ID: 930755588

View in Genome Browser
Species Human (GRCh38)
Location 2:54968850-54968872
Sequence CTCTCCCAGGGGCATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 400}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930755570_930755588 22 Left 930755570 2:54968805-54968827 CCTGGCCAGCTCTCCCTCCCCAT 0: 1
1: 1
2: 2
3: 63
4: 654
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755580_930755588 -10 Left 930755580 2:54968837-54968859 CCCGTGGGTCAGCCTCTCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 299
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755574_930755588 8 Left 930755574 2:54968819-54968841 CCTCCCCATCTCAGGCATCCCGT 0: 1
1: 0
2: 0
3: 18
4: 147
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755571_930755588 17 Left 930755571 2:54968810-54968832 CCAGCTCTCCCTCCCCATCTCAG 0: 1
1: 2
2: 7
3: 124
4: 1072
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755579_930755588 3 Left 930755579 2:54968824-54968846 CCATCTCAGGCATCCCGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 117
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755569_930755588 29 Left 930755569 2:54968798-54968820 CCACAGGCCTGGCCAGCTCTCCC 0: 1
1: 0
2: 11
3: 79
4: 798
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755576_930755588 5 Left 930755576 2:54968822-54968844 CCCCATCTCAGGCATCCCGTGGG 0: 1
1: 1
2: 1
3: 11
4: 116
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755573_930755588 9 Left 930755573 2:54968818-54968840 CCCTCCCCATCTCAGGCATCCCG 0: 1
1: 0
2: 1
3: 29
4: 247
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400
930755578_930755588 4 Left 930755578 2:54968823-54968845 CCCATCTCAGGCATCCCGTGGGT 0: 1
1: 0
2: 0
3: 6
4: 70
Right 930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930755588 Original CRISPR CTCTCCCAGGGGCATGAGGA GGG Intronic
900367548 1:2317432-2317454 CTCTTCCTGGGGCAGGAGAAGGG + Intergenic
900643337 1:3697637-3697659 CCCTCCCAGGTGCAGGAAGATGG - Intronic
901191247 1:7411246-7411268 GCCTCCCTGGGGCATGAGCAGGG + Intronic
901451966 1:9341283-9341305 CCTTCCCAAGGGCATGAGGGAGG + Intronic
901759681 1:11462617-11462639 CTCTCAGAGGGGAATGAGCAGGG - Intergenic
901819909 1:11822049-11822071 TTCTCCCAGGGGAGAGAGGAAGG + Intronic
901824172 1:11849767-11849789 CAGCCCCAGGGGCATGGGGAAGG - Intergenic
902168529 1:14592254-14592276 CTCTTGGAGGGGGATGAGGAGGG + Intergenic
902197805 1:14810728-14810750 CTTTCCCAAGGACATGAGGGTGG + Intronic
902550267 1:17215075-17215097 CACTCCCACAGGCATGGGGAGGG - Intronic
902782119 1:18711614-18711636 CTTCCCCAGGGGCTTGAGGGAGG - Intronic
903044539 1:20554867-20554889 TTCTCCCAGCAGGATGAGGAAGG + Exonic
903133292 1:21293040-21293062 ATCTCCCCGGGGCATGTGGGTGG + Intronic
903182132 1:21610082-21610104 GCCTCCCAGGGGCATCAGCAAGG - Intronic
904328682 1:29744204-29744226 CTCACCCAGGGGCACATGGAAGG - Intergenic
905231552 1:36517657-36517679 ATCTCCCAGGAGCAGGAGGGAGG - Intergenic
905441738 1:38000391-38000413 CTCTCCCAGAGGCAGTAGGAGGG - Intronic
905465875 1:38152737-38152759 CTGCCCCTGGGGCATGAGTAGGG + Intergenic
905862285 1:41359795-41359817 CCCACCCTGGGGAATGAGGAGGG + Intergenic
906778375 1:48550310-48550332 TTCTCCCCGGGGCCTGTGGAGGG - Intronic
907480456 1:54742338-54742360 CTCTCCCGGGGGGATGGGGTGGG - Exonic
907489635 1:54800762-54800784 CTCTGCCAGGCCCATGAGGTCGG + Exonic
907574318 1:55512385-55512407 CTTTCCCAGGGTCCTTAGGAAGG + Intergenic
908102636 1:60807511-60807533 CCCTCCCAGAGGCCTAAGGATGG - Intergenic
908930877 1:69315105-69315127 CTCCTCCAGGGGCCTGATGAAGG - Intergenic
909667713 1:78154134-78154156 CCCTCCAAGGTGCAGGAGGAGGG - Intergenic
912373534 1:109191876-109191898 CTCTCCTGGGGGTCTGAGGAAGG - Intronic
912412830 1:109490004-109490026 CCCACCCCGGGGCATGGGGAAGG - Exonic
912552253 1:110491886-110491908 CTCTCCCAGGAGAATGTGCAGGG - Intergenic
913050098 1:115109894-115109916 CCCTGCCAAGGGCATGTGGAGGG - Intergenic
913936922 1:125064185-125064207 CTCTGCCTGGGTCATGAGGCCGG - Intergenic
913937424 1:125067082-125067104 CTCTGCCTGGGTCATGAGGCCGG + Intergenic
