34705696 GGTGACCTTACTGCATATGAAGG - Intronic
1178993422 21:37375035-37375057 TTTGTTCTTTCTACAGAAGAGGG + Intronic
1182946827 22:34331987-34332009 TGTAGTTTTACTACAGATGGGGG + Intergenic
1184530678 22:45053506-45053528 TATGTTCTTACTCCAGATCAGGG + Intergenic
1203240664 22_KI270733v1_random:14311-14333 AGTGATATTACTCCAGTTGAAGG - Intergenic
949155695 3:825156-825178 TGAGATCTTACTAGAGCTGATGG + Intergenic
949533126 3:4977096-4977118 TGTGATTTTAATAAGGATGAAGG - Intergenic
951439108 3:22702403-22702425 TGTGGTCCAACTACAGATGCAGG + Intergenic
952446257 3:33384001-33384023 TGTGAACTCATCACAGATGATGG + Exonic
956979502 3:74619109-74619131 TATCACCTTTCTACAGATGAAGG + Intergenic
959306092 3:104667944-104667966 TGTCCTCTTCCTTCAGATGAGGG + Intergenic
959364418 3:105438962-105438984 TGTTATAATACTACAGACGAAGG + Intronic
963747175 3:149136007-149136029 TGTGATCTTGCTACATAAAAGGG + Intronic
966179658 3:177176638-177176660 TGTGTTTTTAATAGAGATGAGGG - Intronic
967627063 3:191699465-191699487 AGTGTTCTTACTACAAAAGAAGG + Intergenic
968290228 3:197533319-197533341 TGTGAGCTCATTACTGATGAGGG + Intronic
969647624 4:8441598-8441620 TGTGTCCTTAGTACAGAAGATGG + Intronic
972738649 4:41869147-41869169 TGTGGTATTATTGCAGATGAAGG - Intergenic
972889540 4:43539616-43539638 TTTTATCTTACTTTAGATGATGG + Intergenic
973669297 4:53199254-53199276 TGCTTTCTGACTACAGATGATGG - Intronic
974919993 4:68226988-68227010 TGTCAACTTATCACAGATGATGG + Exonic
979777420 4:124608191-124608213 TGATATTTAACTACAGATGAGGG + Intergenic
980823310 4:138043828-138043850 TTTGATCTTATTACATATGAAGG - Intergenic
982896387 4:160932895-160932917 TGTATTTTTACTAGAGATGAAGG + Intergenic
986648248 5:9939387-9939409 TGGGATTTTACTTCAGATGTAGG + Intergenic
987550930 5:19380513-19380535 TGTTAGCTTGCTACAGATAATGG - Intergenic
990618056 5:57528133-57528155 TGTGATCTTTCTTCAAATGATGG + Intergenic
990658901 5:57990263-57990285 TGTGATCTAACTAATGATGCAGG + Intergenic
990762717 5:59148237-59148259 TGTGACCTTATTTCAGTTGAGGG + Intronic
991920254 5:71649595-71649617 TTTGAACTTCCCACAGATGAAGG - Intronic
993824780 5:92669457-92669479 TGGTAGCTGACTACAGATGAGGG + Intergenic
994572652 5:101534267-101534289 TGTGATTTTGATACAGATGTCGG + Intergenic
997094315 5:130893718-130893740 TGTCATCTTACTTCATATCATGG - Intergenic
998619655 5:143780207-143780229 TTAGATCTTACTCCAGATAAAGG + Intergenic
998928482 5:147154615-147154637 TGTGATTATACTAAATATGAGGG + Intergenic
999614889 5:153412776-153412798 TGTGGTCTTACTTCAAATGCAGG - Intergenic
1003074901 6:2974758-2974780 TGTATTCTTAGTAGAGATGAGGG + Intergenic
1005499168 6:26414857-26414879 TGTACTTTTAGTACAGATGAGGG + Exonic
1006285488 6:33090783-33090805 CCTGATCTTATTGCAGATGAGGG + Intergenic
1012341212 6:98126501-98126523 TTTAATCTTACTACACATGAGGG + Intergenic
1013624582 6:111924683-111924705 TGTGATCTACTTACAGCTGATGG - Intergenic
1014553122 6:122812045-122812067 TGTGTTTTTAGTAGAGATGAGGG - Intergenic
1015911187 6:138169072-138169094 TGTCTTCTTTCTAAAGATGAGGG + Intronic
1019187130 6:170227316-170227338 TGTGATCTCAATCCTGATGAAGG + Intergenic
1019749347 7:2719027-2719049 TTTGATCTCACTTCAGATGGGGG - Intronic
1021442790 7:20697683-20697705 TCTGATGTTATTACAGAGGAAGG - Intronic
1024831668 7:53466613-53466635 TGTGACCTCACTACAGGAGACGG + Intergenic
1027454554 7:78373238-78373260 TGGGATATTACCACAGATGAAGG + Intronic
1029185304 7:98734128-98734150 TGGGACCTTACCACAGAGGAGGG - Intergenic
1029843133 7:103386933-103386955 TGTAATTTTAGTAGAGATGAGGG + Intronic
1032757001 7:134900615-134900637 TGGGATCTAAATACAGATGTGGG - Intronic
1033526806 7:142224050-142224072 TTTGATGGTACTCCAGATGAGGG + Intergenic
1035893596 8:3372637-3372659 TGTGAAATAACTACAGGTGAAGG + Intronic
1036541506 8:9717193-9717215 TGTGAACTCACTACAGAGTACGG - Intronic
1036606712 8:10312323-10312345 TGGGATATCACTACAGATGTGGG + Intronic
1036723130 8:11196611-11196633 TGTGTTCTTAATAAATATGATGG - Intronic
1038120671 8:24611091-24611113 TGTATTTTTAGTACAGATGAGGG - Intergenic
1038424806 8:27458278-27458300 TGTGATCTTCCTACAGATCGAGG + Exonic
1041682672 8:60609013-60609035 TGGGATCTTTCTAAAAATGAAGG + Intronic
1045973007 8:108101041-108101063 TGAGATCTCACTAGAGCTGATGG - Intergenic
1046343218 8:112886528-112886550 TGTGCTATCCCTACAGATGATGG + Intronic
1052584411 9:30407968-30407990 TTTGATCATTCTACTGATGATGG + Intergenic
1052807966 9:33029688-33029710 TGTGATGTAATCACAGATGAGGG - Intronic
1053150842 9:35741696-35741718 TGTGATCTGACGGCAGGTGAGGG + Exonic
1055322055 9:75091795-75091817 AGTGACCTTACTACACATGCAGG - Intronic
1056344771 9:85680846-85680868 TGTGATTTTACTACACATATTGG - Intronic
1058237882 9:102515894-102515916 TGTGATCTGGTTATAGATGAAGG - Intergenic
1060409318 9:123389655-123389677 TGTGATCTTGCTGCAGTTGGTGG + Intronic
1060456951 9:123807565-123807587 TGTGCTCTTGCCACAGATAAAGG + Intronic
1187492232 X:19762758-19762780 TGTCACCATACCACAGATGAAGG + Intronic
1187944410 X:24412346-24412368 TGTGACCTAAATACAGATGGAGG + Intergenic
1187971518 X:24663742-24663764 TGTGTTTTTAGTACAGATGGGGG - Intronic
1197786485 X:130202511-130202533 TGTGATCTTAATAGTCATGAAGG - Intergenic
1198530005 X:137543238-137543260 TGTGATCTTGCCAGAGATGTTGG + Intergenic
1201973368 Y:19819326-19819348 TCTGAGCCTACTAGAGATGAAGG + Intergenic