ID: 930752757

View in Genome Browser
Species Human (GRCh38)
Location 2:54948618-54948640
Sequence AAGGTTAAGCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 615}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930752743_930752757 12 Left 930752743 2:54948583-54948605 CCACATGTTCTTCCTGCTCCCCC 0: 1
1: 0
2: 6
3: 94
4: 1062
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752745_930752757 0 Left 930752745 2:54948595-54948617 CCTGCTCCCCCTGCTCCCAGGAG 0: 1
1: 0
2: 8
3: 85
4: 813
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752741_930752757 27 Left 930752741 2:54948568-54948590 CCTCTTGTTTCAAGCCCACATGT 0: 1
1: 0
2: 1
3: 16
4: 144
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752739_930752757 29 Left 930752739 2:54948566-54948588 CCCCTCTTGTTTCAAGCCCACAT 0: 1
1: 0
2: 1
3: 18
4: 150
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752747_930752757 -6 Left 930752747 2:54948601-54948623 CCCCCTGCTCCCAGGAGAAGGTT 0: 1
1: 0
2: 1
3: 42
4: 285
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752749_930752757 -8 Left 930752749 2:54948603-54948625 CCCTGCTCCCAGGAGAAGGTTAA 0: 1
1: 0
2: 2
3: 20
4: 191
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752748_930752757 -7 Left 930752748 2:54948602-54948624 CCCCTGCTCCCAGGAGAAGGTTA 0: 1
1: 0
2: 2
3: 35
4: 270
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752740_930752757 28 Left 930752740 2:54948567-54948589 CCCTCTTGTTTCAAGCCCACATG 0: 1
1: 0
2: 2
3: 16
4: 208
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752742_930752757 13 Left 930752742 2:54948582-54948604 CCCACATGTTCTTCCTGCTCCCC 0: 1
1: 0
2: 5
3: 50
4: 457
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615
930752750_930752757 -9 Left 930752750 2:54948604-54948626 CCTGCTCCCAGGAGAAGGTTAAG 0: 1
1: 0
2: 0
3: 21
4: 192
Right 930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 37
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930752757 Original CRISPR AAGGTTAAGCAGAGGGAGGA GGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900315058 1:2052268-2052290 AAAGCAAGGCAGAGGGAGGACGG - Intronic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900747527 1:4371376-4371398 AAGGTTAAGAAGAGGGCTCAGGG + Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
902780499 1:18701829-18701851 AGGGATAGGCAGAGGGAAGAAGG + Intronic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904405859 1:30287522-30287544 CAAGTTAAGAAGAGGAAGGAGGG + Intergenic
905130721 1:35754969-35754991 AGTGTTAAGCAGAGTGAGTAGGG - Intronic
905205118 1:36339082-36339104 AAATTTAAGCAAAGGAAGGAAGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907211386 1:52825986-52826008 AAGGTTAAAAAGAGGTAGCAGGG + Exonic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907352623 1:53845336-53845358 CAGATTAAGCAGAGGTATGAAGG - Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907802496 1:57784042-57784064 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
908975401 1:69891161-69891183 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
911234731 1:95399952-95399974 GAGGTCAAGCAGAGTGAAGAGGG + Intergenic
911406355 1:97445283-97445305 AAGGTGAAGCAGAGACATGAAGG - Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912793045 1:112672353-112672375 GAGGTTAAGAAGGGGGCGGAAGG - Intergenic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915385254 1:155485421-155485443 AAGGCTGAGCGGGGGGAGGATGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915909110 1:159901284-159901306 AGGCTTAATCAGAGGGAGAAGGG + Intergenic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918582673 1:186149685-186149707 ATGGTTAAGCTGAGAGAGGCAGG - Intronic
918739559 1:188110745-188110767 AAAGATAAGGAGAGGGATGAAGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
920053167 1:203175521-203175543 AAGGTGGGGCAGGGGGAGGAGGG - Intronic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
920646231 1:207806338-207806360 AGGGTGGAGCAGAGGGAGCATGG + Intergenic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921571736 1:216787698-216787720 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
921609796 1:217197913-217197935 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922945557 1:229510860-229510882 AAGGCTAAGGTGTGGGAGGATGG + Intergenic
922969785 1:229726638-229726660 AAGGTTAGGGAGTGGAAGGAAGG + Intergenic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
924809705 1:247390215-247390237 CAGGTTAAGAAGAGGAAGGAGGG - Intergenic
1063676116 10:8141698-8141720 AAAGTTAAGCAGAGTGGGGGTGG - Intergenic
1063690741 10:8284739-8284761 AAGATTAAGCCAAGGAAGGATGG - Intergenic
1063862186 10:10323076-10323098 AAGGTTAAGTAGATGGTGGATGG + Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064128778 10:12689062-12689084 AATGCTTAGCAGCGGGAGGATGG + Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1067780812 10:49205459-49205481 GAGCTCAAGGAGAGGGAGGAAGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070325719 10:75387719-75387741 AAGGTGGAGGAGAGGGAGCAGGG + Intergenic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070519391 10:77238678-77238700 AAGGTTAAGCAGAGGTTGACTGG - Intronic
1070914108 10:80141841-80141863 GAGGTGAAGCCCAGGGAGGAAGG - Intronic
1070987008 10:80697787-80697809 AAGGATAAAAAGAGGAAGGAAGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1071871819 10:89803882-89803904 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1073515873 10:104075100-104075122 AAGGTAAAGCGGAGGGAATAAGG - Intronic
1074090918 10:110254520-110254542 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1074611245 10:115024244-115024266 AAGGTTAAAGAGAGACAGGAAGG - Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076742701 10:132494930-132494952 ATTATTAAGCTGAGGGAGGAAGG + Intergenic
1077204968 11:1337620-1337642 AACGTTAAAAAGAGGGAGGGTGG + Intergenic
1078793183 11:14565788-14565810 AAGGTAAAGCAGCGGCAAGAAGG + Intronic
1079528184 11:21415739-21415761 GAGGTTAAGCAAAAGGAGAAGGG + Intronic
1080428335 11:32176069-32176091 AAAGTTATCCAGAGGAAGGATGG + Intergenic
1080842311 11:35996142-35996164 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1082761139 11:57127984-57128006 AACATTAGGCAGAGGGAAGAGGG + Intergenic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083071436 11:59987382-59987404 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083367714 11:62151554-62151576 AAGGTTAAGCTGCCAGAGGAAGG + Intronic
1084369246 11:68728152-68728174 AAGATTAAGCTTAGTGAGGAAGG + Intronic
1084919555 11:72458124-72458146 AAAGTGAGGGAGAGGGAGGAAGG + Intergenic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1085875265 11:80399604-80399626 GAGGTAAAGCTGACGGAGGAGGG + Intergenic
1086001165 11:81987228-81987250 GAAGTTAAGAAGAGGCAGGAAGG - Intergenic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088953610 11:114595842-114595864 TAGCTCAAGCAGAGGTAGGAAGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1091515568 12:1177332-1177354 AAGATTAAGCTTAGTGAGGAAGG - Intronic
1091967615 12:4758350-4758372 AAGGTTAAGAAGGGAGATGATGG + Intronic
1092791976 12:12078289-12078311 AAGCTAAAGCAGAGGGTAGAGGG + Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093427557 12:19045529-19045551 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1094083435 12:26563082-26563104 TATGCTAATCAGAGGGAGGAGGG - Intronic
1094776494 12:33734712-33734734 AAGGTGAAGAAGAGGGGAGAGGG - Intergenic
1095886677 12:47195501-47195523 AAAGATAATCAGAGGAAGGAGGG - Intronic
1095910568 12:47422409-47422431 AAAATTAAGCATAGAGAGGAAGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097248113 12:57617779-57617801 CATGTTCAGCTGAGGGAGGATGG + Intronic
1097566490 12:61276003-61276025 GAGGTCAAGGAGTGGGAGGAGGG + Intergenic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1098022957 12:66174420-66174442 AAGGTGAGGGCGAGGGAGGAGGG - Intergenic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1098880890 12:75916097-75916119 AAGGTTTAGAAGAGGTGGGAAGG + Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1101906174 12:108828145-108828167 AGGGTTTACAAGAGGGAGGAGGG + Intronic
1102813545 12:115844151-115844173 AAGGTTGAGCAGAGGAGGAATGG - Intergenic
1102983792 12:117262904-117262926 AAGTTTAAGCAAAGAGGGGAAGG - Intronic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103367028 12:120390820-120390842 AAGGAAAGGAAGAGGGAGGAAGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104515292 12:129419484-129419506 AAACTTTAGCAGAAGGAGGATGG + Intronic
1104666627 12:130652021-130652043 AAGATAAAGCTGAGGCAGGAGGG - Intronic
1106086482 13:26546878-26546900 AAGGTGAAGTATAGGGAGCATGG - Intergenic
1106314325 13:28579700-28579722 GATGTTAAGGAGAGGAAGGAGGG - Intergenic
1107683695 13:42875823-42875845 AAGGTGAAGCAGGGAAAGGAAGG + Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108701068 13:52944611-52944633 ATGGTTAAGCACAGGAAAGAAGG + Intergenic
1109086445 13:57977875-57977897 AAGGCTAAGAAAATGGAGGATGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111351493 13:87036878-87036900 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112215412 13:97425876-97425898 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1112870598 13:103965976-103965998 AAGGTTAAGTAGAGCCAGCAAGG + Intergenic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115709550 14:36035803-36035825 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117564704 14:56981281-56981303 AATGTGAAGCAGAGATAGGATGG - Intergenic
1118518089 14:66548748-66548770 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119330829 14:73792308-73792330 AAGGGTAAGGAGAGAGAAGAGGG + Intergenic
1119546365 14:75474819-75474841 AAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1121461480 14:94081975-94081997 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1121532918 14:94671148-94671170 AAGGTCCAGCAGAGGGAGACAGG + Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1124670795 15:31636595-31636617 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1125303454 15:38282613-38282635 ATGGATAAGCAGTGGTAGGATGG + Intronic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126668900 15:51098259-51098281 AACCTTCAGCAGTGGGAGGAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1126988071 15:54337921-54337943 AAAGTAAAACAGAGGAAGGATGG - Intronic
1127267846 15:57376098-57376120 AAGGCTAAGCAGGGAAAGGAAGG + Intronic
1127674730 15:61228610-61228632 AAGGTAAAGCGGAAGGAGGGTGG + Intronic
1127805147 15:62512370-62512392 AAGGTTAAACAAAGAAAGGAAGG - Intronic
1127999417 15:64176841-64176863 AAGATGAATCAGAGGAAGGAGGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1129990101 15:79954712-79954734 AAGGTGAAAAAGAGGGAGTATGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132543147 16:520828-520850 GAGGTCAAGTAGAGGCAGGAAGG + Exonic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1134567886 16:15266708-15266730 AAGGATTGGCAGAGGGAGGGCGG - Intergenic
1134734549 16:16489645-16489667 AAGGATTGGCAGAGGGAGGGCGG + Intergenic
1134932917 16:18222261-18222283 AAGGATTGGCAGAGGGAGGGCGG - Intergenic
1137384994 16:48033212-48033234 AGGGTTAGGCAGAGAGAGAAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1139797902 16:69497887-69497909 AAGATGAGGCAGAGGGAGGGAGG + Intergenic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143462914 17:7115231-7115253 AAGCTTCAGCAGGAGGAGGAAGG + Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1143951918 17:10639405-10639427 AAAGTTAACCAGAGAGAAGAAGG - Exonic
1144118422 17:12125017-12125039 AAGCTGAAGCTGAGGGAAGAGGG - Intronic
1144711185 17:17402603-17402625 AACACTATGCAGAGGGAGGATGG + Intergenic
1146441444 17:32898729-32898751 AAGATAAAGTAGGGGGAGGAAGG + Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1149750998 17:59145123-59145145 AAGGTTATGGAGATGGATGATGG + Intronic
1149999684 17:61425947-61425969 AGGGTTAGGGAGAGGAAGGATGG + Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150119442 17:62587634-62587656 AGGGCTTAGCAGAGGGAGAAGGG + Intronic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153488363 18:5624942-5624964 AAGGTGAAGAAAGGGGAGGAAGG + Intronic
1153662088 18:7333919-7333941 AAGGTAGAGGAGAGGGCGGAGGG + Intergenic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1155616794 18:27730516-27730538 TAGCTTAAGTAGAGGGAGTAAGG - Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156346295 18:36259996-36260018 AAGAGTAAGTAGGGGGAGGATGG - Intronic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158043642 18:53128689-53128711 AAGGATAAGGCTAGGGAGGAAGG + Intronic
1158154059 18:54405607-54405629 AAAATTAAGCAGGGGGAGGCAGG - Intergenic
1158236169 18:55317017-55317039 AAATTTAATCAGAGGCAGGAAGG + Intronic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158435780 18:57435140-57435162 AACGTCAAGGAGAGGGAGGGAGG - Intergenic
1159620649 18:70634298-70634320 AAGGTTAAGCAAAGTGACCAAGG + Intronic
1159625086 18:70683677-70683699 AATGTCAAAGAGAGGGAGGAAGG - Intergenic
1160692499 19:466406-466428 AAGGTTAGGTAGATGGTGGATGG + Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161825262 19:6559587-6559609 AAAGTTTAGTAGAGGGAGGGAGG - Intergenic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162937996 19:13991284-13991306 AAGGTGGGGCAGAGGGAGAATGG + Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1164511408 19:28900239-28900261 AAAGTATTGCAGAGGGAGGATGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1167758404 19:51427487-51427509 AGGGTCATGCAGAGGGAGGCTGG + Intergenic
1168418216 19:56183001-56183023 AGGGTGGAGCAGGGGGAGGAGGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925070090 2:960074-960096 AACCTTAAGCAGGGGGATGATGG - Intronic
925130288 2:1489465-1489487 AAAGTGAAGCAGAGGAAGGTGGG - Intronic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925769354 2:7267213-7267235 AGGGTTCAGCAGAGGTGGGAGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
928938159 2:36702094-36702116 AATGTTAAACAGAGAGATGAAGG + Intronic
929328352 2:40646703-40646725 AAGATAAAGTAGAGGAAGGAAGG + Intergenic
929391025 2:41468847-41468869 AAGGTTAAGGATAAGGAAGAAGG - Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929812838 2:45206271-45206293 ATAGTTCAGCAGAGGGTGGAGGG + Intergenic
930060944 2:47287878-47287900 AGGGTTATGGAGAGGGAAGATGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
932144087 2:69304007-69304029 AAGGCTCATCTGAGGGAGGAGGG + Intergenic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
932741307 2:74293060-74293082 AGGGTGAAGCAGAGGGGGCAGGG + Intronic
932794743 2:74684599-74684621 AAGTTCAAGCAGATGGAGAAGGG + Intergenic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
934729410 2:96647153-96647175 AAGGTGAGGCAGAGAGAGGCAGG + Intergenic
935147439 2:100405465-100405487 AAGGTGGGGCAGAGAGAGGATGG + Intronic
935484852 2:103640535-103640557 AAAGTCAAGCAGAGGGAAAAGGG + Intergenic
935787974 2:106566425-106566447 AAGGTGAAGAAGAGAGGGGAAGG + Intergenic
935791953 2:106601024-106601046 AAGGTGAAGCAGGGGCAGGTAGG + Intergenic
936514695 2:113174259-113174281 AGGGGTAGGCTGAGGGAGGAGGG - Intronic
938265612 2:129926006-129926028 GAGGTGAAGCCCAGGGAGGAAGG + Intergenic
938605221 2:132885281-132885303 AAGGATAAGCAGAGAGGGAAAGG + Intronic
938673818 2:133610533-133610555 CAGGTTTAGCACAGGCAGGAGGG - Intergenic
938816006 2:134904772-134904794 AATGTGAGGAAGAGGGAGGAAGG + Intergenic
939024680 2:136997942-136997964 AAGGTAAGGCAGAGTGAGCAAGG + Intronic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
939729511 2:145764717-145764739 AAGGTTGAGGAGAGGATGGATGG - Intergenic
939994257 2:148905703-148905725 AGGGTCAAGGAGTGGGAGGATGG + Intronic
940495983 2:154429205-154429227 AAGATTAAGCTTAGTGAGGAAGG + Intronic
940614287 2:156030761-156030783 AAGGTTAAGGAGAAGGATAATGG + Intergenic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941254408 2:163210438-163210460 CTGGTTAAGCAGTGGGAGTATGG + Intergenic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
941974583 2:171389113-171389135 AAGATTAAGCTTAGTGAGGAAGG + Intronic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942570907 2:177313364-177313386 AAGGGAAAGAAGAGGAAGGAAGG - Intronic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943367621 2:186981006-186981028 AAGGTTAAGCCCAGTGAGGGAGG - Intergenic
944006948 2:194921111-194921133 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
944122848 2:196259629-196259651 AACCTTAAGCAGAGAGAGGCTGG - Intronic
944187312 2:196963374-196963396 AATATTAAGGAGAGGGAGGTAGG + Intergenic
945424784 2:209687560-209687582 AAGATCAAGCTGATGGAGGATGG - Intronic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
946524236 2:220500853-220500875 ATGGTTAAGCCTAGTGAGGAAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947395239 2:229680227-229680249 AAGGTGACGCAGAAGGAGTATGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948121303 2:235532756-235532778 AAGGGTAAGCTGAGGCAGGTAGG - Intronic
948612117 2:239176374-239176396 AAGGCCAGGCAGAGGGAGGGAGG - Intronic
948681686 2:239639479-239639501 AAGGTGAAGCAGGGACAGGAAGG - Intergenic
1169512973 20:6284856-6284878 AAAGTCAAACAGAGTGAGGAAGG + Intergenic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170659284 20:18320758-18320780 AAGATTAATCAGTGGGAGGAGGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171168671 20:22995881-22995903 ATGGCCAAGCAGAGGGAGGGAGG - Intergenic
1171240687 20:23565138-23565160 CAGGTCAAGCAGTGGGAAGACGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172895235 20:38295553-38295575 GATGTGAAGCAGAGGGGGGATGG + Intronic
1172953946 20:38742088-38742110 CAGGTTAAGTAGATGGAGCAGGG - Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173364009 20:42368993-42369015 AAGGTAAAGGAAAGGAAGGAAGG - Intronic
1173419575 20:42889086-42889108 ACAGTTAAGCAGAGGCAGGGAGG - Intronic
1174050866 20:47766422-47766444 AGGGTCATTCAGAGGGAGGAGGG + Intronic
1174066660 20:47870736-47870758 AAGGCAAAGAGGAGGGAGGAAGG + Intergenic
1174631338 20:51960658-51960680 AAGGTGGAATAGAGGGAGGAGGG + Intergenic
1174652578 20:52140291-52140313 AAGGTTAAGCTCGGTGAGGAAGG + Intronic
1175088363 20:56480608-56480630 ATGATTAAGCTTAGGGAGGAAGG - Intronic
1175294702 20:57900293-57900315 AAGGTTGAGGGGAGGGAGGGAGG + Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175872544 20:62215272-62215294 AAGCCTTAGCGGAGGGAGGAGGG + Exonic
1176951155 21:15047875-15047897 AAGGTTAAGCTCAGTGAGGAAGG - Intronic
1177094805 21:16819554-16819576 GAGGTGAAGCAGAGGAAGCAGGG - Intergenic
1177306895 21:19330264-19330286 AAGGATAACCAAAGAGAGGAGGG - Intergenic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181270716 22:21657211-21657233 AGAGTGAAGGAGAGGGAGGAGGG + Intronic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1182045456 22:27270711-27270733 AAGGGTAACCAGAGAAAGGAGGG + Intergenic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182789698 22:32940859-32940881 TAGGTTAAGGAGACAGAGGATGG - Intronic
1183002033 22:34868578-34868600 CAGGTGAAGCAGAGGGAGTGAGG - Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1184667094 22:45994937-45994959 AAGGTTAAGGACAGGGTGAAGGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185017697 22:48354503-48354525 TAGGTTAGGCTGAGGGAGGCAGG + Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1185264525 22:49893400-49893422 AACCTTAAGCAGAGGGAGGGAGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949165325 3:933670-933692 GAGTTAAAGGAGAGGGAGGATGG + Intergenic
949221169 3:1635800-1635822 AAGCTTCAGATGAGGGAGGAGGG + Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949477510 3:4462632-4462654 AAGGTTGAGGAGAGGAAAGAAGG - Intronic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
949742348 3:7250971-7250993 AAGCTTAAGGAAAGGAAGGATGG + Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950983442 3:17333582-17333604 ATGCTTAAGCAGAGGGATAAGGG + Intronic
951972974 3:28469057-28469079 AAAGTTAAAAAGAGGGAGGAAGG + Intronic
952119420 3:30224176-30224198 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
952417816 3:33105472-33105494 ATAGTTCAGCAGAGGGGGGAAGG - Intergenic
953431493 3:42844250-42844272 GAGGTGAGGCAGAGGAAGGAAGG + Intronic
953850105 3:46459553-46459575 CAGGTGAAGCAGAGGAAGTAAGG + Intronic
953854811 3:46493134-46493156 AAAGATAAGCAGAGGTAGAATGG - Intergenic
955143013 3:56288316-56288338 AAGGTAAAGCAGGAGGATGAGGG + Intronic
955658607 3:61271864-61271886 AAGCTCAAGAAGAGGCAGGAAGG + Intergenic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
956973926 3:74558248-74558270 AGGATTAAGAAGAGGGAGGAAGG - Intergenic
957282798 3:78175093-78175115 GAGGTGAAGGAGAGGGAAGAAGG - Intergenic
957499712 3:81038725-81038747 AAGATTAAGCTTAGTGAGGATGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959565014 3:107825325-107825347 CAGGTTAAGCAGAGGCAAGTGGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959738417 3:109687644-109687666 AAGGTTGAGCAGAAAGAGCATGG + Intergenic
960121092 3:113948692-113948714 GAGGTTAAGCAGAGAGAGAGAGG + Intronic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
963281348 3:143387372-143387394 AAAGGTAAGCCGAGGGTGGAGGG + Intronic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965595527 3:170406932-170406954 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
966356376 3:179083897-179083919 TTTGTTAAGCAGAGGGAGGGTGG - Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966999741 3:185322563-185322585 AAGATTATACAGAGTGAGGAAGG - Intronic
967210199 3:187161764-187161786 TAGGGGAAGCAGAGGTAGGAAGG - Intronic
967342994 3:188421727-188421749 AAGCTTAAGCAGATGGAGACAGG - Intronic
967693635 3:192506073-192506095 AAGGTGAAGCAGGGATAGGAAGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969476985 4:7427427-7427449 GAGCTTCAGCAGTGGGAGGATGG + Intronic
969920060 4:10530026-10530048 AAGGTGAAAGAAAGGGAGGAAGG - Intronic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970689978 4:18611627-18611649 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690142 4:18612087-18612109 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690228 4:18612325-18612347 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970738996 4:19210656-19210678 AAGGTTAGGAAGTGGGAGGTGGG + Intergenic
971881169 4:32375261-32375283 AAGATGAAGAAGGGGGAGGAGGG - Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972770620 4:42193877-42193899 TGGGTAAAGCAGAGGGAAGATGG + Intergenic
973284122 4:48396262-48396284 AAGGTAAAGAAGGGGGAGGAGGG + Intronic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976316879 4:83667826-83667848 AGGGTTGGGCAGAGGTAGGAAGG + Intergenic
976381275 4:84402012-84402034 AAGGTTAAGCAGAATGGGGCTGG + Intergenic
976437562 4:85035434-85035456 AAAGCTAAGGAAAGGGAGGAAGG - Intergenic
976572200 4:86625382-86625404 AAGGTTGGGATGAGGGAGGAGGG - Intronic
976597591 4:86908621-86908643 AAGGTTGAGGAGGGGGAGGGAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978763044 4:112375828-112375850 AATGTTAAGCTGAGAGAGAAAGG - Intronic
979014159 4:115411359-115411381 AATGTTAAGCAGTGTGAAGAAGG + Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981769357 4:148289771-148289793 AAGGAAAAGAAAAGGGAGGAAGG - Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
983421227 4:167520070-167520092 AAAGTTGAGGAGATGGAGGACGG - Intergenic
983555466 4:169055560-169055582 GAGGTGAAGGAGAGGGAGAAGGG - Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984038580 4:174700580-174700602 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
985250810 4:188022594-188022616 AAAGTTTAGCAGGAGGAGGAAGG + Intergenic
985487117 5:158158-158180 AGGATAGAGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988717377 5:33841386-33841408 GAGGTTAACCAGAGACAGGATGG - Intronic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990358503 5:54995145-54995167 AAGATTAAGCAGGTGGATGAAGG - Intronic
990375713 5:55168403-55168425 AGGGTCAAGCAGAGGGAAAAGGG - Intronic
991473797 5:66998697-66998719 AATATTAAGCAAAGGGAGAAAGG - Intronic
992472508 5:77072248-77072270 AAGGTTAAGTAAAGGCAGCATGG - Exonic
992808353 5:80360896-80360918 AAGGTTAGGCAGGCAGAGGAGGG - Intergenic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994030471 5:95136158-95136180 AAGGTTGAAGAGAGGGAGAAGGG - Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995615666 5:113960476-113960498 AAGGTCAAGGAGAGAGATGAGGG + Intergenic
996199487 5:120653560-120653582 AATCTTAATCAGAGGTAGGAAGG + Intronic
996744554 5:126835229-126835251 AAGGTTCATAAGAGGGAAGATGG + Intronic
997463882 5:134073639-134073661 AATGTTCATCAGAGAGAGGATGG + Intergenic
998211912 5:140206062-140206084 AAGGTGGAGCAGAGGGCGCAGGG - Intronic
998719211 5:144924493-144924515 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
999268632 5:150283333-150283355 AGAGTTAACCAGAGGGAAGAGGG - Intronic
999554271 5:152723162-152723184 AAGGTTTAGAAGGTGGAGGAAGG - Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000067641 5:157708872-157708894 AAGGATGAGAAGAGGGAGAAAGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000393056 5:160745439-160745461 AAGGTAAAGAAGAGATAGGATGG - Intronic
1000913057 5:167045500-167045522 AAGGTGAAGGAGAGAGAAGAGGG - Intergenic
1001765377 5:174241882-174241904 AAGGTCAGGGGGAGGGAGGAAGG - Intronic
1002113356 5:176936861-176936883 AAAGTAAAGCAGAGGGAGAGGGG - Intronic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002842354 6:917138-917160 TAGGTTGAGAAGTGGGAGGAAGG - Intergenic
1002891251 6:1334524-1334546 AAGGTTTAAAGGAGGGAGGAGGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004125079 6:12865220-12865242 AGGACTAGGCAGAGGGAGGAAGG + Intronic
1004291139 6:14368554-14368576 AAGGTTTTGCAGTGGGAGAAAGG + Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1005037131 6:21567074-21567096 AAGTTAAAGCAGGGGGATGAAGG - Intergenic
1005406902 6:25498996-25499018 AAGGTCAGGGAGTGGGAGGAGGG + Intronic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006736715 6:36278944-36278966 AAGATAAAGCAGGGGAAGGATGG + Intronic
1007287673 6:40759339-40759361 AAGGTTAATGAGCTGGAGGAGGG + Intergenic
1007569128 6:42876615-42876637 AATTTTAAGCAGAGTGATGATGG - Intergenic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007652488 6:43432210-43432232 AAGGTCTAGCAGCGGGAAGACGG - Exonic
1008497970 6:52152195-52152217 AAGGTAAAGGAAAGGAAGGAAGG + Intergenic
1009960790 6:70518026-70518048 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1012170740 6:96015140-96015162 AATGTTGAGAAAAGGGAGGAAGG + Intergenic
1012564906 6:100636575-100636597 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1012928568 6:105293188-105293210 AGGGTTAAGCTCAGTGAGGAAGG - Intronic
1013205032 6:107936901-107936923 GAGGTCTAGTAGAGGGAGGAAGG - Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013984725 6:116176706-116176728 AGGCTTAAGCAGCTGGAGGAAGG - Intronic
1014243056 6:119039610-119039632 GGGGTTGAGGAGAGGGAGGAAGG + Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015495461 6:133877755-133877777 ATTGTGAAGCAGAGGAAGGAAGG + Intergenic
1016645711 6:146406044-146406066 AGGTTGAAGAAGAGGGAGGAAGG + Intronic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1016931573 6:149415879-149415901 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017113920 6:150959301-150959323 AAGCTTACGCAGAGAGAGAATGG - Intronic
1017267315 6:152462890-152462912 ACTGTTAAGGAAAGGGAGGAGGG + Exonic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1017808427 6:157966642-157966664 AAGGTTAAGGACAGACAGGAAGG + Intergenic
1017967538 6:159279564-159279586 AAAGTTTAGGAGAGGGAAGAGGG + Intergenic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1022063269 7:26822981-26823003 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1022951390 7:35341590-35341612 AAGGTTAAACTTAGGGAGGAAGG + Intergenic
1023038093 7:36150406-36150428 AAGGTTTAGGAGGGGGATGAAGG - Intergenic
1023058321 7:36307253-36307275 AGGGTTTGGAAGAGGGAGGAGGG - Intergenic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1023173658 7:37414397-37414419 AAGGTGGAGAAGAGAGAGGACGG + Intronic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023729069 7:43173260-43173282 ATGGCTAAGCAGAGGAAGAATGG + Intronic
1023773233 7:43579144-43579166 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023980767 7:45068743-45068765 AGGGTTGAGCAGAGAGAGGTGGG - Intronic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025294824 7:57769111-57769133 AAGGTGAAACACAGAGAGGAAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027141692 7:75662073-75662095 AAGGTGGAGGGGAGGGAGGAGGG + Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028379948 7:90188931-90188953 GAGGTTAAGAAGAGGGTGTAGGG - Intronic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030547139 7:110910051-110910073 AAGGTTAGGCTTAGGGAGGGAGG + Intronic
1030927845 7:115479639-115479661 TAGGTTAAGGAAAGGAAGGAAGG - Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033801587 7:144908388-144908410 AAGGTGAAGCAGAGAGAGAAAGG + Intergenic
1034096277 7:148410779-148410801 AAAGTTGAGCAGGAGGAGGAAGG + Intronic
1034142714 7:148837157-148837179 AAGATTATTCAGAGGCAGGACGG - Intronic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1035568750 8:658878-658900 AAGGAAAGGCAGAGGAAGGACGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1038526964 8:28282984-28283006 AAGGTTAAACTTAGTGAGGAAGG + Intergenic
1039099025 8:33920925-33920947 AAGGTTGGGGAGAGGCAGGAGGG + Intergenic
1039349941 8:36753165-36753187 AAGGTGAGGCGGAGGGAGAAGGG - Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1041179779 8:55235638-55235660 TAGGTCAAGGAGAGGGAGGTAGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043946459 8:86259507-86259529 AAGGTTAAGCAAAGTGCGAAAGG - Intronic
1044874255 8:96648768-96648790 AAGACCAAGCAGAGGGAGAAGGG + Intronic
1046927660 8:119809548-119809570 ATGGTTAAGCTTAGGGAGGAAGG - Intronic
1046962032 8:120122911-120122933 AAACTTAAGGAGAGGAAGGAAGG + Intronic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1048013598 8:130478373-130478395 AAGGTTAAGAAGAGACAGAAAGG - Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049405954 8:142451955-142451977 AAGGTCAAGCAGGCGAAGGAGGG + Intronic
1049986221 9:954292-954314 AAAGTGAAGCAGAGAGAGAAGGG + Intronic
1050156638 9:2673851-2673873 AAGGTTAAGTAGATGGTGGGAGG - Intergenic
1050793267 9:9502269-9502291 AGGGCTCAGCAGAGGGAGAAAGG - Intronic
1050918337 9:11165961-11165983 AAGGTTTTGCAGAGGTAGAAAGG + Intergenic
1051166407 9:14266719-14266741 AGGGTAAGGGAGAGGGAGGAGGG - Intronic
1051507254 9:17840702-17840724 AAGGTCCAGCAGAGGCAGCAGGG - Intergenic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052186613 9:25604539-25604561 AAGATTAAGCTTAGTGAGGAAGG + Intergenic
1052257349 9:26473796-26473818 AAGGTAAAGGAAATGGAGGAAGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055529826 9:77172888-77172910 AAGGTTAAGTATAAGTAGGATGG - Intergenic
1055820190 9:80252990-80253012 AAGGTGAGGCAGAGAGGGGAAGG + Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058349233 9:104001172-104001194 ATGGTTTAGAAGAGGTAGGAGGG + Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059690321 9:116678601-116678623 AAGGTTAAGCAAAGTGAAAAGGG + Intronic
1060628975 9:125139004-125139026 AAGGTGGAGCAGAGGGAGGGTGG + Intronic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1061334620 9:129923963-129923985 AGGGTGAGGCAGAGGCAGGAGGG + Exonic
1061536761 9:131255115-131255137 AAGGGTCAGCAGTGGCAGGAAGG + Intergenic
1061769080 9:132903821-132903843 ATTGTAAAGCAGAGGGAGGGTGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187692254 X:21881156-21881178 AAGATTAATCAGAGTGAGAAAGG + Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189408083 X:40743825-40743847 AAGGTTAGGCAACAGGAGGAAGG - Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1192175346 X:68881492-68881514 AAGGGTAAGCAGGGAGAGGTGGG - Intergenic
1192562030 X:72133535-72133557 AAGGTGAAGGAGAGGGAAGGAGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193010349 X:76668763-76668785 AAGGTTCAGAAGAGGTTGGAGGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195987907 X:110651206-110651228 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
1196194470 X:112825225-112825247 AATGTTCAGGAGAGGGAGGGAGG + Intronic
1197112678 X:122795292-122795314 AGGGTCAGGGAGAGGGAGGAGGG + Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1198102763 X:133436309-133436331 AGGGTGAAGCAGATGGAGGGTGG + Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1198264643 X:134998114-134998136 AAGGGTAAGCAGGGGGAAAATGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1199260182 X:145764061-145764083 ATGATTAAGCTTAGGGAGGAAGG + Intergenic
1199343776 X:146714348-146714370 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic