ID: 930751984

View in Genome Browser
Species Human (GRCh38)
Location 2:54943242-54943264
Sequence CTCTGAGAAGAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 872
Summary {0: 1, 1: 0, 2: 8, 3: 84, 4: 779}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930751984_930751991 20 Left 930751984 2:54943242-54943264 CCTTCTTCCCTCTCTTCTCAGAG 0: 1
1: 0
2: 8
3: 84
4: 779
Right 930751991 2:54943285-54943307 TTCAAGACAGTTCCCTCACCTGG 0: 1
1: 0
2: 2
3: 15
4: 188
930751984_930751992 27 Left 930751984 2:54943242-54943264 CCTTCTTCCCTCTCTTCTCAGAG 0: 1
1: 0
2: 8
3: 84
4: 779
Right 930751992 2:54943292-54943314 CAGTTCCCTCACCTGGTGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930751984 Original CRISPR CTCTGAGAAGAGAGGGAAGA AGG (reversed) Intronic
900269786 1:1781149-1781171 GGCTGAGGAGAGAGGGAAGTTGG + Intergenic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901286228 1:8081052-8081074 CTCTGAGAAGAAAGGGCTGATGG + Intergenic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
901811882 1:11772061-11772083 CACTAAGGAGAGAGGGAGGAGGG - Exonic
901894943 1:12303695-12303717 ATCTGGGAAGAGAGGAAGGATGG - Intronic
901948537 1:12723113-12723135 CTCTGAGAAGCTGAGGAAGAAGG - Intronic
902777675 1:18685004-18685026 CTCTGGCAAAAGAGGGAGGAGGG + Intronic
903031187 1:20465468-20465490 CTCGGAGCAGAGGGAGAAGATGG - Intergenic
903143149 1:21352157-21352179 CTCAGAGAGGACAGGGAGGAAGG - Intergenic
903575066 1:24334624-24334646 CCCTGAGAAGAGAGAAAGGAAGG - Exonic
904210901 1:28886538-28886560 CACTGAGAAGAGTGGCAAGGCGG + Intergenic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904506919 1:30964697-30964719 CCATGTGAAGAGAGGGAAGGAGG + Exonic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904808295 1:33146880-33146902 CCCTGAGAAGATGGGGATGAGGG + Exonic
905208339 1:36355929-36355951 TTCTGAGAAAAGAGGAAAGCAGG - Intronic
905525856 1:38639009-38639031 ATGGGAGAAGAGAGGTAAGAGGG - Intergenic
905544152 1:38784412-38784434 CTGTGACAAGACTGGGAAGAGGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906285768 1:44586841-44586863 TTCTGAAAATTGAGGGAAGATGG + Intronic
906796849 1:48703210-48703232 TTCTAAGAAGAGAAGGAAGGAGG + Intronic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
907963918 1:59310709-59310731 CACTGAGGAGAGAAGGACGATGG - Intronic
908150227 1:61293164-61293186 CTCAGAGAAGAGAGGGAGGGAGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908505836 1:64799085-64799107 GTCTGGGAAGAGAAGGGAGAAGG - Intronic
908549575 1:65195157-65195179 CTCACACAAGAGAGGGAATAAGG + Intronic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
909344755 1:74572173-74572195 CTCTGAGGAAAGAAGGAGGAGGG - Exonic
909877008 1:80819125-80819147 CATTGAGGAGAGAGGGAGGAAGG - Intergenic
909948682 1:81693126-81693148 CTCTTGGAGGAGAGGAAAGAAGG - Intronic
910069365 1:83193184-83193206 CTCTTAGAAGGGAGGCAACATGG - Intergenic
910616964 1:89209057-89209079 GTCTAAGAAGACAGGGAGGATGG + Intergenic
911063125 1:93764666-93764688 CACTGAGGAGAGAGGCAGGAGGG - Intronic
911098250 1:94073329-94073351 CTCTGAGCAGAGGGGTATGATGG - Intronic
911614853 1:99998499-99998521 CTCTAAGAAAAGTGGGAAGGTGG - Intronic
911814713 1:102332037-102332059 ATTTCAGAAAAGAGGGAAGAAGG + Intergenic
912379914 1:109241756-109241778 CTCTGAGACAAGATGGAAGGAGG - Intergenic
912469022 1:109893981-109894003 GGCTGAGGAGAGATGGAAGACGG - Intergenic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913223133 1:116675415-116675437 ATCTGAGAGAAGAGGGAAGAAGG + Intergenic
914901784 1:151715044-151715066 ATGGGAGAAGAGAGGGATGATGG - Intronic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915305501 1:154975012-154975034 CTCTCAGTAGAGAGGAGAGAGGG + Intronic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915969433 1:160343378-160343400 CGCTCAGCAGAGAGGCAAGATGG + Exonic
916349914 1:163837326-163837348 CTCTGAGAGGAGAGAGAAAGAGG - Intergenic
916444617 1:164860845-164860867 CTCAGACAAGAGAGGGAGGAAGG + Intronic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
917134964 1:171781036-171781058 CTTTGCGGAGAGAAGGAAGAGGG + Intergenic
917574303 1:176304802-176304824 AACTCAGAAGAGAGGGAAAATGG + Intergenic
918094357 1:181322277-181322299 ATCTGAGCAGTGGGGGAAGAGGG + Intergenic
918179434 1:182073447-182073469 ATCAGAGAAGAGAGGGAAAAAGG - Intergenic
918630428 1:186710661-186710683 ACCTGAGAAGAGAGGGAGTAGGG + Intergenic
919118968 1:193315306-193315328 GTCAGGGAAGAGAAGGAAGAAGG - Intergenic
919674864 1:200371279-200371301 CTCTGGGAAGTGAGGACAGAAGG + Intergenic
919969621 1:202566094-202566116 CGCTGAGAAGAGTGGGGAGCAGG - Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920952978 1:210590272-210590294 TCATGAAAAGAGAGGGAAGAAGG - Intronic
921762049 1:218926280-218926302 CACTGAATAGAGAGGGAAGGGGG - Intergenic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
922008503 1:221556427-221556449 CACTGAAAAGAGAGAGAAGATGG + Intergenic
922580672 1:226695600-226695622 GTGTGAGAAGAGAGAGAGGATGG - Intronic
922604241 1:226879354-226879376 CTCTGAGTGAAGAGGGAGGAGGG + Intronic
922789459 1:228303159-228303181 CTCTGAGAAGAGATCCAGGATGG + Intronic
923023246 1:230183410-230183432 TGCTGAGAAGAGAGAGAAAATGG - Intronic
923042982 1:230333040-230333062 CCCTGAGGGGAGAGGGAGGAAGG + Exonic
924064298 1:240207707-240207729 CTCCGGGAAGAGGGGGAGGAAGG - Exonic
924064350 1:240207839-240207861 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924064404 1:240207971-240207993 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924064498 1:240208202-240208224 CTCCGGGAAGAGGGGGAGGAGGG - Exonic
924319903 1:242838636-242838658 CTCTCAGCAGAGAGGGGAGTTGG - Intergenic
924584859 1:245353386-245353408 CTCTGAGAAGCCAGTAAAGATGG + Intronic
924591684 1:245410131-245410153 CTCGGAGAAGAGGGAGGAGATGG - Intronic
1063189166 10:3678103-3678125 ATTTGAGAAGAGACGGAAAAGGG - Intergenic
1063600989 10:7481263-7481285 CTCTTAGAAAAGAGGAAATAGGG + Intergenic
1063954594 10:11254825-11254847 CTCGGAGACGAGAGGGAAGGAGG + Intronic
1064003872 10:11684892-11684914 CTCTCAGAGGAGAGCGAAGAAGG + Intergenic
1064050674 10:12056834-12056856 CTCAGAGAAGAGAGAAAGGAGGG - Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064694941 10:17955637-17955659 GTCTGAAAAAAGAGGGAAGTAGG + Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1066016355 10:31248116-31248138 ATCTGAGAATGGAGGGAGGAAGG - Intergenic
1066488657 10:35873029-35873051 CTCAGAAAAGGGAGAGAAGACGG + Intergenic
1068657052 10:59586747-59586769 CTCAGAGAAGCCAAGGAAGAAGG - Intergenic
1069142176 10:64840180-64840202 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069639258 10:69944267-69944289 CCAGGAGAAGAGATGGAAGAAGG - Intronic
1070550786 10:77489024-77489046 CTCTGCCTAGAGGGGGAAGATGG - Intronic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071487860 10:86114653-86114675 TTCTCAGAAGACAGGGGAGAGGG - Intronic
1071730169 10:88240084-88240106 CTTTGAAAACAGAGCGAAGAAGG - Intergenic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073189819 10:101643353-101643375 CCCTGGGAAGAGAGAGAACATGG + Intronic
