ID: 930763203

View in Genome Browser
Species Human (GRCh38)
Location 2:55058477-55058499
Sequence GCCTGAAAGTGGCTGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930763203_930763206 27 Left 930763203 2:55058477-55058499 CCAGCTACCAGCCACTTTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 150
Right 930763206 2:55058527-55058549 TTTTGTTGACGAAATTTTAGTGG 0: 1
1: 0
2: 1
3: 14
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930763203 Original CRISPR GCCTGAAAGTGGCTGGTAGC TGG (reversed) Intronic
902757008 1:18555682-18555704 GCCTGAACCTGGGTGGAAGCAGG - Intergenic
905371983 1:37487217-37487239 GCCTGAAAGAGGCAGGAAGTAGG + Intergenic
905404953 1:37726401-37726423 TCCTGAAACTGCCTGGCAGCTGG - Intronic
905888897 1:41507670-41507692 GCTTGGAAGTGACTGGGAGCAGG + Exonic
907425266 1:54375514-54375536 GTGTGAAAGTGGCTGGCAGCAGG - Intronic
907626118 1:56031592-56031614 GCCTTAAAGTGGGTGGCAGGGGG - Intergenic
908462384 1:64357699-64357721 GCCTGTTAGGGGCTGGTAGAGGG + Intergenic
910864956 1:91779923-91779945 ACCTGAAAGAGGCTGGGAACAGG - Intronic
911250946 1:95575652-95575674 CCCTGTAAGTGGCTGGTCCCTGG + Intergenic
912384808 1:109265984-109266006 GCCAGGAAGGGGCTGGTTGCAGG + Intronic
912681474 1:111731972-111731994 GACTGAACGTGGCTGGGAGTGGG - Intronic
915511382 1:156388682-156388704 GCCTGAAAAGGGCTGGCGGCCGG + Intergenic
915686520 1:157639855-157639877 GGCTGAAAGTGGCGGACAGCAGG + Intergenic
916563135 1:165950101-165950123 GCTTCAAAGTGACTGGCAGCTGG + Intergenic
917670559 1:177269724-177269746 GCCTGAAAGTGGACGGTGGAGGG + Intronic
919719538 1:200817923-200817945 GACAGAAATTGGCTGGAAGCAGG - Intronic
1063112207 10:3046981-3047003 GCCTGAAAGTCCCTGGGATCTGG - Intergenic
1066325002 10:34350306-34350328 GCCTGCAAGGGGGTGATAGCAGG - Intronic
1070776618 10:79113488-79113510 GCCTGAATGTGACTGGTGCCTGG + Intronic
1071724722 10:88186528-88186550 GCATGAAAGTGCTTGGGAGCTGG + Intergenic
1072793325 10:98335361-98335383 CCCTGGAAGTGGCTGTGAGCTGG - Intergenic
1073055154 10:100695279-100695301 GCCTGGCAGTGGCTGCTGGCTGG - Intergenic
1074867733 10:117554524-117554546 GCCTGGAGCTGGCTGGGAGCAGG - Intergenic
1075443314 10:122496103-122496125 AGCTGAAAGTGGCTGGAGGCAGG + Intronic
1076528721 10:131130029-131130051 GCCTGAAAGTGGCATGTGTCAGG - Intronic
1080279887 11:30544881-30544903 GCATGAGAGTGGCCGGAAGCTGG + Intronic
1081689375 11:45066837-45066859 ACCTGAAAGTGGCCTGCAGCTGG - Intergenic
1085409073 11:76281067-76281089 GCCAGAACCTGGCTGGGAGCAGG - Intergenic
1086206988 11:84270480-84270502 ACCTTAAAGTGGCTGATACCTGG - Intronic
1095826060 12:46531301-46531323 CACTGAAGGTGGCTGGGAGCTGG + Intergenic
1096172100 12:49479644-49479666 GCCTGAAAGTGGGTGGCAGGGGG - Intronic
1101533123 12:105593043-105593065 GCCTGAGATTGGCTGGTAAGGGG + Intergenic
1102639583 12:114355241-114355263 GCGTGAATGTGGCTGGTTGATGG + Exonic
1104047668 12:125174489-125174511 GGCTGGAAGTGGGTGGTACCAGG + Intergenic
1105956367 13:25287122-25287144 GCCTGACTGGGGCTGGGAGCCGG - Intronic
1106928012 13:34633236-34633258 TCCTGGAAGTGAGTGGTAGCAGG - Intergenic
1108945255 13:56014925-56014947 CAATGAAAGTGGCTGTTAGCAGG - Intergenic
1112990614 13:105509182-105509204 GCCTGGAAGTTGCTGGTTACGGG - Intergenic
1114568566 14:23649804-23649826 GCTTGGAAGTGTCTGGGAGCTGG + Intergenic
1116126499 14:40795360-40795382 GTCTGAAAATGGCTTGTAGGAGG + Intergenic
1121693944 14:95897476-95897498 GCCTGAAAGTAGCAGGTGGGTGG - Intergenic
1122383170 14:101324707-101324729 TCCTGGAAGTGGATGGTAACAGG - Intergenic
1122629424 14:103100502-103100524 GCCTGGGAATGGCCGGTAGCTGG - Exonic
1123782957 15:23645350-23645372 GGCTGAAACTGGGAGGTAGCTGG + Exonic
1127150975 15:56075129-56075151 GCCTGCCAGTGGCTGGTGGGAGG + Intergenic
1132977719 16:2718992-2719014 GCCTGTGATTCGCTGGTAGCTGG + Intronic
1133107853 16:3525321-3525343 GCCTCAGAGTGGCAGGTAGGTGG + Intronic
1133745873 16:8686313-8686335 TCCTGCAAGGGGCTGGAAGCAGG + Intronic
1134227844 16:12405432-12405454 GCCTGAGGCTGGCTGGAAGCAGG - Intronic
1137725990 16:50657075-50657097 GCCTCCAAGTAGCTGGTAGCTGG - Intergenic
1137804330 16:51289084-51289106 GCTTGAGAGTGGCTTGTGGCAGG - Intergenic
1139563671 16:67759451-67759473 GCCTGACTGAGGCTGGTAGGGGG - Intronic
1139939934 16:70597957-70597979 CCCTCCAAGTAGCTGGTAGCTGG + Intronic
1140389299 16:74571528-74571550 TCCTGAAAGTAGCTGGCACCTGG - Intronic
1143649581 17:8255264-8255286 GCCTGAAAGTACCTGGTTGAGGG + Intronic
1145366173 17:22268559-22268581 TCCTGAAAGAGGCTGTTTGCAGG - Intergenic
1145831636 17:27921123-27921145 GCCTGGAAGTGACTGGAAGGTGG - Intergenic
1147587985 17:41663872-41663894 TCCAGAAAGTGGCTGGAAGAAGG + Intergenic
1148807446 17:50271112-50271134 GCCTGGAAGTGGGTGGTCCCAGG - Intergenic
1150429315 17:65102485-65102507 TCCTGAAAGCGGCTGGTGCCTGG - Intergenic
1151395344 17:73819506-73819528 GGCTGAAGGTGGCTGGGTGCTGG - Intergenic
1151682836 17:75630803-75630825 CCCTGAAAGAGGCTTCTAGCAGG - Exonic
1152389372 17:79993588-79993610 CCCTGAAAGTTGCAGGTAGTGGG - Intronic
1156970752 18:43151607-43151629 GCCTGAAAGTTTCTGTTAGTGGG - Intergenic
1161404164 19:4082444-4082466 CCCTGAGTGTGGCTGGTGGCTGG - Intergenic
1161455034 19:4365795-4365817 GCCTCAAAGGAGCTGGCAGCGGG + Intronic
1162803120 19:13121953-13121975 ACATGAAAGTGGCTGGAAGGCGG - Intronic
1165390109 19:35533877-35533899 GCCTGAAAGTGGCGGGAAGTGGG + Intronic
1167602932 19:50465072-50465094 GGGTGAAAGTGGCTGGCAGGAGG - Intronic
1167696332 19:51017467-51017489 GCGTGAAAGTGGAAGGAAGCTGG + Intronic
925235053 2:2270792-2270814 GCCTCAAACTGGCTGGGAGGGGG - Intronic
925349663 2:3191961-3191983 GCCTTCCACTGGCTGGTAGCAGG - Intronic
926090509 2:10045812-10045834 GCCAAAAAGTGGCTGGGAGGAGG - Intronic
930763203 2:55058477-55058499 GCCTGAAAGTGGCTGGTAGCTGG - Intronic
931750582 2:65326520-65326542 GCCTCAAACTGCCTGCTAGCTGG - Intronic
931878154 2:66537080-66537102 GCTTGAGAGTGTCTGTTAGCTGG + Intronic
931906217 2:66846516-66846538 GTTTGAAAGGGGCTGGGAGCAGG - Intergenic
936022194 2:109003270-109003292 GCCTGAAAGGAGCTGACAGCTGG - Intergenic
936254843 2:110902868-110902890 GCTTGTAAGTGCCTGGCAGCTGG - Intronic
938952547 2:136268573-136268595 GGCTGATAGTGGCTGTCAGCTGG - Intergenic
939387722 2:141522404-141522426 GCCTGAATGTGGCAGGAAGAAGG + Intronic
940875399 2:158892899-158892921 GTCTGGTAGTGGCTGGTACCAGG - Intergenic
942307722 2:174625083-174625105 CCCAGAAAGTGCCTGGTAACTGG - Intronic
942453988 2:176125229-176125251 GCCTGAAAGTGCCTGGCTTCTGG - Intergenic
947635914 2:231680819-231680841 GCCTGGCCGTGGCTGGTGGCTGG - Intergenic
1170763504 20:19272169-19272191 GCCTGCAAGTGCCTGGCAGAGGG - Intronic
1172845034 20:37925177-37925199 GCCTGAAAATGTCAGGAAGCAGG - Intronic
1174887476 20:54351839-54351861 TCCCCAAAGTGTCTGGTAGCAGG + Intergenic
1174898608 20:54475731-54475753 CCCCGAAAGTGGCTGCAAGCCGG + Exonic
1178504126 21:33149444-33149466 GCCTGCGAGTGGCAGGTGGCAGG - Intergenic
1184042945 22:41955063-41955085 GCAGGAAAGTGGAAGGTAGCAGG - Intergenic
950128172 3:10523729-10523751 TCCTGGATGTGGCTGGTAGCAGG + Intronic
952738479 3:36713438-36713460 ACGTGAAAGAGGCTGGAAGCTGG - Exonic
953193871 3:40713914-40713936 GGCAGAAAGTGGCTGGGAGAAGG - Intergenic
958967529 3:100575792-100575814 CCCTGGAAGGGGCTAGTAGCAGG + Intronic
960569548 3:119172443-119172465 TCCTGAAAGGGGCTGATAACTGG - Intronic
960622266 3:119648307-119648329 GCAGGAAAGTTGGTGGTAGCTGG + Exonic
962444389 3:135451782-135451804 GGCTGAAAGTTTCTGGTAGGTGG - Intergenic
963918238 3:150880373-150880395 GCATGAAAGTGGATGGTACAAGG + Intronic
964170965 3:153768762-153768784 GCCTCAAAGAGCCTGGTTGCAGG + Intergenic
964519126 3:157544148-157544170 GCAGGAGAATGGCTGGTAGCGGG - Intronic
968502765 4:958780-958802 GCCTCAAAGGGGCTGGGAGTGGG - Intergenic
969053685 4:4388833-4388855 GCCGGGAAGAGGCTGGCAGCGGG + Intronic
970286592 4:14523721-14523743 GTTTGAAATTGGCTGGTACCAGG + Intergenic
970575932 4:17427825-17427847 GCATGAAACTGGATGGCAGCCGG - Intergenic
973826033 4:54708474-54708496 GCCAGTAAGTGACTGATAGCTGG - Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
978521939 4:109625240-109625262 GCCTGAGAGTAGCTGGGAGAAGG - Intronic
981400795 4:144311884-144311906 TCCTGAAGGTGGCAGGTAGTTGG + Intergenic
982329429 4:154164701-154164723 TCCTGGTAGTGGCTGGTATCTGG + Intergenic
982361635 4:154524950-154524972 GCCTGAAGGAGGCTGGATGCTGG + Intergenic
985126677 4:186701624-186701646 GTCTGCAAGTGGCTGAGAGCTGG - Intronic
986319051 5:6612949-6612971 GCCTTAGAGTGGGTGGTTGCTGG - Intronic
998177630 5:139911616-139911638 CCCTGGAAGAGGCTGGCAGCAGG - Intronic
1000247015 5:159456932-159456954 GACAGAAAGTGGCTGGTGGAAGG - Intergenic
1001050401 5:168409415-168409437 GCCTGCAGATGGCTAGTAGCTGG - Intronic
1003276986 6:4661546-4661568 GCCTGCATGTGGCTGGGAGCTGG - Intergenic
1004772462 6:18799378-18799400 CTCTGAAAGTGGCTGGCAGAGGG - Intergenic
1013743625 6:113318856-113318878 TCCTGAGAGTGGGTGGCAGCTGG + Intergenic
1016977512 6:149823711-149823733 GTTTGAAAGTGTCTGGTTGCCGG + Intronic
1020127931 7:5543411-5543433 GCCTGAAAGTGGCTCCGAGTAGG - Intronic
1020213069 7:6169885-6169907 GGCTGAGAGTGGCTGGGACCTGG - Intronic
1024715276 7:52072976-52072998 GCCTCTAAGAGGATGGTAGCTGG - Intergenic
1025719738 7:63999050-63999072 GGCTGAAAGTGGCTTGTAGCAGG + Intergenic
1029443968 7:100602837-100602859 TCCTGAACTTGCCTGGTAGCTGG + Intronic
1032127630 7:129206272-129206294 GCCCGAGAGAGGCTGGTAGGTGG - Exonic
1034461964 7:151203006-151203028 GCATGAAGGTGGCTCGAAGCCGG + Exonic
1035182023 7:157096487-157096509 GCCTGGAAGGGGATGGCAGCAGG + Intergenic
1035345134 7:158192576-158192598 GCATGCAAGGGGCTGGGAGCCGG + Intronic
1035405758 7:158596083-158596105 GACTGAAAGGGTCTGGCAGCTGG - Intergenic
1036585479 8:10119440-10119462 GCTTGGGAGTGGCTTGTAGCAGG + Intronic
1037283653 8:17272170-17272192 GCCTCAAAGAGGCTGTTAGGAGG - Intronic
1037423898 8:18733508-18733530 GCCAAAAAGTGGCTGGCAGATGG + Intronic
1037961877 8:23103640-23103662 TCCTGAAAGTGGCAGGAAGCCGG + Intronic
1038369058 8:26969704-26969726 CCATGAAAGTGGCTGTCAGCTGG + Intergenic
1038815329 8:30897281-30897303 GCCTGAAAGTGGTAGGAAGAGGG - Intergenic
1040969355 8:53116560-53116582 GCCTAGGAGAGGCTGGTAGCTGG + Intergenic
1041899377 8:62964147-62964169 GCCTGAGAGTTGCTCTTAGCAGG + Intronic
1042786224 8:72549993-72550015 TCCAGAAAATGGCTGGTACCTGG - Intronic
1044488373 8:92781358-92781380 GCATGGAAGTGGCTAGTGGCAGG - Intergenic
1045325432 8:101114334-101114356 GCCTGAAAATCGCGGGTAGAGGG + Intergenic
1048527059 8:135212882-135212904 GTATTAAAGTGGCTGGTGGCTGG + Intergenic
1049034347 8:140062628-140062650 GCAGGAATGTGGCTGGTGGCAGG - Intronic
1050276678 9:4008136-4008158 GCCTGAGAGTGGCTGAGAGTGGG + Intronic
1055588499 9:77783809-77783831 GCCTCCAAGTAGCTGGGAGCTGG - Intronic
1057207190 9:93180666-93180688 GCCTGACAGTGTGTGGTGGCAGG - Intergenic
1061300729 9:129703465-129703487 TCCCCAAAGTGGCTGGTATCTGG - Intronic
1185473284 X:397924-397946 GCCTGACAGTGCCTTGAAGCTGG - Intergenic
1187325032 X:18278634-18278656 GCCTGGGAGGGGCTGGTGGCAGG - Intronic
1188580426 X:31705236-31705258 GCCTGATGGTGGGTGGTAGATGG + Intronic
1188811942 X:34661386-34661408 GACTGGAAGTGGGTGGTAGTTGG + Intergenic
1189021626 X:37347915-37347937 GTCTGTAAGTGCCTGGAAGCAGG - Intergenic
1192917896 X:75673549-75673571 CCCTGGGAGTGGCTGGCAGCAGG - Intergenic
1195080350 X:101364507-101364529 GCCTAAAAGCTGCTAGTAGCTGG + Intronic
1196670710 X:118364568-118364590 GCCTGAAAGTGCCTGGCACATGG + Intronic
1196857811 X:120000188-120000210 GCCTGCACGTGGCGGGGAGCCGG + Intergenic
1199783961 X:151087533-151087555 GACTGATGGTGGCTGGTACCAGG - Intergenic
1200964180 Y:9021314-9021336 TCCTGAAAGAGGCTGTGAGCAGG + Intergenic
1202148932 Y:21827487-21827509 TCCTGAAAGAGGCTGTGAGCAGG - Intergenic