915010302 1:152679117-152679139 ATCTCTCAAGGGCAGGAGGAGGG + Intergenic
915056291 1:153134073-153134095 TCCTCCCAGGGGCCTGAGAATGG + Intergenic
915556650 1:156664558-156664580 CTCTCCCTGCTTCATGAGGATGG + Intergenic
915592577 1:156879058-156879080 AACTCCCAGGAGCCTGAGGAAGG - Intronic
916022699 1:160807952-160807974 CTCTGCCTGGGGCCTGAGGATGG - Intronic
917931423 1:179825274-179825296 CTCCCGCAGGGGCAAGACGACGG + Intergenic
919792503 1:201301100-201301122 TCCTCCCTGGGGCAGGAGGATGG - Intronic
919974161 1:202600047-202600069 TTCTCCCAGGGAAATGAGCAGGG - Intronic
919983762 1:202658796-202658818 CACTGGCAGGGGCAAGAGGAGGG - Intronic
920210822 1:204327058-204327080 CTATCCCAGGAGGAGGAGGAGGG - Intronic
920263761 1:204707094-204707116 CACTGCCAGGGGCAGGAGTAGGG - Intergenic
920273017 1:204781178-204781200 CTATCACAGAGGCATGAGCAAGG + Intergenic
920363538 1:205435922-205435944 TTCTCCCAGAGGCCTGAGGATGG - Intronic
920856378 1:209665912-209665934 CTCTTCTAGGGGCAGGAAGAAGG + Intergenic
922210684 1:223484136-223484158 CACTAGCAGGGGCATGAGGCAGG + Intergenic
922786097 1:228283030-228283052 GTCTTCCAGGGGCTTGATGATGG - Exonic
923099795 1:230803239-230803261 CTTTCCCAGGGACATATGGATGG - Intergenic
1062891473 10:1063851-1063873 CTCTGCCAGGTGGATGTGGACGG - Intronic
1063125103 10:3130069-3130091 CTTTCCAAGGGGCATGGAGATGG + Intronic
1065886072 10:30078371-30078393 CTCTCTCTGGGGCAGGATGAAGG + Intronic
1067385301 10:45812985-45813007 TGCTCCCTGGGGCATCAGGAGGG + Intergenic
1067587530 10:47484797-47484819 TGCTCCCTGGGGCATCAGGAGGG + Intergenic
1067634586 10:47992563-47992585 TGCTCCCTGGGGCATCAGGAGGG + Intergenic
1068216552 10:53989709-53989731 CTCACCCAGGAGCATGAGGAGGG - Intronic
1070141394 10:73740865-73740887 TGCTCCCTGGGGCATCAGGAGGG + Intergenic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070887103 10:79911156-79911178 CTCACCCAGGAGCATGAGGAGGG - Intergenic
1071504364 10:86223677-86223699 CACTCCCATGGGCTTGAGGGAGG - Intronic
1071610461 10:87027119-87027141 TGCTCCCTGGGGCATCAGGAGGG - Intergenic
1071793962 10:88985746-88985768 CCCTTCCAGGCCCATGAGGAGGG + Intronic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1074274661 10:111989863-111989885 CTCTCCCATGCCCACGAGGATGG + Intergenic
1074813939 10:117130941-117130963 CTCTCCCAGGGGCCTCAGCCTGG - Intronic
1075464033 10:122638068-122638090 CACTCCCAGGCAAATGAGGACGG + Intronic
1076407517 10:130222555-130222577 CTCTGCCAGGGGCAAGGGTAGGG + Intergenic
1076567436 10:131408427-131408449 TGCTCCCAGGGGCATCAGGGTGG + Intergenic
1076587264 10:131558043-131558065 CTCTCTCAGAGGCCTGAGGCAGG - Intergenic
1077033074 11:478955-478977 CTCTCCCAGGGGCCTGTGAAGGG + Intronic
1079675464 11:23220982-23221004 CTCTGCCAGGGGCTTGAAGTTGG + Intergenic
1080833607 11:35919233-35919255 CTCTGCCAGGGGAAAGATGATGG - Intergenic
1081099680 11:38986528-38986550 TTCTTCCTGGGGCCTGAGGATGG - Intergenic
1081105924 11:39069057-39069079 CACTCCCAGGGGCATAAGGATGG + Intergenic
1082811789 11:57482908-57482930 CACTCCCCGGGGCTTGGGGAGGG - Intergenic
1084122374 11:67077286-67077308 CTCTGCCAGGGTGAGGAGGATGG - Intergenic
1084481711 11:69425070-69425092 GTTTCCCAGGAGCAGGAGGAGGG + Intergenic
1085509711 11:77082114-77082136 CTGTCCCAGGGGCACCAGGATGG + Intronic
1085574468 11:77589883-77589905 CGCCCCGAGGGGCGTGAGGAGGG + Exonic
1086143556 11:83525642-83525664 CACTCCAGGGGGCATCAGGAAGG - Intronic
1089685246 11:120142406-120142428 CTTGCCCAGGGGCAAGGGGATGG - Intronic
1089692303 11:120194376-120194398 ACCTCCCAGGGGCAGGAGCAGGG - Intergenic
1089747712 11:120628672-120628694 AGCTCCTAGGGGCCTGAGGAAGG + Intronic
1090726806 11:129534671-129534693 CACTGCCTGGGGCATGAGGTGGG + Intergenic
1090760127 11:129829324-129829346 CTCACACATGGGCCTGAGGAAGG - Intronic
1091255693 11:134183062-134183084 CTGGCCCAGGGCCATTAGGACGG - Intronic
1094632029 12:32185108-32185130 CTCTACCAGTGGCTTGAAGATGG - Intronic
1094832779 12:34308094-34308116 CTATACCAGGGGCATGATGTAGG - Intergenic
1095802387 12:46282064-46282086 ACATCCCAGGGGCCTGAGGATGG + Intergenic
1095941933 12:47733067-47733089 CTCTCCAAGGGCCAAGAGCAAGG + Intergenic
1095965160 12:47862766-47862788 CTCTCCCAGGGTTCTGAGGCCGG + Intronic
1096705613 12:53420027-53420049 TCCTACTAGGGGCATGAGGAAGG - Intergenic
1096757057 12:53808478-53808500 CCCTCTCAGTGGGATGAGGAAGG - Intergenic
1100682909 12:96948406-96948428 CTCTGTCAAGGGCATGAAGATGG + Intronic
1101777361 12:107806633-107806655 CCTTCCCATGGGCATGTGGAGGG - Intergenic
1102347890 12:112171175-112171197 CTCCACCAGGGGCAGGAAGAAGG + Exonic
1102867163 12:116383476-116383498 TTCTCCCAGGGGAAAGAGAAAGG - Intergenic
1103001874 12:117391024-117391046 GTCTGCCAGGGACATGAGAAGGG - Intronic
1104618413 12:130290605-130290627 CCCTACCAGGGGCAAGAAGAGGG + Intergenic
1108284315 13:48891019-48891041 CACTCACAGTGGCAAGAGGAGGG + Intergenic
1113537017 13:111076190-111076212 CTCTTCCCAGGGCCTGAGGATGG - Intergenic
1113784592 13:112995780-112995802 CTCTCCCTGTGGCATGAGAAGGG + Intronic
1114473514 14:22979496-22979518 CCCTACTAGGGGCAGGAGGAGGG + Intronic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114714617 14:24811736-24811758 CTCTCCCAAGGACATTATGAAGG + Exonic
1118320288 14:64748784-64748806 GCCCCCTAGGGGCATGAGGAAGG - Exonic
1118468082 14:66049522-66049544 CACTCCCATGGGCATTAGGAAGG + Intergenic
1118468411 14:66052849-66052871 CACTCCCATGGGCATTAGCAGGG + Intergenic
1119140678 14:72264753-72264775 CTCTCCCAGGGACATTGAGAGGG + Intronic
1119825401 14:77653650-77653672 CTCCCCCAGTGGCAGGAGGAAGG + Intergenic
1120234642 14:81876351-81876373 CTCTGCTAGGACCATGAGGATGG + Intergenic
1121841995 14:97142334-97142356 CTCTCCCAGGACCCTGAGGTTGG + Intergenic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122806401 14:104262087-104262109 ATCTCCAAGGGGCACGAAGAAGG + Intergenic
1122909427 14:104819811-104819833 CCCTCCCAGGGCCCTGAGAAAGG - Intergenic
1123038252 14:105480023-105480045 CTCTGCCAGGGACATGGTGAGGG - Intronic
1123103038 14:105818644-105818666 GCCTCCCAGGGGCCTGTGGATGG + Intergenic
1124258338 15:28164135-28164157 CTCTGCCTGGGGAATGAGAAGGG - Intronic
1124382399 15:29177709-29177731 CACTCTCAGGGGCCAGAGGAAGG + Intronic
1125718809 15:41835407-41835429 CCCTCCCTGGGGCAGAAGGAAGG - Intronic
1125883177 15:43210475-43210497 CCCACACAGGGCCATGAGGAAGG + Intronic
1125987936 15:44073725-44073747 CTCTCCTGGGGCCATAAGGAGGG + Intronic
1126578683 15:50222250-50222272 CTGTCCCAGTGGGATGGGGAGGG - Intronic
1126705352 15:51400699-51400721 AGGTCACAGGGGCATGAGGAGGG + Intronic
1128560855 15:68666926-68666948 CTCACCCAAGGGCATGCGGCAGG - Intronic
1129394708 15:75237539-75237561 GGCTCCCTGGGGCAGGAGGAGGG + Intergenic
1129485477 15:75867106-75867128 CTCTTCCTATGGCATGAGGATGG + Intronic
1130265553 15:82398994-82399016 CTCTTCCTGTGGCATGAGGGTGG + Intergenic
1130506457 15:84547899-84547921 CTCTTCCTGTGGCATGAGGGTGG - Intergenic
1131070471 15:89462531-89462553 CTCTCCCAGGGAGGTGAGGCAGG + Intergenic
1131558282 15:93418021-93418043 CCCTCCCAGGGGCAGAAGGAAGG + Intergenic
1132715455 16:1287985-1288007 CAAGCCCAGGGGCATGGGGAAGG + Intergenic
1132826369 16:1907560-1907582 CTCTGCCCGGGGCATGGGGCTGG - Intergenic
1132854490 16:2038722-2038744 CTCTCCGAGGGGCCTGAGGATGG + Exonic
1133322574 16:4923420-4923442 CTCTCCTGGGGGCAGGAGGCCGG - Intronic
1134031847 16:10998394-10998416 ATCTCCCAGGTGCCTGAGGCTGG - Intronic
1135136127 16:19886074-19886096 CTCTCCCGGGGGCTGCAGGAAGG + Intronic
1136251687 16:29009537-29009559 ATGTCCCAGGGCCAGGAGGAGGG - Intergenic
1136568894 16:31085197-31085219 GCCTCCCAGGGCCATGGGGAGGG + Exonic
1136617676 16:31408596-31408618 CTCTCCCTGGCGATTGAGGATGG - Intronic
1137270483 16:46899657-46899679 CTCTGCCAGGGAAATGAGGTGGG + Intronic
1137311439 16:47263414-47263436 CTCTACCATGTGCAGGAGGATGG + Intronic
1137532402 16:49287699-49287721 AGCTTCCAGGGGCAAGAGGAGGG - Intergenic
1138204673 16:55115786-55115808 CTCCACCAAGGCCATGAGGAAGG + Intergenic
1138303653 16:55955115-55955137 CTCTCCCTGGGGCAGAAGGAAGG - Intronic
1139282952 16:65785481-65785503 CTTTCCATGGGGCCTGAGGAAGG + Intergenic
1139956714 16:70696790-70696812 TTCTCCCAGGGGCAGGAGCTGGG + Intronic
1140326115 16:74005180-74005202 TCCTCCCAGGGGCCTGTGGATGG - Intergenic