1073253268 10:102134653-102134675 CTCTGAGAAAGTAGGGGAGAAGG - Intronic
1073310342 10:102535625-102535647 GTATCAGAAGAAAGGGAAGAGGG - Intronic
1073427546 10:103464925-103464947 CTCAGAGAAGAATGGGAAGATGG - Intergenic
1073639968 10:105241659-105241681 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1074897607 10:117790899-117790921 CTCTCAGAAGAGCTGGGAGAGGG + Intergenic
1075081064 10:119384222-119384244 CTCTGAGAACAGGGGACAGAAGG - Intronic
1075353959 10:121753833-121753855 CTCAAAGATGAGAGGGAAGTTGG + Intronic
1075355240 10:121766445-121766467 CTCTGAAAAGTGAGAGAAGACGG + Intronic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1076586936 10:131555738-131555760 CCCTGAGGAGAGAGACAAGATGG + Intergenic
1076685011 10:132194602-132194624 CTCTGAGCACAGAAGGGAGAGGG - Intronic
1076685863 10:132198255-132198277 CACTCAGAATAGAGGGCAGAGGG - Intronic
1076725182 10:132409766-132409788 TGCTGAGAAGGAAGGGAAGAGGG + Intronic
1077029008 11:455257-455279 CTCTAAGAAAAGAGGGGTGAAGG - Intronic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077779601 11:5312026-5312048 CTTTGAGAAGAGGCTGAAGAGGG - Intronic
1078741073 11:14066822-14066844 GACTGAGAAGAGGGAGAAGAGGG - Intronic
1079253110 11:18802129-18802151 CACTGAAAAGAGGGGAAAGAGGG - Intergenic
1079290040 11:19179723-19179745 CTCTGAAAGGAGAGAGGAGACGG + Intergenic
1079554925 11:21747776-21747798 ATCTTAGGAGAGAAGGAAGAAGG - Intergenic
1079617213 11:22510511-22510533 TGCTGAGCGGAGAGGGAAGAGGG - Intergenic
1081038176 11:38176698-38176720 CTCTCAGTGGAGAGGGGAGATGG - Intergenic
1081406413 11:42703861-42703883 TTTGGAGAAGAAAGGGAAGATGG + Intergenic
1081644963 11:44783909-44783931 CCCTGAGACGAGAGGGGTGAGGG - Intronic
1082037187 11:47654472-47654494 CTCTAAGAACAAAGGAAAGAGGG + Intergenic
1082131056 11:48489803-48489825 TTCTTTGAAGAAAGGGAAGATGG - Intergenic
1082275389 11:50215687-50215709 CTTTGAGAAGAGAGGGGAAAAGG + Intergenic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084841285 11:71851703-71851725 CTCTGAGAAGAATGGAAACAGGG + Intergenic
1085034319 11:73291050-73291072 CCCTGAGAAGAGGGTGAGGAAGG + Intronic
1085729495 11:78984086-78984108 CTCTGAAAAATGAGGGAAGCAGG + Intronic
1087240743 11:95774738-95774760 CTCTCAGAACAGAGGGCTGATGG + Intronic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1087788658 11:102384340-102384362 TCCTGAGATGAGAAGGAAGAGGG + Intergenic
1088338809 11:108739835-108739857 ATCTGATAAGAAAGGGATGACGG - Intronic
1088525161 11:110745211-110745233 GGCTGAGAAGAGAGGGAAATGGG - Intergenic
1088544726 11:110947806-110947828 CTCTAAGAAGAGAGTGGGGAAGG + Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088772114 11:113045284-113045306 TCCTGAGAAGAGAGAGAGGATGG + Intronic
1088838525 11:113602245-113602267 CTCTAAGAACAGAGTGAAGGTGG + Intergenic
1088888749 11:114028398-114028420 TTCTGAGAAGAGTGGGGAGTTGG - Intergenic
1089058455 11:115606925-115606947 CACTGAGGAGAGAGGAAATAGGG + Intergenic
1089113925 11:116078761-116078783 ATCTCAGAAAAGAGGGAAGAGGG + Intergenic
1089740232 11:120577351-120577373 CTATGGGAAGAGTGGGATGATGG + Intronic
1090746653 11:129710774-129710796 TCCTGAGTAGAGAAGGAAGAGGG + Intergenic
1091094919 11:132811286-132811308 TGCTGAGAAGAGAAGTAAGAGGG - Intronic
1091097491 11:132837860-132837882 CCCTGAGCAGTGAGGGAGGAGGG - Intronic
1091303897 11:134524391-134524413 CTCTGAGAAGATGGGGAACAAGG - Intergenic
1091369986 11:135049694-135049716 CTCTAAGAAAAGTGTGAAGAGGG + Intergenic
1091437715 12:485861-485883 CTCAGAGAAGGGAGGTGAGAAGG + Intronic
1091519609 12:1224116-1224138 CTCTGGGAAGAGATATAAGAGGG - Intronic
1092019207 12:5186467-5186489 CACATAGAGGAGAGGGAAGAAGG - Intergenic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092462698 12:8699825-8699847 TTCTGAGAACAGAGCCAAGAAGG + Exonic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093276187 12:17130784-17130806 TTCTAAGAAGGGATGGAAGAAGG + Intergenic
1093446470 12:19265743-19265765 CTCTTAGATGAGAAAGAAGAGGG + Exonic
1093930641 12:24951999-24952021 CTTTCAGCAGAGAGGGAAGCGGG + Intergenic
1094133507 12:27099961-27099983 CTTTAAGAAGAGAGGGAATGAGG - Intergenic
1094433564 12:30397154-30397176 CTCTGAGATGAGAAAGGAGAAGG + Intergenic
1094526115 12:31232388-31232410 CTCGGAGGAGGGAGGCAAGAGGG - Intergenic
1095617130 12:44204132-44204154 GTCTGAGAAGAGAGAGAATTTGG - Intronic
1097746601 12:63310482-63310504 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1098682160 12:73369880-73369902 CTCCAAAAAGAGAGAGAAGAAGG + Intergenic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1099484747 12:83215140-83215162 CTCTTAGAAGAGAGGTCATATGG - Intergenic
1100885598 12:99066481-99066503 CACAGAGAAGAGAGGGAACCAGG + Intronic
1100891432 12:99130582-99130604 GGATGAGTAGAGAGGGAAGAAGG - Intronic
1101549516 12:105748996-105749018 CTCTGAGACGAAAGGAAAGCGGG - Intergenic
1101766774 12:107708243-107708265 TTTTGAGATGAGAGGGAAGCAGG - Intronic
1101858608 12:108464488-108464510 CTCTGAGAAGAAAGGCAGGGAGG + Intergenic
1102409452 12:112704599-112704621 CTCTGGGAAGAAAGAGATGATGG - Intronic
1102599733 12:114020707-114020729 CTCTGGGAACAGAGACAAGAAGG + Intergenic
1102667459 12:114587608-114587630 CTTTGAGAACAGAGGAAATAGGG + Intergenic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103120411 12:118375643-118375665 CTCTGAGTAGAAAAGGAACACGG - Intergenic
1103385528 12:120529310-120529332 ATTTGAGAAGAGAGAGAGGAAGG - Intronic
1104088444 12:125494930-125494952 TTCAGGGAAGAGGGGGAAGAGGG - Intronic
1104093973 12:125539228-125539250 GGATGAGAAGTGAGGGAAGAGGG - Intronic
1104158199 12:126153452-126153474 ATCTGGGAAGAGAAGGAAAATGG + Intergenic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1105290134 13:19048285-19048307 GCCTGAGAAGAGAAGGAAGCAGG + Intergenic
1105434324 13:20363690-20363712 CTCCTAGGAGAGAGGGAAGCAGG - Intergenic
1105461964 13:20599963-20599985 GTCTTAGAAGAGGGGGAAGCTGG + Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105948804 13:25211809-25211831 CTCAGAGAAGAGCAGGAAGAGGG - Intergenic
1106346690 13:28886289-28886311 TGCTGAGAAGAGATGGAAGGGGG + Intronic
1107037053 13:35912602-35912624 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1107151884 13:37121189-37121211 TTCTGAGCAGAGAGGGAAAGAGG - Intergenic
1107772054 13:43797868-43797890 CTCTAAAAAGAGAGTGAAAATGG - Intergenic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1109136414 13:58656783-58656805 CTCTCAGCAGAGAGGGAAGCTGG + Intergenic
1110149310 13:72230259-72230281 CACTGTGAAGAGATGAAAGAGGG + Intergenic
1110173986 13:72534999-72535021 CTCTGACAGGAGACTGAAGAAGG + Intergenic
1111047183 13:82829280-82829302 CTCTCAGCAGAGTGGGAAGCTGG + Intergenic
1111213313 13:85108969-85108991 CTCTCAGCAGAGAGGGGATATGG + Intergenic
1111613784 13:90639395-90639417 TTCTGAGATGAAAGGGAAGGGGG - Intergenic
1111726250 13:92013276-92013298 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1111840348 13:93441922-93441944 CTCTGAGAAGAAAGAGTAGGAGG + Intronic
1112949742 13:104977981-104978003 GACTGGGAAGAGAGGGAAAAAGG - Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1114539255 14:23442781-23442803 CTCTGAGAAGCCAGGGCAGGGGG + Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1115507758 14:34109223-34109245 CTAGCAGAAGAGAGGGAAGGAGG + Intronic
1115514927 14:34175572-34175594 GTCAGAGAAGAGATGAAAGAGGG - Intronic
1116125980 14:40785414-40785436 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1116342924 14:43749572-43749594 GGCTGAGAAAAGTGGGAAGAAGG - Intergenic
1116756500 14:48955194-48955216 TTCTGAGATTAGAGGGAAAATGG + Intergenic
1116907751 14:50421755-50421777 CTCTGAGCAGAGTAGGTAGAAGG + Intronic
1116951623 14:50883409-50883431 CTCTGAGAAGGCAGTGATGAGGG - Intronic
1117006567 14:51426712-51426734 CTCTGAGAAGAGAACGAGAAGGG - Intergenic
1117066248 14:52015274-52015296 CTCTGAGCAGATGGGGAAGAGGG + Exonic
1117268433 14:54115326-54115348 CTTTGAGAAGAGAGTGGAGTGGG - Intergenic
1117474728 14:56082465-56082487 CTCTGAGATCAGAGGAAGGAGGG + Intergenic
1117783869 14:59262192-59262214 CTCTCAGAAGAGAGGAATTAGGG + Intronic
1117928575 14:60812818-60812840 CTCTTAGCAGAGAGGGGAGCTGG - Intronic
1118108056 14:62682985-62683007 CTATCTGAAGAGACGGAAGATGG + Intergenic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1118769839 14:68935352-68935374 CTCTGACAGGAGAAGGGAGAGGG - Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120174017 14:81274499-81274521 CTACCAGAAGAGAGGGAGGATGG - Intronic
1121069316 14:91002801-91002823 GGCTGAGAGAAGAGGGAAGAGGG - Intronic
1121222335 14:92295894-92295916 CTCTGAGAAGCGGTGGAAGAGGG + Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121675353 14:95747942-95747964 CTCTGAGAAGAGAGACACAATGG - Intergenic
1121722369 14:96118607-96118629 AGCTGGGAAGACAGGGAAGAAGG - Intergenic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1121871418 14:97411576-97411598 CTTTGAGAAGAGAGAGAAGGGGG - Intergenic
1121909691 14:97777528-97777550 CCCTGAGAAGAGACAGAAAAGGG + Intergenic
1122043418 14:99006895-99006917 CTTTGAGAAGAGAGGAGAGCAGG - Intergenic
1122177966 14:99934983-99935005 CCCTGGGAAGAGAGGCAGGAAGG + Intronic
1122180026 14:99948107-99948129 CTCTTTGAAGAGAAGAAAGAGGG + Intergenic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1122473491 14:101988564-101988586 TTCTGAGAAGAGAGATATGAAGG + Intronic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124782060 15:32645447-32645469 GTCTGAGTGGAGAGGGAAGTGGG + Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125447898 15:39777260-39777282 ATCAGAGCTGAGAGGGAAGAAGG - Intronic
1125909399 15:43422533-43422555 CTGAGAGAAGACAGGGAAGGAGG + Intronic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126379961 15:48036384-48036406 AGCTGACAGGAGAGGGAAGAAGG + Intergenic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1127440445 15:59001247-59001269 CTCTGAGAACAGAGGTATGAAGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127611821 15:60644691-60644713 CTTTGGGAAGAGAGAGAAGGAGG - Intronic
1127648364 15:60981400-60981422 CTCAGAGAAGAGAGAGAAAGGGG - Intronic
1127758085 15:62112449-62112471 GACTGAGAAGAAAGGGAAGAGGG + Intergenic
1127999891 15:64181128-64181150 CTCTCCGACAAGAGGGAAGATGG + Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128553609 15:68615048-68615070 CTCTGAGAGGAGAGAGGTGAGGG + Intronic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128699863 15:69796302-69796324 TTGTGAGAAGAGATGGAAGAAGG + Intergenic
1128947925 15:71842985-71843007 CTCAGAGCAGAGAGGGGAAAAGG - Intronic
1129793060 15:78354686-78354708 CGATGAGAAGAGACTGAAGAGGG - Intergenic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1130538369 15:84802917-84802939 ATCAGAGAAGACAGGGAGGAGGG - Exonic
1130770282 15:86917150-86917172 CTGGGAGAAGATAGAGAAGATGG + Intronic
1130850968 15:87793216-87793238 CTCTGAGATGAAGGGAAAGATGG + Intergenic
1130854153 15:87826195-87826217 CTCTGTGATGTGAGGCAAGATGG + Intergenic
1131067778 15:89444926-89444948 ATGTGAGAAGAGTGGGAAGTGGG - Intergenic
1131223987 15:90608537-90608559 CTCTGAGCTGAGAGGAAGGAAGG - Intronic
1131699564 15:94919456-94919478 ATCAGGCAAGAGAGGGAAGATGG - Intergenic
1131707136 15:95009490-95009512 TTCTGAGTATAGAGGTAAGAAGG - Intergenic
1132919299 16:2376631-2376653 CTCTCTGGAGAGAGGGATGAGGG - Intergenic
1132967816 16:2669052-2669074 CCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1133036229 16:3035818-3035840 TTCTGGGAAGAGAGGGGACAGGG - Intronic
1133361888 16:5180556-5180578 CTTTGAATAGAGTGGGAAGAAGG - Intergenic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1133941166 16:10310278-10310300 CTCTAAGAAGAGAGGTTTGATGG - Intergenic
1134365977 16:13579549-13579571 CTCTCAGAAGACAGGGGAGCTGG + Intergenic
1135296127 16:21280801-21280823 CTCAGAGAAGATAGGGAACATGG + Intronic
1135473395 16:22752120-22752142 CTCTGAGAAGAAGGAGAACATGG + Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135926821 16:26702080-26702102 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1135943086 16:26839856-26839878 CTCTGGGAAGTTAGGGCAGAGGG + Intergenic
1137004883 16:35266640-35266662 CTCTGAGAAGAGAGGGACGTAGG - Intergenic
1137488290 16:48909665-48909687 TTCTGGAAAGAGAGGGAAGGAGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137910551 16:52373585-52373607 CTCTGCCAAAAGAGGGAAGTGGG + Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138111924 16:54330726-54330748 GGCTGAGAAGAGAGGAAAGCAGG - Intergenic
1138152331 16:54670235-54670257 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1138226349 16:55298723-55298745 CTGTGAGAATAGAGGGCAAAGGG - Intergenic
1138270699 16:55693896-55693918 CTCTGAGACCAGAGGAAACATGG - Intronic
1138291877 16:55854866-55854888 GACTGAGAACAGAAGGAAGAAGG - Intronic
1138354173 16:56364546-56364568 CTCTGAAAACAGAGGTAAAAAGG + Intronic
1138416428 16:56874152-56874174 CTCTGAGCTGGGAGGGAATAGGG - Intronic
1138825682 16:60316488-60316510 CTCTGAGAAGGAAGGGAGGAAGG - Intergenic
1139429207 16:66902065-66902087 TGCTGAGAAGAGGGGGATGAGGG - Intergenic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140436548 16:74951542-74951564 CTCTGAAAAGAAAGGAAAGAAGG + Exonic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1141523162 16:84594825-84594847 CACTGAGAAGAGAGAGAGGCTGG - Intronic
1141581938 16:85005225-85005247 CTCTAGGAAGACAGGGAAGGAGG - Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142253125 16:89001922-89001944 CCCTTAGAAGAGAAGGAGGATGG - Intergenic
1142665560 17:1461396-1461418 TCCTGAGAGGAAAGGGAAGAAGG - Intronic
1142752586 17:1997874-1997896 CTCTGAGAAGGGAGGTGACAAGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142971934 17:3618025-3618047 CTCTGCCAGGAGAGGCAAGAGGG - Intronic
1143026131 17:3942968-3942990 CTTGGAGAAAAGAGGGGAGAAGG - Intronic
1143322882 17:6079509-6079531 CCCAGAGAAGAGAAGGCAGAAGG - Intronic
1144482579 17:15639883-15639905 TTCTCAGGAGAGTGGGAAGAGGG - Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1144795386 17:17887900-17887922 TTCAGAGAACAGAGGAAAGATGG + Intronic
1144916104 17:18725148-18725170 TTCTCAGGAGAGTGGGAAGAGGG + Intronic
1145032403 17:19514843-19514865 CACTGAGAAGAGAAAGGAGAAGG + Intronic
1145187347 17:20806386-20806408 CTCTGAGAGCAGAGTGGAGATGG + Intergenic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1146540237 17:33687333-33687355 CCCTTAGGAGAGAGGCAAGAAGG + Intronic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1147018665 17:37512931-37512953 ATTTGAGAAGAGAGTGGAGAGGG - Exonic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147246262 17:39123137-39123159 CTCAGAGAAGAGAGGAATGCTGG - Intronic
1147865199 17:43547221-43547243 CTCTCAGATAAGAGGGAAGATGG - Intronic
1147896226 17:43753172-43753194 CTCAGAGGAGAGAGGGATCATGG + Intergenic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148447647 17:47747877-47747899 CTCTGAGTAGAGAGCAAAAAAGG - Intergenic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148468289 17:47877892-47877914 GTCTTAGGAGGGAGGGAAGAGGG - Intergenic
1148552150 17:48556865-48556887 CTGGCAGAAGAGATGGAAGATGG + Intronic
1148748041 17:49929319-49929341 CTCAGAAAGGAGAGGGCAGAAGG + Intergenic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1150649026 17:66997915-66997937 CCCTGAGAAGGAAGGGAAGGAGG + Intronic
1151036192 17:70803295-70803317 CCTTCAGAAGAGAGAGAAGAGGG - Intergenic
1151042613 17:70881099-70881121 ATAAGAGAAGAGAGGGAGGAAGG + Intergenic
1151155946 17:72123104-72123126 CTCTGGGTAGAGAGGGGAGCGGG - Intronic
1151555164 17:74842993-74843015 CTCCGGGAAGAGCGGGAGGAAGG + Exonic
1151622105 17:75252460-75252482 GGATGAGGAGAGAGGGAAGAAGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153200644 18:2644206-2644228 CTCTGGCAAGAGTGGAAAGAAGG - Intergenic
1153299607 18:3581282-3581304 ATCAGAGAAGACAGGGAGGAGGG - Intronic
1153519947 18:5942113-5942135 AACTGAGAGGAGAGGGGAGAAGG + Intergenic
1153981652 18:10315503-10315525 CTCAGAGCAGAGATGGATGAAGG - Intergenic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1155034591 18:22015245-22015267 CACTTAGAAGAGAGGGAATGAGG - Intergenic
1155637786 18:27975849-27975871 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1155918692 18:31581066-31581088 GCCTGAGAAGTCAGGGAAGAGGG + Intergenic
1156365590 18:36423484-36423506 CTCTGAGAATAGAAAGAAGGTGG + Intronic
1156811094 18:41252475-41252497 CTTTGATAAGAGAAAGAAGAAGG + Intergenic
1156905604 18:42348661-42348683 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157171858 18:45414458-45414480 GACTGATGAGAGAGGGAAGAAGG - Intronic
1157242583 18:46024976-46024998 CTCTTAGAAAAGATGGAGGAGGG - Intronic
1157254443 18:46125867-46125889 CACTGAGGAGAAAGGAAAGAAGG - Intronic
1157298247 18:46461334-46461356 TTCTGAGGAGAGAAGAAAGAGGG + Exonic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158282499 18:55842802-55842824 CACTAAGCAGAGAAGGAAGAAGG - Intergenic
1158311701 18:56166426-56166448 CTATAGGAAGAGAGGGAAGGGGG + Intergenic
1158725254 18:59965532-59965554 GGATGAGAAGAGAGGGATGAAGG - Intergenic
1159309345 18:66687428-66687450 CTCAAAGAAGGGAGGGAAAAAGG - Intergenic
1159971298 18:74657853-74657875 GGCTGAGAAGACAGGGAGGAAGG - Intronic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1161576697 19:5058401-5058423 CTCTGAGGACTGAGGGAGGAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161913940 19:7214944-7214966 AGCTGGGAAGACAGGGAAGAAGG - Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162320153 19:9966765-9966787 GACGGAGAAGAGAGGGGAGATGG + Intronic
1162969140 19:14169734-14169756 CTCCGGGAAGAGTGGGGAGAAGG - Intronic
1163356250 19:16813203-16813225 AGCTGAGAAGAGTGAGAAGAGGG + Intronic
1163686652 19:18715658-18715680 CACTGAGAAGCAGGGGAAGAGGG - Intronic
1164577005 19:29411375-29411397 CTCTGAGGAGTGGGGGAGGAGGG - Intergenic
1164828650 19:31303233-31303255 CTCTGGGAAGAGACTGAAGATGG + Intronic
1165752394 19:38268194-38268216 CTCTGAGTAGTGAGGGCAGGTGG + Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166700263 19:44878202-44878224 TTCTGAGGAGAGAGAGAAGGAGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167175320 19:47860633-47860655 CCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1167623203 19:50569900-50569922 CTCCGAGGAGAAGGGGAAGAGGG - Intergenic
1168641996 19:58037012-58037034 CTCTGAAAAGAGAGGGAAAGTGG - Intronic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
925024896 2:599877-599899 CACCCAGAGGAGAGGGAAGAGGG + Intergenic
926961117 2:18359493-18359515 CTCAGAGAAGACAAGGGAGATGG - Intronic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927955812 2:27206648-27206670 ATTTGAGAGGAGAAGGAAGAGGG - Intronic
928129971 2:28642337-28642359 CACTGAGAGGAGAGTGGAGAGGG + Intronic
928216843 2:29368805-29368827 CCCTGAGAACAGATGGATGATGG - Intronic
928739086 2:34328524-34328546 GTTAGAGAAGAGAGGGAAAATGG - Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929560405 2:42952974-42952996 CTCTGAGAGGAGAAGGGAGGAGG - Intergenic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930619171 2:53626335-53626357 CTCTGAGAAGAAAAGGGTGAAGG - Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931312759 2:61097978-61098000 CTCTAAGAAGAGATGGAAAATGG - Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932335053 2:70925971-70925993 CTCTGAGTATCCAGGGAAGAAGG - Intronic
933027007 2:77272093-77272115 CACTGAGAAGAAAGGAGAGATGG - Intronic
933298225 2:80514595-80514617 CTCTCAGAAGAGAGGGGAGTGGG + Intronic
933657097 2:84897608-84897630 CACTGAGAAGAGTTGGGAGAAGG + Intronic
934076303 2:88431511-88431533 CTGGGAGAAGAGTGGGAAGGAGG - Intergenic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
936102089 2:109590956-109590978 CCCAGAGCAGAGAAGGAAGATGG + Intronic
936631954 2:114213179-114213201 CTCAGGGAAGAGAGATAAGAAGG - Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
936705949 2:115073959-115073981 CTCTGTAAAGAGTGAGAAGAAGG + Intronic
937009872 2:118552774-118552796 TTCTGAAAAGAAAAGGAAGAAGG - Intergenic
937040613 2:118817817-118817839 TTCTGAGAATAGAGTGAGGAAGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937384146 2:121411210-121411232 TTCTGATATGAGAGGGAAGCGGG + Intronic
937458774 2:122067567-122067589 CTTTGAGAAGCTAAGGAAGAAGG - Intergenic
937774168 2:125756060-125756082 GTGTGAGAAGAGGAGGAAGAGGG + Intergenic
938132562 2:128730351-128730373 TTCAGAGATGAGAGGCAAGAAGG + Intergenic
938213830 2:129491331-129491353 GTCAGAGAAGAGGGGAAAGAAGG + Intergenic
938472973 2:131582789-131582811 CTTTGAGAAGAAAAGCAAGATGG + Intergenic
939183682 2:138834389-138834411 TTTTGAAAAGAGAAGGAAGAAGG + Intergenic
939270668 2:139935349-139935371 GTCTGTGAGGAGAGGAAAGAGGG - Intergenic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942134010 2:172907337-172907359 GGCTCAGAATAGAGGGAAGAGGG - Intronic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
943507934 2:188785415-188785437 ATCTGAGAAGACCGAGAAGATGG - Intronic
943960259 2:194254713-194254735 CTCTCAGAAGAGAGGAAACCTGG - Intergenic
944535546 2:200705920-200705942 ATCTGAGAAGAAAGGGAGCAAGG - Intergenic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944682819 2:202092306-202092328 CTCTGAGATGTGCAGGAAGAGGG - Intronic
944845104 2:203660173-203660195 CTCTCAGAGGAGACGGGAGAAGG + Intergenic
946229439 2:218282446-218282468 CGCTGAGGAGAGAGGGAACCAGG + Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
946537803 2:220650359-220650381 CTCTGATGAGAAAGGGGAGAGGG - Intergenic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
946866854 2:224048700-224048722 CTCAGAGGTGAGAGGAAAGAAGG - Intergenic
946907423 2:224430134-224430156 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
946943726 2:224797727-224797749 TTCTCAGTAGGGAGGGAAGAAGG - Intronic
947178789 2:227393796-227393818 CTCCCAGAAGAGATGGAAAAGGG - Intergenic
947183986 2:227438572-227438594 CTCTGAGAAGTGGAGGAAAAAGG + Intergenic
947227295 2:227852772-227852794 GTCTCAGCAGAGAGGGAAGCTGG + Intergenic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947828533 2:233123039-233123061 CACTGAGAGGAGAGTGAAGGAGG + Intronic
948967130 2:241391556-241391578 CTCTCAGAAGTGGGGGAAGGTGG - Intronic
1169080496 20:2795470-2795492 CTCAGAGAAGGGAGGGTAGCGGG - Intronic
1169150579 20:3286379-3286401 CTCTCCGAAGTGATGGAAGATGG + Intronic
1169211718 20:3769400-3769422 CTATGAGAAGAGAGCGGGGAGGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169801831 20:9518512-9518534 ATATAAGAAGGGAGGGAAGAAGG - Intronic
1170555711 20:17513228-17513250 CTCTGAGAAGGGGAGGAAAAGGG - Intronic
1170807661 20:19647138-19647160 CTCTGAGAGGAGAGGGAGCTGGG - Intronic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171150563 20:22823381-22823403 CTCTGAGTAGAGAGAGAAAGGGG - Intergenic
1171908565 20:30921258-30921280 CTTTGGGAAGCGAGGGAAGGTGG - Intergenic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1173117484 20:40259596-40259618 CTCTCAAAAGAGAGAGATGAAGG + Intergenic
1173223909 20:41150658-41150680 GGATGAGAAGGGAGGGAAGATGG - Intronic
1173377053 20:42495317-42495339 CCTAGAGAAGAGAGGGTAGAGGG - Intronic
1173485688 20:43439366-43439388 CACAGAGAAGAGGGGGAAAAAGG - Intergenic
1173657725 20:44711894-44711916 CTCTGAGGCAAGAAGGAAGACGG - Intergenic
1173833100 20:46105318-46105340 CTCAGAGTAGAGAGGGAGTATGG + Intergenic
1174303756 20:49600692-49600714 CTCTGAGAGCAGAGGGGAGGGGG - Intergenic
1174719551 20:52797375-52797397 CTCTATGAAGAGTGGGAAGGAGG + Intergenic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1175299080 20:57930157-57930179 CTCAGAGATGAGAGAGAAGCGGG + Intergenic
1175488076 20:59359700-59359722 CTCTGAGATGAAAGCGGAGATGG + Intergenic
1175543344 20:59762055-59762077 GTCAGAGAGGAGAGGGAAGATGG + Intronic
1175813330 20:61870477-61870499 CCCTGACCAGTGAGGGAAGAAGG - Intronic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1177072463 21:16527735-16527757 TTTTGAGAAAATAGGGAAGAGGG - Intergenic
1177089058 21:16743398-16743420 CTATGAGAAAAGAGGGCAGATGG - Intergenic
1178179117 21:30139546-30139568 CTCTCAGTGGAGAGTGAAGATGG + Intergenic
1178427537 21:32491121-32491143 AACTGAGAAGACAGGGGAGAAGG + Intronic
1178466545 21:32853650-32853672 CTCTCAGTGGAGAGGGAACATGG + Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179709865 21:43207105-43207127 CGCTGAAAGGTGAGGGAAGAAGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180120965 21:45747819-45747841 CTCAGAGGAGGGAGGAAAGAAGG - Intronic
1180128736 21:45810707-45810729 CTTTCAGAAAACAGGGAAGAGGG - Intronic
1180180501 21:46116749-46116771 CCCTGAAGAGAGAAGGAAGAGGG - Exonic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181413075 22:22738646-22738668 CTATGATAAGAGAGGGCTGAAGG + Intronic
1181506459 22:23361582-23361604 GACTGAGAACAGAAGGAAGAAGG - Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1181884467 22:26009215-26009237 TTCTGAGACCAGAGGGAATATGG - Intronic
1182035610 22:27195921-27195943 CCCACAGAAGGGAGGGAAGAGGG - Intergenic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1183143884 22:35971511-35971533 AGCAGAGAAGAGAGGGAGGAAGG - Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183400256 22:37599483-37599505 CTAGGAGAAGAGAAGGAAAAGGG + Intergenic
1184064126 22:42106354-42106376 GAAGGAGAAGAGAGGGAAGAGGG + Intergenic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
1184359548 22:44006766-44006788 CTATGAGAGGAGAGGGCTGAAGG - Intronic
1184814985 22:46862445-46862467 CCCTGAGAACAGAAGCAAGAGGG - Intronic
949203986 3:1416090-1416112 TCCTGAGAAGAGTGGGAACATGG - Intergenic
949227405 3:1711163-1711185 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
949675434 3:6447909-6447931 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950724230 3:14906165-14906187 CTCTGAGAAGAGCAAGAACATGG - Intronic
951322785 3:21267185-21267207 CTCTGAGAAGGGATGGCTGAAGG + Intergenic
951689877 3:25384309-25384331 CTCTTAGGAGAGAGGGAGGGAGG - Intronic
951923158 3:27877741-27877763 CTATAAGAAGAGAGAGGAGATGG + Intergenic
952427532 3:33191023-33191045 CTCTATGAAGAGGGTGAAGAGGG - Intronic
952672232 3:35983767-35983789 CTTTGAGAATCTAGGGAAGAAGG - Intergenic
953496900 3:43395053-43395075 GACTGAGGTGAGAGGGAAGAGGG + Intronic
953690412 3:45112897-45112919 CTCTCAGAAGTGAGGAAAGCAGG - Intronic
953919308 3:46941010-46941032 CTCAGAGAAGAGGAGGAAGAAGG - Exonic
954007902 3:47607567-47607589 CTCTAAGAAGAGAAGGAATGTGG + Intronic
954368466 3:50158127-50158149 CTCTGAGAAGTGGGGGCAGGTGG - Intronic
954656115 3:52195267-52195289 CTCTGAGAAGGAAGGGAGGGAGG + Intergenic
954705054 3:52475529-52475551 CTCTGAGAAGCTAGAAAAGACGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
955252161 3:57294587-57294609 GAATGAGAAGGGAGGGAAGAAGG + Intronic
955468280 3:59258834-59258856 CACCGAGAAGAGAGGGACGTAGG - Intergenic
956089605 3:65651825-65651847 CTTTGAGATGAGTGGGGAGAAGG - Intronic
956427511 3:69152108-69152130 CTCAGGGAAGAGAGAGAATAGGG - Intergenic
956762810 3:72458798-72458820 ATCTGAGAAGGCTGGGAAGAGGG + Intergenic
956826169 3:72998078-72998100 TTTTGAGAAGAGGGGGAAAAAGG + Exonic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
959446130 3:106441946-106441968 GTCTGAGAAGAAAGGGGTGAGGG - Intergenic
959693533 3:109224719-109224741 CTCTCAGCAGAGAGGGGAGCCGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
961106318 3:124245138-124245160 CGCTGGGAAGAGAAGGGAGAAGG - Intronic
961106684 3:124248660-124248682 CTCTGAGAGAAAAGGAAAGAGGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961354658 3:126329182-126329204 ATATGATAAGAGAGGAAAGATGG - Intergenic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
961701523 3:128748428-128748450 CTTTGAGTAGACAGGGAAGGTGG + Intronic
962474359 3:135742373-135742395 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
962598961 3:136976207-136976229 CTCAGAGAAGGGAGTGAAGCTGG + Intronic
962850558 3:139305579-139305601 GTCTGAGGACAGAGGGGAGATGG + Intronic
962894408 3:139701012-139701034 CTTTCAGAAGAGAGAGAAGAGGG + Intergenic
963203887 3:142613132-142613154 GTCTGAGAAGAAAGAGAAGTAGG + Intronic
963248172 3:143082126-143082148 GTCTCACAGGAGAGGGAAGAAGG - Intergenic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964709851 3:159660141-159660163 CACTGAGAAGAAAGGAAAGCAGG + Intronic
964920542 3:161890759-161890781 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965039702 3:163490574-163490596 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965123643 3:164595671-164595693 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965890893 3:173512365-173512387 CTCTCAGTAGAGAGGGGAGCTGG + Intronic
965961748 3:174437555-174437577 CTCAGAGAGGGGAGAGAAGAAGG - Intergenic
967219888 3:187239650-187239672 CTCAGAGAAGAGAGGAATGGCGG - Intronic
967430050 3:189372092-189372114 CTCTGAAAAGAGAGAGACCAAGG - Intergenic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
968727895 4:2256708-2256730 CTCTGGGAGGAGAGGACAGAGGG + Intronic
969060281 4:4428610-4428632 CTTTGAGACTAGAGGGTAGAAGG - Intronic
969542925 4:7804946-7804968 CACTGCGAAGAGTGGGAAGGAGG - Intronic
969782382 4:9417744-9417766 CTCTGAGAAGAATGGAAACAGGG + Intergenic
971959824 4:33471348-33471370 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
972196982 4:36665490-36665512 CTCAGAGAAGAGAGGAAAAGGGG - Intergenic
973562175 4:52148354-52148376 AGGAGAGAAGAGAGGGAAGATGG + Intergenic
975591396 4:76003700-76003722 CTGTGAGAAGAAGGGGAAAAAGG + Intronic
975622844 4:76310974-76310996 GTATGAAAGGAGAGGGAAGAGGG - Exonic
976017028 4:80568772-80568794 TTTAGAGAAGAGGGGGAAGAAGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976768188 4:88620647-88620669 CTCTGTGGAGAGAGGGATTAAGG - Intronic
977064679 4:92299789-92299811 ATTTTAGAAGGGAGGGAAGAGGG + Intronic
977220475 4:94332210-94332232 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
977445985 4:97132807-97132829 CTCTAAGAAAACAGGGAAGTTGG - Intergenic
977582797 4:98743963-98743985 CTCTTATAAGAGAGGCTAGAGGG - Intergenic
977908430 4:102502154-102502176 CGCGGAGGAGAGAGGGAAGGTGG + Intronic
978669767 4:111232659-111232681 CTCTGAGAACCTGGGGAAGATGG - Intergenic
979047960 4:115893983-115894005 CTCTCAGGAGAGAATGAAGAGGG - Intergenic
979894635 4:126144889-126144911 CTATGAGATGAGATGGAACAGGG - Intergenic
980646125 4:135644329-135644351 CTCTGCTAAGACAGTGAAGAAGG + Intergenic
980709340 4:136543862-136543884 TTCTGAGAGAGGAGGGAAGACGG + Intergenic
980729136 4:136804668-136804690 CTTTCAGCAGAGAGGGGAGATGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981602024 4:146500722-146500744 CTCTGTGATGAAAGGGAAAAGGG - Intronic
981634557 4:146862026-146862048 AGCTGTGAAGAGAGGTAAGAAGG - Intronic
981643856 4:146975676-146975698 CTCTGAGACCAGATGGCAGATGG + Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
983697868 4:170554623-170554645 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984278707 4:177640882-177640904 CTCCTAGAAGACTGGGAAGAGGG - Intergenic
984586089 4:181566527-181566549 CTCTGAGAAGGGTGGGAAAGAGG - Intergenic
986060172 5:4181285-4181307 CTCAAAGAAGACAGTGAAGAAGG - Intergenic
986164749 5:5263963-5263985 CTCTCAGCAGAGAGGGTAGCTGG + Intronic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987486445 5:18532976-18532998 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
987876169 5:23684447-23684469 CTCTGACAAGGGAAGGAAAAGGG + Intergenic
987994744 5:25262262-25262284 CTCCAAGAAGAGAAGGAAAATGG - Intergenic
989433663 5:41385387-41385409 GTCTGAGGAGAGAGGGCAAATGG - Intronic
989998148 5:50860220-50860242 CTCTGAAGAGAGAAAGAAGATGG - Intergenic
990683863 5:58278009-58278031 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
990948729 5:61275889-61275911 CTCTGAGAACAAAGGGGAGAGGG - Intergenic
990998443 5:61757331-61757353 GTCTGGGAAGAGAGGGAAATGGG + Intergenic
991178911 5:63725743-63725765 GTGTGAGAAGAGAGTGAAGTGGG + Intergenic
991651703 5:68862297-68862319 CTCTGAGCAGAGAGGGGACCAGG - Intergenic
992168231 5:74076112-74076134 CTCTCAGAAGGGCAGGAAGAGGG - Intergenic
992445927 5:76833438-76833460 CTCAGAGAAGAAAAGGAAGAGGG + Exonic
992847829 5:80771565-80771587 CTCTGAGAAGTGAGGGAGGCAGG + Intronic
993016031 5:82535695-82535717 TTCTGAGATGAGAGGGAATGAGG + Intergenic
993155427 5:84215994-84216016 TTTTGAGAAGAGACTGAAGAGGG + Intronic
993880556 5:93355815-93355837 GTCTAAGAAGGGAAGGAAGAGGG + Intergenic
993887032 5:93426736-93426758 ATCTGAGAAGAGTGGGAAAAAGG + Intergenic
994017837 5:94989216-94989238 CTCTCAGAAGAAAGGCACGATGG - Intronic
994188316 5:96839667-96839689 CTCTGAGCAGGGAGTGAAGGAGG - Intronic
994434024 5:99706039-99706061 TTCTCAGCAGAGAGGGAAGCTGG - Intergenic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994852529 5:105074291-105074313 CTTTAAGAAGAGATGGGAGAGGG - Intergenic
995350610 5:111170870-111170892 ATCAGAGAAGAGAGCAAAGAAGG + Intergenic
995509348 5:112892734-112892756 CTCCGAGAGGAGGGAGAAGATGG + Exonic
995532271 5:113103353-113103375 CTCGGAGTTGAGAGGGAAGGAGG - Intronic
995583678 5:113624960-113624982 CTCGGAGAAGAGAGGCGAGAAGG + Intergenic
995658084 5:114449637-114449659 CTCTGAGACAAGAGGCAAGGAGG - Intronic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997747880 5:136315546-136315568 CCCCGAGAAGAGAGGTGAGATGG + Intronic
997786787 5:136720874-136720896 ATCTGGGAAGAGAGATAAGAAGG + Intergenic
997875721 5:137544981-137545003 TTCAGAGGAGAGAGGGAAAAAGG + Intronic
998425094 5:142019626-142019648 TTTTGAGATGAGAGAGAAGAAGG - Intergenic
998432542 5:142078595-142078617 GTCTGAGAAGAGAGGGTAGTGGG - Intergenic
998552807 5:143093794-143093816 CTCTGAGAAGAAAGGAAAGGGGG + Intronic
998636595 5:143961812-143961834 CTCTGAAAAAAAAGGAAAGAAGG + Intergenic
998881128 5:146646066-146646088 TTCTGTGAAGACAGGGAATATGG - Intronic
998882457 5:146657320-146657342 CTCGGAGAAGAGAGAAGAGATGG + Intronic
999856166 5:155596673-155596695 CTCCCAGAAGACAGGGAAGCAGG - Intergenic
999910432 5:156192064-156192086 CTCTGGGAAAAGAGGAAAAATGG - Intronic
999973869 5:156891714-156891736 CTCTGTGCAGAGAGGAAATATGG + Intergenic
1000185055 5:158851346-158851368 CGCTGTCAAGAAAGGGAAGAAGG + Intronic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1000603855 5:163306931-163306953 CTTTGAGAAGAGGGGTAACATGG + Intergenic
1000989683 5:167898983-167899005 TTCAGGGAAGAGAGGCAAGAGGG + Intronic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001412939 5:171523747-171523769 CTCGGAGAAGGGAAGGAAGGAGG - Intergenic
1001434426 5:171688271-171688293 CTCTGAGAAGAGTAGGAAGATGG + Intergenic
1001536715 5:172503234-172503256 CTGGGAGAAGAAAGAGAAGATGG - Intergenic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1002067845 5:176661137-176661159 CCCAGAGAAGACAGGGCAGAGGG - Intergenic
1002364364 5:178698530-178698552 GTCTGAGAAGACAGGGAAGGGGG + Intergenic
1002679649 5:180950683-180950705 CCCTGAGCTGGGAGGGAAGAAGG + Exonic
1002874452 6:1199354-1199376 TCATGAGAAGAGATGGAAGAGGG + Intergenic
1002999747 6:2319815-2319837 CTCTCAGAGGAGAGGGGAGCTGG + Intergenic
1004146957 6:13076867-13076889 CTCTGAGAGGTCAGGGCAGAGGG + Intronic
1004297111 6:14422877-14422899 GAATGAGAAAAGAGGGAAGAAGG - Intergenic
1005360650 6:25027925-25027947 CTCTGAGAAGAAAGGGGAGTGGG + Intronic
1006441990 6:34058743-34058765 GTCTGAGAAGAGAGGAGGGAAGG + Intronic
1006651847 6:35558055-35558077 CTCTGAGAAGGGACGGTAAAAGG + Intergenic
1007070720 6:39036244-39036266 CTCTGAGAGGTGGGGAAAGAGGG + Intergenic
1007306266 6:40907784-40907806 CTCTGAAAAGTGAGGGGAAAGGG + Intergenic
1007432368 6:41784110-41784132 CCCTGAGGAGACATGGAAGAAGG - Exonic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008043665 6:46829691-46829713 CTCTGAGAAGAGAAGAAAGTGGG - Intronic
1008585973 6:52949685-52949707 CTCTGAGAAGGGAGAGAGGAAGG + Intergenic
1008662333 6:53681207-53681229 CTCTTAGAAGAGATTTAAGATGG + Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1010294723 6:74182722-74182744 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1010732365 6:79404593-79404615 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1010977373 6:82331100-82331122 ATCTGAAAAGAGAAGAAAGAGGG - Intergenic
1011566955 6:88685517-88685539 TTCAGAGAGGAGAGGGGAGAAGG + Intronic
1011570109 6:88725754-88725776 CCCTGAGAAGAAAGGAAAGGGGG - Intronic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1012687094 6:102265688-102265710 GGCTGAGGACAGAGGGAAGATGG - Intergenic
1013758463 6:113488105-113488127 CTCAGAGGAGAGAGAGAAAAGGG - Intergenic
1013838541 6:114362021-114362043 CTCTGAGAAGGAAGGAAGGAGGG - Intergenic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014107407 6:117582673-117582695 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1014547107 6:122746851-122746873 CTCTGAAAGGAGAGGGAAAGGGG - Intergenic
1014998099 6:128177984-128178006 ATCTGAGTAGAAAGGAAAGAGGG + Intronic
1015631319 6:135234838-135234860 CTTTGAGGCGAGAGGGGAGAAGG - Intergenic
1015701013 6:136036233-136036255 CTCTTATCAGAGAGGGAAAAAGG + Intronic
1015830585 6:137364341-137364363 CTCTGAGAAGATTTGGAAAATGG - Intergenic
1016011664 6:139143463-139143485 CTATGATAAGAAAGAGAAGATGG - Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016082992 6:139878380-139878402 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1016191734 6:141276826-141276848 CTCACAGAGGGGAGGGAAGATGG - Intergenic
1016361310 6:143270215-143270237 CTCTGCTAAGTGTGGGAAGAGGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017101064 6:150850303-150850325 CTCGGAGAAGAGAGGTGAGAGGG - Intergenic
1017340612 6:153317342-153317364 CCCTGAGAAGAGAAGAAAGTAGG + Intergenic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018168232 6:161120796-161120818 CTCTGAGAAAACAGAGAAGAGGG - Intergenic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018227345 6:161641040-161641062 CTTGGAGATGAGAAGGAAGATGG - Intronic
1018604312 6:165580861-165580883 CGATGAGAAGAGAAAGAAGATGG + Intronic
1018641030 6:165904218-165904240 CTTTGAGAAGAGAGAGGGGACGG + Intronic
1018650137 6:165986271-165986293 CTCGGAGAGGAGAGTGAAGGTGG + Intronic
1018654772 6:166024757-166024779 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1018662819 6:166104222-166104244 AGCTGAGAAGCGAGTGAAGAAGG - Intergenic
1019178552 6:170173547-170173569 CTCAGAGAGGAGAGGACAGAGGG + Intergenic
1019805079 7:3117685-3117707 GGGGGAGAAGAGAGGGAAGAAGG + Intergenic
1020161869 7:5779520-5779542 CGCTGAGAAGGGAGAGAAGCGGG - Intronic
1020725633 7:11810284-11810306 CTCTGAGAGGTGAGAGATGAAGG - Intronic
1020918602 7:14232221-14232243 CTCTGAGAAGATAAGACAGATGG - Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1021906278 7:25336988-25337010 ATGGGAGAAGAAAGGGAAGAGGG + Intergenic
1022142864 7:27508379-27508401 CTCTTTGAAGAGAGGTAAGGGGG + Intergenic
1022732542 7:33043687-33043709 AACAGAGAAGAGAGGGAATATGG + Intronic
1023081463 7:36530513-36530535 CTCTGAAGAGAGAGGAAACAGGG + Exonic
1023431203 7:40093153-40093175 CTACTAGAAGAGAGGGAAAATGG + Exonic
1024119288 7:46220857-46220879 CCCTGAGGTGGGAGGGAAGAGGG + Intergenic
1024192719 7:47029158-47029180 CTATGAGAAGAAAGGGGAAAAGG + Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024485596 7:49914515-49914537 CTATGAGGAGAGAGGAATGAGGG - Exonic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026541957 7:71287450-71287472 CTATGAGACGAGAGGGAGGTGGG - Intronic
1026660544 7:72298324-72298346 CTTTGAGATGAGATGGAAGATGG - Intronic
1027132996 7:75604662-75604684 GTCTTAGAAAAGAAGGAAGAAGG + Intronic
1027191713 7:76000493-76000515 TCCAGAGAAGAGAGGGAAGCAGG - Intronic
1027287145 7:76658364-76658386 CTCTTAGAAGGGAGGCAACATGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028513770 7:91653848-91653870 CTCAGGGAGGAGAGAGAAGATGG - Intergenic
1028773804 7:94656545-94656567 CTCTGCGAAGACAGGAAGGATGG - Exonic
1029123849 7:98284477-98284499 CTCTGCGAGGAGAGTGGAGACGG + Intronic
1029328613 7:99832147-99832169 CTCTGAGAAAACAGGAAAGAAGG + Intronic
1029596848 7:101542577-101542599 CACTCAGAACAGAGGGCAGAGGG - Intronic
1029817820 7:103114552-103114574 CTCTGAGAGGGCAGGGAGGAAGG - Intronic
1030562116 7:111101691-111101713 CCCTGAGAAGACTGAGAAGAGGG + Intronic
1031188605 7:118516729-118516751 CTGTGAGAAAAGAGGGTACAAGG - Intergenic
1031437774 7:121753645-121753667 TGCTGAGAAGAGAAGGAATAGGG - Intergenic
1031449327 7:121895006-121895028 CTCTTAGAAGAGAAGACAGAAGG + Intronic
1032016027 7:128380948-128380970 CTCAGAGGAGACAGGGAGGAGGG - Intergenic
1032205727 7:129863528-129863550 CTCTGAGAACAGAGGAATTATGG + Intronic
1033273627 7:139955252-139955274 CTCTGAGCAGTGACGGCAGAGGG - Intronic
1033451195 7:141463673-141463695 ATCTGAGCAGAGCTGGAAGAAGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034213385 7:149384108-149384130 CCCTGGGAAGAGTGGGAAGTTGG - Intergenic
1034453032 7:151148028-151148050 CTTTGTAAAGAGAGGCAAGATGG + Intergenic
1035059002 7:156055374-156055396 CTCTGTGAAGTGAGGGTAGGAGG - Intergenic
1035961937 8:4147347-4147369 CACTGAGGACTGAGGGAAGAAGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036053433 8:5225606-5225628 CTCCGAGAAGTGAGGAAAGGAGG - Intergenic
1036617235 8:10397927-10397949 CATTAACAAGAGAGGGAAGAGGG - Intronic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1037234109 8:16696228-16696250 GAAAGAGAAGAGAGGGAAGAAGG - Intergenic
1037640607 8:20738762-20738784 CACTCAGAAGAGAGGTAACAAGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038213476 8:25540866-25540888 ATCTGTGAAAAGAGTGAAGAGGG - Intergenic
1038229998 8:25690945-25690967 CTCACAGAGGAGAGGGATGATGG - Intergenic
1038364769 8:26919876-26919898 TTCTGGCAAGAGAGGAAAGAAGG - Intergenic
1038520353 8:28226985-28227007 CTCTCAGCAGAGAGGGAATGTGG - Intergenic
1038547039 8:28433696-28433718 CCCTGAGATGAGAAAGAAGAAGG - Intronic
1038562950 8:28596424-28596446 CTCTCAGCAGAGAGGGGACACGG + Intergenic
1038859216 8:31367889-31367911 CTCTGAGAACTAAGGGAACATGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040410577 8:47150334-47150356 TTCTGAGAAGAGTGGAAGGAGGG + Intergenic
1041095252 8:54343164-54343186 GAAGGAGAAGAGAGGGAAGAAGG - Intergenic
1041465961 8:58157872-58157894 CTCAGGGAAGAGAGGTGAGATGG - Intronic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1042192657 8:66203304-66203326 CTCTGAGATAAGGGGAAAGAAGG - Intergenic
1042286119 8:67112606-67112628 CTCTGAGAATAGAAAGAAGGAGG - Intronic
1042515872 8:69658484-69658506 CTCTGTGAAAAGAGAGAAGAAGG - Exonic
1042842780 8:73140949-73140971 CTCAAACGAGAGAGGGAAGAGGG - Intergenic
1043220747 8:77660458-77660480 CTCTGATAATAGAAGGAAAATGG - Intergenic
1043451090 8:80367444-80367466 CTCAGAGAAGAAAGGAAAGAGGG - Intergenic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1043687558 8:83106880-83106902 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1044184913 8:89239761-89239783 CCCTGAGAAGAAAGGAAAGAGGG + Intergenic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1044257370 8:90081775-90081797 GACAGAGAAGGGAGGGAAGAAGG - Intronic
1044631023 8:94278697-94278719 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1045803007 8:106123327-106123349 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1046607022 8:116382572-116382594 CCCTGAGGAGAGAGGGAAAGAGG - Intergenic
1047141119 8:122140994-122141016 ATCTGGGATGAGAGGGAAGTTGG + Intergenic
1047172155 8:122504128-122504150 CTCTGAAAACAGAGGGAATTGGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047883924 8:129227141-129227163 CCCTGAGAAGAAAGAAAAGAGGG + Intergenic
1048085152 8:131169464-131169486 CTAATAGAAGAGGGGGAAGAAGG + Intergenic
1048141338 8:131797592-131797614 TGCTGAGAAGACAGGGAATAAGG + Intergenic
1048475932 8:134742412-134742434 CTCTGAGATGGGAGAGAGGAGGG - Intergenic
1048600519 8:135914602-135914624 TTCTAAGAAGAAAGGGAAGAAGG - Intergenic
1049294816 8:141826850-141826872 CTCGGAGATGAGAGGGAAGGGGG + Intergenic
1049341384 8:142114425-142114447 GAATGAGAAGAGAGGGAGGAAGG + Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1050792831 9:9495644-9495666 CTCTCAGCAGAGAGGGGAGTCGG - Intronic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051564808 9:18485635-18485657 GGCAGATAAGAGAGGGAAGAGGG + Intronic
1052067517 9:24040566-24040588 CACAGAGCAAAGAGGGAAGATGG - Intergenic
1052345696 9:27407567-27407589 CTCCAAGAAGAGAGGAAGGAAGG - Intronic
1052477862 9:28984076-28984098 AAATGAGAAGAGAGTGAAGAAGG - Intergenic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1053145695 9:35710757-35710779 CTCGGAGGAGAGAGGGCAGTAGG - Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053230372 9:36402570-36402592 CTATGTGAAGAGAGGGGAAAGGG + Intronic
1053310053 9:37012222-37012244 CTGTGAGATGAGAGACAAGAGGG - Intronic
1054766178 9:69044463-69044485 CTCAGAAAAGAGAAGGCAGAAGG - Intronic
1055135497 9:72824492-72824514 CTCTCAGCAGAGAGGGCAGTTGG + Intronic
1056429830 9:86516371-86516393 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1056726466 9:89123428-89123450 TTCTGATGAGAGATGGAAGAGGG + Intronic
1057095060 9:92298953-92298975 CTCTGAAAAGAAAGGGACAAAGG + Exonic
1057439024 9:95068813-95068835 CACTGAGAAGAGAAGGGGGAGGG + Intronic
1058104832 9:100957800-100957822 CTCTGACAGGAAAGGGGAGAAGG - Intergenic
1058394815 9:104539251-104539273 CTTTAAGAAGAGAGAGAAGGAGG + Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059712893 9:116885783-116885805 CTCTGAAAAGAGAAGTAATATGG - Intronic
1059989099 9:119847833-119847855 CTCAGAGCAAATAGGGAAGATGG - Intergenic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060507485 9:124209012-124209034 CTCTGGGAAGAGAAGGGACATGG - Intergenic
1060601423 9:124880731-124880753 CTCTGAGCAGAGCAAGAAGATGG + Intronic
1061065846 9:128276856-128276878 CTGGGAGAAGATATGGAAGAGGG - Intronic
1061370727 9:130196001-130196023 CTCTGGGAGGAGGGGGAAAATGG + Intronic
1061456119 9:130699097-130699119 CTCAGAGAAGGGAGGGAAAGAGG + Intronic
1061488226 9:130931054-130931076 CTCTGTGAAGAGATAGAGGAAGG - Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062402548 9:136378842-136378864 CTCTGAGAAGACAGGAGCGAGGG + Exonic
1062631634 9:137465626-137465648 TTCTGAACAGAGAGGGGAGAAGG + Intronic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1185683742 X:1910110-1910132 CTAGGAGGAGAGAGAGAAGAGGG - Intergenic
1185895408 X:3854167-3854189 CTCTAAAAAGAGGGAGAAGAAGG - Intergenic
1185900525 X:3892591-3892613 CTCTAAAAAGAGGGAGAAGAAGG - Intergenic
1185905641 X:3931022-3931044 CTCTAAAAAGAGGGAGAAGAAGG - Intergenic
1186239001 X:7546463-7546485 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186504421 X:10079403-10079425 GTCTGAGAGGAGTGGGTAGAAGG + Intronic
1186933023 X:14415565-14415587 ATCTAAGAAGAGAGGAAAGTAGG + Intergenic
1187041695 X:15603182-15603204 CTTTGAGAAGCAAGGGAAAAGGG + Intergenic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187478480 X:19633159-19633181 GACAGAGAAGAGAGGGAGGAAGG + Intronic
1188046306 X:25429025-25429047 TGAGGAGAAGAGAGGGAAGAGGG - Intergenic
1188180599 X:27050658-27050680 CTCTCAGCAGACAGGGAAGCTGG - Intergenic
1188212957 X:27445265-27445287 TTCAGAGGGGAGAGGGAAGATGG - Intergenic
1188391521 X:29626634-29626656 TTCTAAAAAGAGAGAGAAGAAGG + Intronic
1188495491 X:30779429-30779451 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1188911304 X:35851269-35851291 CTCACAGAAGAGAGGGAAGTGGG + Intergenic
1189230179 X:39445981-39446003 CTCTGAGGAGAGAGTGGGGAAGG + Intergenic
1189343523 X:40222653-40222675 CCCTGAGAAGGAAGGAAAGAAGG + Intergenic
1189833489 X:44998290-44998312 CTCTGTGAATAGAAGGAACATGG + Intronic
1189836025 X:45023789-45023811 CTCGGGGAAGAGAGGCAAGGGGG - Intronic
1190059132 X:47199637-47199659 CTCTGAGAAAACTGGGCAGAAGG - Intronic
1190509503 X:51161690-51161712 CTCTGAGAAGAGAGTGAGGGTGG - Intergenic
1191214167 X:57918829-57918851 CACTGAGCAGAAGGGGAAGAAGG - Intergenic
1191716105 X:64194619-64194641 ATCTGGGAGGAGAGGGGAGAGGG + Intronic
1191754274 X:64577244-64577266 CTCTCAGCAGAGAGGGGACACGG - Intergenic
1191842608 X:65523875-65523897 CTCTGAGAAGAAAAGGAAAAGGG + Intronic
1193728682 X:85076051-85076073 GGCAGAGAAGAGAGGGAAGCAGG + Intronic
1194739360 X:97554292-97554314 CACTGAGAGGAGAGGTAGGAGGG - Intronic
1195615231 X:106906653-106906675 CCCTGAGAAGAGAGGGCTGGAGG - Intronic
1195650014 X:107274459-107274481 CTCAGAGAAGAGAGCCCAGAGGG - Intergenic
1196845925 X:119896606-119896628 CTCCAACAGGAGAGGGAAGATGG - Intronic
1197926061 X:131647696-131647718 CACTGTGCAGAGAGGGAAAAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198151040 X:133910090-133910112 CTCAGAGAAGAGATGAAGGATGG - Intronic
1198713836 X:139534944-139534966 GTCTGGGAAGAGAAGGATGAAGG + Intronic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1199637832 X:149830159-149830181 CCCTGAGAAGAAAGGAAAGGGGG - Intergenic
1199686161 X:150267512-150267534 GTAAGAGAAGAGAGGGAAGTAGG + Intergenic
1199728312 X:150606614-150606636 CTCTCAGATGCGAGGGAAGGAGG - Intronic
1200734793 Y:6782649-6782671 CCCTGAGAAGAAAGGAAAGGGGG - Intergenic
1201796751 Y:17904562-17904584 CCCTGAGAAGATTGTGAAGATGG - Intergenic
1201804802 Y:18001423-18001445 CCCTGAGAAGATTGTGAAGATGG + Intergenic
1202341209 Y:23870899-23870921 CCCTGAGAAGATTGCGAAGATGG - Intergenic
1202358130 Y:24073624-24073646 CCCTGAGAAGATTGTGAAGATGG - Intergenic
1202512648 Y:25596489-25596511 CCCTGAGAAGATTGTGAAGATGG + Intergenic
1202529557 Y:25799187-25799209 CCCTGAGAAGATTGCGAAGATGG + Intergenic