1140459900 16:75131209-75131231 CACCCTCAGGAGCATGAGGAGGG + Intergenic
1141635895 16:85313584-85313606 CTGTCCCAGGGGCACTAGCAGGG - Intergenic
1143448254 17:7021308-7021330 CTCTCCCTTTGGCATCAGGATGG - Intergenic
1143461595 17:7107949-7107971 GTCCCCCAGCAGCATGAGGACGG - Intronic
1143495881 17:7312339-7312361 CCCTCCCAGATGCCTGAGGAGGG - Exonic
1143705257 17:8693300-8693322 CACTCCCAGGGGCAAGAAGCAGG - Intergenic
1144810369 17:17994922-17994944 ATCTCACAGGCCCATGAGGAAGG - Intronic
1145941362 17:28744858-28744880 CTCTCCCGGGGGCTGGAGTAAGG + Intronic
1146636992 17:34513815-34513837 CCCTTCCAGAGGCAGGAGGAAGG + Intergenic
1146750506 17:35374044-35374066 CTCTCCGAGGGGTATCTGGAAGG - Intergenic
1147252443 17:39161135-39161157 CTATACCAGCAGCATGAGGAGGG - Intronic
1147744856 17:42688803-42688825 CTCCCCCAGGGACATGCTGAGGG - Intronic
1148062847 17:44848537-44848559 CTCTACCAGGGCCATAAGGAAGG - Intronic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148496227 17:48054886-48054908 AGCTCCGAGGGGCCTGAGGAGGG - Intronic
1148541824 17:48487047-48487069 CTCTCCCAGGTGCATGGAGTGGG + Intergenic
1148640776 17:49185595-49185617 CTCTGCGAGGGGAGTGAGGAAGG + Intergenic
1148722033 17:49760765-49760787 CTCTTCCAGGACCATGATGAAGG - Intronic
1150210059 17:63436905-63436927 CTCCCCCTGGGGCAGGAGCAAGG - Intronic
1150410728 17:64938886-64938908 CTCCCCCAGGGGCAGGCAGAAGG - Intergenic
1151559703 17:74863731-74863753 TTCTCTCAGGGCCAAGAGGAGGG + Intronic
1152026927 17:77815931-77815953 CATTCACAGGGGCAGGAGGAAGG - Intergenic
1152075835 17:78159020-78159042 CTCTCCCAGATGCCTGAGGAGGG - Intronic
1152135652 17:78501707-78501729 CTGTCCCAGGGGCCAGGGGAAGG - Intronic
1152465687 17:80464798-80464820 CTCTCTCAGGGCCGTGAAGATGG - Intergenic
1152569716 17:81116369-81116391 CCCACCGAGGGGCATGGGGAGGG - Exonic
1153056260 18:949585-949607 TCCTCCCAGGGGTCTGAGGATGG - Intergenic
1154490435 18:14917888-14917910 CTCCCCCAGGGCGATGAGCAAGG + Intergenic
1155588915 18:27402062-27402084 CTATGCCAAGGGCATGAGGCAGG - Intergenic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1157394124 18:47327586-47327608 CCCTCCCAGGGGGACCAGGAAGG - Intergenic
1157595657 18:48862189-48862211 CCCTCTCTGTGGCATGAGGAAGG + Intronic
1158735656 18:60075758-60075780 TCCTCCCAGGGGCCTGGGGATGG + Intergenic
1159028217 18:63206139-63206161 CTCTCCCAGGGGGATGTGCTCGG + Intronic
1160025224 18:75210880-75210902 CTCTCCCAGGAGTTTGAGGGGGG + Exonic
1160837496 19:1131723-1131745 CTACCCCAGGGGCAGAAGGAGGG + Intronic
1162584519 19:11550986-11551008 CTCTCCCAGAGGCTTGTGGATGG + Intergenic
1162877303 19:13630188-13630210 CTGTCCCAGGAGGAAGAGGAGGG + Intergenic
1163768541 19:19177056-19177078 TTCTACCAGGAGCATCAGGAAGG - Exonic
1165974762 19:39665995-39666017 CTCTGCTAGGGCCATGTGGAAGG - Intergenic
1166202706 19:41248855-41248877 CTGTCTCAGGGGCATAGGGAAGG - Intronic
1166750693 19:45162782-45162804 CTCTGCCAGGAGCACGGGGAGGG + Intronic
1167266590 19:48485777-48485799 TTCTCCACGGGGCCTGAGGATGG + Exonic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
1168015048 19:53566175-53566197 CTCTCCCAGGGGCATCACACCGG + Intronic
1168122287 19:54258442-54258464 CTGTCCCAGGGTCATTAGGGAGG + Intronic
925007840 2:458608-458630 CTCTCCCAGGGGCTGGGGGGAGG + Intergenic
927872331 2:26631555-26631577 CTCTCCCAGAGCCCTGACGATGG + Intronic
927970183 2:27300944-27300966 CTCTAACAGAGGCAGGAGGATGG - Intronic
928087728 2:28356283-28356305 TCCTGCCAGGGGCGTGAGGAAGG + Intergenic
929258353 2:39838634-39838656 CTCCCCCAAGGGCCTGAGGTTGG - Intergenic
929297959 2:40270097-40270119 CTATCCCTGAGGCATAAGGAAGG + Intronic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
934129283 2:88931900-88931922 CTCTCCCAGAGGGATGGGCAGGG + Intergenic
934615026 2:95765275-95765297 CGTTCCCAGGGGCAAGAGCAAGG + Intergenic
934645875 2:96059211-96059233 CGTTCCCAGGGGCAAGAGCAAGG - Intergenic
934839278 2:97615301-97615323 CGTTCCCAGGGGCAAGAGCAAGG - Intergenic
935584720 2:104790375-104790397 CTCTCCTGGGGGCAGGAGGAGGG - Intergenic
936071389 2:109374069-109374091 CTCCCTCAGGGCCATGAGGAGGG + Intronic
936268981 2:111033853-111033875 CCCTTCCTGGGACATGAGGATGG + Intronic
937257284 2:120564516-120564538 CCCTCCCTGTGGCAGGAGGATGG + Intergenic
938062755 2:128265809-128265831 CCCTCCCAGGGCTGTGAGGACGG - Exonic
938976184 2:136480718-136480740 CCCTCCCAGGGGCATGTGGGAGG + Intergenic
939882455 2:147645840-147645862 CTGTCCCAGGGGTGTGAGGGAGG + Intergenic
940121509 2:150272635-150272657 CTCTCCCAGAGGCCTGAGAGAGG + Intergenic
942665407 2:178311809-178311831 CACTCTCAGGAGCAAGAGGAAGG - Intronic
943491649 2:188561496-188561518 ACCTCCCAGAGGCATGAGGTTGG - Intronic
944368808 2:198956596-198956618 CTCTTCCAGGAGCCTTAGGAGGG - Intergenic
944666703 2:201965011-201965033 TTGTCCCAGGGGCATTGGGAGGG - Intergenic
944668014 2:201972789-201972811 ACCTCCCAGGGGCCAGAGGAGGG - Intergenic
944675190 2:202029560-202029582 CTCTCCCAGGGACATGTGTTTGG + Intergenic
945073832 2:206016965-206016987 CTTTCCCAGAGGCATGAAAACGG + Intronic
945520585 2:210822420-210822442 CTGTCAGAGGGGCATGGGGAGGG + Intergenic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946399097 2:219459507-219459529 CTCTCCAAGGGGCTTGAGGATGG + Intronic
946632672 2:221687679-221687701 CTGTCTCTGGGGGATGAGGAAGG + Intergenic
947043430 2:225949856-225949878 CCCTCCCAAGGGCCTGAGCATGG + Intergenic
947501504 2:230674525-230674547 TTCTCCCAGAGGCCTGAGTAGGG - Intergenic
947543093 2:230991781-230991803 CCCTGCCAGGGGCAGCAGGAGGG + Intergenic
947961133 2:234238409-234238431 CTCTCACAAGGGCAAGAAGAGGG + Intergenic
948056026 2:235009907-235009929 CTTTCCCAGGAGCAAGAGGAAGG - Intronic
948283977 2:236769791-236769813 CTCTCCCAGGGCAATGGGCAGGG + Intergenic
949066058 2:241990936-241990958 CTCTCTCTGTGGCTTGAGGATGG + Intergenic
1171445994 20:25205397-25205419 CTGTGCCAGGGGCCTGAGGCAGG + Intronic
1171846810 20:30282406-30282428 CTCTGCCTGGGTCATGAGGCCGG + Intergenic
1171847498 20:30285923-30285945 CTCTGCCTGGGTCATGAGGCCGG - Intergenic
1172280361 20:33703606-33703628 CACTGGTAGGGGCATGAGGAAGG + Exonic
1172766947 20:37356088-37356110 CTCTCCCTGGGGCAAAAGGTAGG + Intronic
1173595572 20:44256973-44256995 ATCTCCCAGGGGCATGTGCCTGG - Intronic
1173980429 20:47219914-47219936 CTCTCTCAGGGAAATGAGAACGG - Intronic
1174304078 20:49602909-49602931 CCTTCCTAGGGCCATGAGGAAGG - Intergenic
1174336362 20:49864177-49864199 CTTTCACAGGGGCATGAGTTTGG + Intronic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174900032 20:54489805-54489827 CTCTCCAATGGGTATGATGAGGG - Intronic
1175785371 20:61708585-61708607 GTCTACAAGGGGCATGAGGCTGG - Intronic
1175891676 20:62318535-62318557 CTCTCGCAGGTCCATGAGGCCGG + Exonic
1176656416 21:9592187-9592209 CTCTGCCTGGGTCATGAGGCCGG - Intergenic
1178662627 21:34520356-34520378 CTGGCCCGGGGGCATGAGCATGG - Intronic
1178701174 21:34834999-34835021 GCCTCCCAGGGGCATCAGAACGG + Intronic
1178899685 21:36589015-36589037 ATCTCACAGGGGCAGGAGGCAGG - Intergenic
1179655918 21:42844718-42844740 CTCTCCCTGGGGCAGGAGGGAGG + Intronic
1179930493 21:44568209-44568231 ATCCCCCAGGAGCAGGAGGAGGG - Intronic
1179988017 21:44932005-44932027 CGCTCCCCTGGGCACGAGGATGG + Intergenic
1181878276 22:25957024-25957046 CTCTCCCAGGGCCATGGGTGTGG - Intronic
1182483677 22:30626575-30626597 CTGTTCCAGGGACATCAGGAGGG - Exonic
1183163808 22:36132490-36132512 TGCTCCCACGGGGATGAGGAGGG + Intergenic
1183255051 22:36756678-36756700 CTCTACTAGGGCCATGGGGAAGG + Intergenic
1184116008 22:42422721-42422743 CCCTCAAAGGGGCATCAGGATGG + Intronic
1184884691 22:47335610-47335632 CTGTCTCAGGGGCGTGAGGCAGG + Intergenic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
1185199553 22:49493376-49493398 TTCCCGCAGGGGCAGGAGGAAGG + Intronic
950329386 3:12144375-12144397 CTCTCCTGGGGGCCTGATGAGGG + Intronic
950492598 3:13315003-13315025 CAATGGCAGGGGCATGAGGAGGG + Intergenic
950493093 3:13318050-13318072 CTGTCCAGGGGGCATGAGGCAGG + Intronic
952717039 3:36490263-36490285 CTTTCTCAGGGGAGTGAGGAGGG + Intronic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
953392861 3:42543896-42543918 TGCTCCCTGGGGCATGAGAAAGG - Intergenic
954744723 3:52780684-52780706 CTCTCCCATGGGCGTGAGGCGGG - Intronic
954797346 3:53168294-53168316 CTGTCCCAGGGACACGAAGAAGG + Intronic
956885674 3:73556951-73556973 CAGTCCCAGGGGCATGTGGGAGG - Intronic
958640075 3:96794673-96794695 TTCTCCCAGAGGCCTGAGGTTGG - Intergenic
959229206 3:103625926-103625948 CCTTCCCAGGGATATGAGGATGG - Intergenic
959586963 3:108034001-108034023 GGCTCCCAGCTGCATGAGGAGGG - Intergenic
959878830 3:111419135-111419157 CTGTCCCAGGTGCATTGGGAAGG + Intronic
961445499 3:126979122-126979144 CTGCCCCAGGGGCAGGAGCATGG + Intergenic
961476494 3:127150076-127150098 CTTGCCCAGGGGCAGGAGGGTGG + Intergenic
962240529 3:133747435-133747457 CTCTCCAGGATGCATGAGGAGGG - Intronic
963062573 3:141236302-141236324 CACACCCAGGGGCATAAGGGTGG - Intronic
963122698 3:141789538-141789560 CTGTCCCAGGAGCCAGAGGAAGG + Intronic
968044646 3:195617219-195617241 CTCTCCCCAGGGCATCAGGATGG - Intergenic
968047454 3:195632054-195632076 CTGACCCAGGGGCAGGAGGTGGG + Intergenic
968060434 3:195723270-195723292 CTCTCCCCAGGGCATCAGGATGG - Intronic
968088530 3:195885536-195885558 CTCTCCCCTGGGCAGGATGAAGG - Intronic
968307159 3:197657870-197657892 CTGACCCAGGGGCAGGAGGTGGG - Intergenic
968753431 4:2402100-2402122 CTCTCCCTGGCGCTGGAGGAGGG + Intronic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
973230867 4:47837633-47837655 CCCTCCCAGGGTCATGGGCAGGG - Intronic
975169373 4:71215508-71215530 CTTTCCCAGGTTCATAAGGAGGG + Intronic
975543888 4:75542024-75542046 ATGTCCCAGGGGGATGATGAAGG - Intronic
980159270 4:129139460-129139482 CTCTCCCAGGGGGCTTAGTATGG - Intergenic
981038327 4:140195381-140195403 CTGTACCAGGGACAGGAGGAGGG + Intergenic
981113157 4:140958786-140958808 CTCATCCAGGGGCATGATCAGGG + Intronic
981246530 4:142547146-142547168 CTTTCCCATGGCAATGAGGATGG + Intronic
981557405 4:146009794-146009816 CTCTCCCAAGGGCCTAAGGATGG - Intergenic
983457764 4:167986007-167986029 CCCTCCTAGGGGCCTGAGGATGG - Intergenic
983705591 4:170654659-170654681 CTATCCCTGGGGCATGGGGATGG - Intergenic
984845820 4:184107066-184107088 CTCCCCCAGGGGCCTGGGGCAGG - Intronic
985666006 5:1181811-1181833 CTCTCCCAAGGCCATGGGGTGGG - Intergenic
985967359 5:3347881-3347903 CTCTCCCAGGGGATAGAGGCTGG - Intergenic
986956548 5:13157895-13157917 GGCTCCCTGGGGAATGAGGAAGG - Intergenic
987509298 5:18815186-18815208 CTCTCCTAGGGCAATGAAGAAGG - Intergenic
987621171 5:20339658-20339680 CTTTTCTAGGGGCATGAGTAAGG - Intronic
989421090 5:41240611-41240633 TCCTCCCAGGGGCCTGAAGATGG - Intronic
989656751 5:43753322-43753344 CTCTGCCAGGGCAGTGAGGAAGG - Intergenic
990400220 5:55430035-55430057 TCCTCCCAGGGGCCTCAGGAAGG + Intronic
990698028 5:58444254-58444276 TTCCCCCAGGAGCATGATGAAGG + Intergenic
992733658 5:79697280-79697302 AACTCCCAGGGGAATGAGCAAGG - Intronic
993431733 5:87841040-87841062 TTCTCCCAAGGGCCTGAGGATGG - Intergenic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
996183872 5:120452682-120452704 TTCTCACTGGGGCATGAGGAGGG - Intergenic
996513166 5:124340458-124340480 CTCTCCCAGTGCCACAAGGATGG + Intergenic
996683763 5:126257355-126257377 ACCTTCCAGGGGCCTGAGGATGG + Intergenic
997236531 5:132275217-132275239 CTCTTCCAGGGCCCTCAGGATGG + Intronic
997739742 5:136243134-136243156 CTGTCCCAAGGGGAAGAGGAAGG - Intronic
998002528 5:138636299-138636321 CTCACCCAGGTGTATGAGAATGG - Intronic
998312926 5:141152573-141152595 CTCTCTCAGTGCCCTGAGGAGGG - Exonic
1000032380 5:157414545-157414567 CTATCCCAGGGGGCTGAGGCAGG + Intronic
1001219597 5:169888848-169888870 CTATCCCAAGGGAAAGAGGAGGG - Intronic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1001297105 5:170505765-170505787 AGCTCCCAGGGGCATCAGGCTGG + Intronic
1002002936 5:176208288-176208310 CTCTACCAGGGCAGTGAGGAGGG - Intergenic
1002092078 5:176811587-176811609 CCCTCCCAAGGGAATGAGGTGGG - Intronic
1002223573 5:177702965-177702987 CTCTACCAGGGCAGTGAGGAGGG + Intergenic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1002534601 5:179869363-179869385 CTGTCACATGGCCATGAGGAGGG - Intronic
1002875324 6:1204701-1204723 CTGTCCCAGGAGTCTGAGGAGGG + Intergenic
1003293812 6:4805999-4806021 CTGGCGCAGGAGCATGAGGAAGG + Intronic
1003330372 6:5124041-5124063 CTCTCCCAGGGCCGTGGAGAGGG + Intronic
1003563640 6:7204153-7204175 CTCTCCCAGGGTGTGGAGGAAGG - Intronic
1005339686 6:24831551-24831573 GTCTCTGAGGGGCATGAAGAGGG - Intronic
1005896890 6:30186120-30186142 CTCTCCCTGCGGCCAGAGGATGG - Exonic
1006114388 6:31767490-31767512 GTCTCCCAGGGCCAGGAGGAAGG - Exonic
1007829607 6:44628371-44628393 CTCTGACAGGGGCTGGAGGAAGG + Intergenic
1008547283 6:52594371-52594393 CTCTCCAAGGGGCATGGGGGAGG + Intergenic
1009733001 6:67634452-67634474 CTCTACTAGGGCCATGTGGAGGG + Intergenic
1009900991 6:69807747-69807769 CTCTGCTAGGGGAATGCGGAAGG - Intergenic
1010631796 6:78207442-78207464 CTCTGCTAGGGCAATGAGGAAGG - Intergenic
1011117117 6:83905935-83905957 TCCTCCCAGGGGCCTGAGGTTGG - Intronic
1014724308 6:124956378-124956400 TTCTCCTGGGGGCTTGAGGATGG + Intergenic
1016387435 6:143542218-143542240 CTCTCCCTGGGGGAGAAGGAAGG - Intronic
1017029280 6:150206620-150206642 TTCTACACGGGGCATGAGGATGG + Intronic
1017231378 6:152077392-152077414 CTCTGCTAGGGCAATGAGGAAGG + Intronic
1017740348 6:157400766-157400788 TACTGCCAGGGGCATCAGGAAGG - Intronic
1018422753 6:163653461-163653483 TTCTCCCTGGGGCAAGAAGAAGG - Intergenic
1019624825 7:2010817-2010839 CTTCCCCAGGGGCATGCGCAGGG + Intronic
1019760916 7:2811999-2812021 CTTTCCCAGGGGCAGTGGGAAGG + Intronic
1019918409 7:4148053-4148075 CTCTCCCTGAGCCACGAGGATGG - Intronic
1019971964 7:4548652-4548674 CTTTCCCAGGAGCGAGAGGATGG - Intergenic
1020140671 7:5609777-5609799 CTCTCCCACAGTCACGAGGATGG + Intergenic
1020673963 7:11156933-11156955 CTCACCTTTGGGCATGAGGAAGG + Intronic
1020763185 7:12292035-12292057 CTGTCCCAGAGCCATAAGGATGG - Intergenic
1020936623 7:14473471-14473493 CTCTGCTAGGGCAATGAGGAAGG + Intronic
1022216930 7:28272551-28272573 CTCCCCCAGAGGAAGGAGGAAGG - Intergenic
1023043846 7:36194971-36194993 CTCTGTCTGGGGCATTAGGAAGG - Intronic
1023965883 7:44962890-44962912 CCCTCCCTGCGGCAGGAGGAGGG + Exonic
1024713115 7:52040242-52040264 CTCCACCAGGGGAATGAGGAGGG - Intergenic
1025295156 7:57770830-57770852 CTCTGCCTGGGTCATGAGGCTGG + Intergenic
1029061848 7:97806478-97806500 TCCTCCCAGGAGCCTGAGGATGG + Intergenic
1029853562 7:103489958-103489980 CTCTCCCAGAGGCTGGAGGCAGG - Intronic
1030898910 7:115097266-115097288 CTCTCTCAGGAGGATCAGGACGG - Intergenic
1031976722 7:128098593-128098615 CTCTTCCAGGGAGGTGAGGAAGG + Intergenic
1032092591 7:128918546-128918568 CTCTGACAGAGGCATGAAGAGGG - Intergenic
1032169973 7:129576586-129576608 GACTGCCAGGGGCTTGAGGAAGG + Intergenic
1033305027 7:140218928-140218950 CTCACCCAGTGGCATGGGGTAGG + Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034469263 7:151246923-151246945 CTCACCCCCAGGCATGAGGAGGG + Intronic
1034557561 7:151859743-151859765 CTCTCACTGGGACAAGAGGATGG - Intronic
1036712002 8:11085740-11085762 CTGTCCCAGGGCCATGCTGACGG - Intronic
1037319998 8:17632809-17632831 CTCACCCAGGGCCATGAACATGG + Intronic
1037344828 8:17887327-17887349 CTCTCCCAGGTGCATGAAGGAGG - Intronic
1037600561 8:20390422-20390444 GTCACCCAGTGCCATGAGGAAGG - Intergenic
1037767895 8:21783040-21783062 TTCTCCCTGGGGTATGAGGAGGG - Intronic
1039387131 8:37146036-37146058 CTCTCCCAGGGGCTTGTCCATGG - Intergenic
1039442741 8:37606621-37606643 CTTTCCCACGGCCTTGAGGATGG - Intergenic
1039968450 8:42300667-42300689 CTTTCCCTGGCTCATGAGGAAGG - Intronic
1039983511 8:42428712-42428734 CTGTCCCAGCGGCCTGGGGAAGG + Intronic
1040280473 8:46039473-46039495 CCCTCCCAGGTGCACGGGGATGG - Intergenic
1040349647 8:46551437-46551459 TCCTCCCAGGAGCCTGAGGATGG + Intergenic
1040368733 8:46747093-46747115 TACTCCCAGGAGCCTGAGGATGG - Intergenic
1041663515 8:60421333-60421355 CACTGCCAGGGTCATGAGAAAGG - Intergenic
1041728663 8:61043055-61043077 CTCTAACAGGGACATGATGATGG - Intergenic
1041782821 8:61596226-61596248 GCCTTCCAGGGGCCTGAGGATGG + Intronic
1042382942 8:68139634-68139656 CTCTCCCAGGTGGGAGAGGATGG + Intronic
1043238516 8:77900033-77900055 CTCACCCAGGTCCATGGGGATGG + Intergenic
1044233970 8:89809190-89809212 CTCTGCCAGGGCAGTGAGGAAGG + Intergenic
1046384053 8:113486249-113486271 CTCTCCCTGTGGAAAGAGGAGGG - Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048435611 8:134414158-134414180 CTCTCCCAAAGGCATCAAGAAGG - Intergenic
1048516957 8:135120037-135120059 CTTCCTCAGGGGCATTAGGAAGG + Intergenic
1048576880 8:135699192-135699214 TTATCCCAGGGACATAAGGATGG - Intergenic
1049160788 8:141096248-141096270 AAGTCCCAGGGGCAGGAGGAGGG + Intergenic
1049228659 8:141470700-141470722 CTCTCCCAGGCCCATTCGGACGG - Intergenic
1049263509 8:141652678-141652700 CTCTCCCGGGACCCTGAGGAGGG - Intergenic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049325305 8:142018378-142018400 CTGTCCCAAGGGCCTGAGCATGG - Intergenic
1049639381 8:143707745-143707767 CTCTACCACGGGCGCGAGGACGG - Exonic
1049728161 8:144160894-144160916 CCTTCCCAGGGGCACCAGGAAGG - Intronic
1050822077 9:9891221-9891243 CTTTCCCAGTGGTATGGGGATGG + Intronic
1051151492 9:14084655-14084677 GTCACCCAAGGGCATGAGTAGGG - Intronic
1051508276 9:17848746-17848768 TTTTCCCAGGGGCTGGAGGAAGG - Intergenic
1052897694 9:33763222-33763244 CTCACACATGGGCCTGAGGAAGG - Intronic
1053219339 9:36298882-36298904 CTCTCCCTGGGGCGTTATGAAGG + Intronic
1053410251 9:37911620-37911642 CTCTCACAGGGGCAGAGGGAGGG + Intronic
1053438039 9:38090278-38090300 CTCTGCCTGGGGGATGGGGACGG + Intergenic
1053556484 9:39143274-39143296 GTCTACCAGAAGCATGAGGAAGG + Intronic
1053784512 9:41644645-41644667 CTCTGCCTGGGTCATGAGGCCGG + Intergenic
1053820596 9:41963573-41963595 GTCTACCAGAAGCATGAGGAAGG + Intronic
1054089461 9:60831701-60831723 GTCTACCAGAAGCATGAGGAAGG + Intergenic
1054110872 9:61107259-61107281 GTCTACCAGAAGCATGAGGAAGG + Intergenic
1054159827 9:61666034-61666056 CTCTGCCAGGGTCATGAGGCCGG + Intergenic
1054172469 9:61854784-61854806 CTCTACCTGGGTCATGAGGCCGG + Intronic
1054173239 9:61858578-61858600 CTCTGCCTGGGTCATGAGGCCGG + Intergenic
1054447324 9:65383795-65383817 CTCTGCCTGGGTCATGAGGCCGG + Intergenic
1054448096 9:65387656-65387678 CTCTGCCTGGGTCATGAGGCCGG + Intergenic
1054609985 9:67223866-67223888 GTCTACCAGAAGCATGAGGAAGG - Intergenic
1054664303 9:67722203-67722225 CTCTGCCTGGGTCATGAGGCCGG - Intergenic
1054665071 9:67726017-67726039 CTCTACCTGGGTCATGAGGCCGG - Intergenic
1054972011 9:71098928-71098950 CTCTCCCAGAGCCATCAGTATGG + Intronic
1056168029 9:83957119-83957141 CACTCCCTGGGGCTTGGGGAAGG - Intergenic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1060553966 9:124498946-124498968 TTCCTCCAGGGGCATGAGGCCGG - Intronic
1060826027 9:126688587-126688609 CTCTCCCGAGGGGCTGAGGAAGG - Intronic
1061640722 9:131952771-131952793 TTCCCCCAGGGGTAAGAGGAGGG - Intronic
1061779887 9:132989281-132989303 CACCCCCAGGGGCAGGGGGAGGG - Intronic
1061781286 9:132997609-132997631 TCCTCCCATGGGCATTAGGATGG - Intergenic
1062096715 9:134707467-134707489 CTCTCCCCGGGGCAGGAGTGGGG + Intronic
1062254241 9:135613637-135613659 CACACACAGGGGCAGGAGGATGG + Intergenic
1203634131 Un_KI270750v1:95669-95691 CTCTGCCTGGGTCATGAGGCCGG - Intergenic
1186140085 X:6562538-6562560 CTCTTCCAGAGGAATGAGAAAGG - Intergenic
1188247515 X:27853759-27853781 ATCTCCCCTGGGCCTGAGGAAGG + Intergenic
1189888701 X:45576956-45576978 ATCATCCAGGGGCATAAGGATGG - Intergenic
1189946664 X:46187377-46187399 CACTGCCAGGGGCATTAGAAAGG + Intergenic
1192157708 X:68758863-68758885 CACTCCCAGGGCCATGCAGAGGG - Intergenic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1193564119 X:83056378-83056400 CTCTACCAGGGCAATGTGGAGGG - Intergenic
1193584956 X:83310532-83310554 CACTGCCAGGGGCATGGGAAAGG - Intergenic
1193902884 X:87204204-87204226 TCCTACCAGGGGCCTGAGGATGG + Intergenic
1193970092 X:88039828-88039850 TTCTCCCAGGTGCCTGAGGATGG + Intergenic
1194543766 X:95206247-95206269 TTATCTCAGGGGCCTGAGGATGG + Intergenic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1197160545 X:123317875-123317897 CTCTGCCAGGGCAATGCGGAAGG - Intronic
1197753849 X:129981976-129981998 TTCTCCCAGGGGCCTGAGGGAGG - Intronic
1199399221 X:147377054-147377076 CTATCCTAGGGGCATGTGAAAGG + Intergenic
1200959348 Y:8982801-8982823 CTCTCCGAGGGCCATGACTAAGG - Intergenic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic